Team:GeorgiaTech/WeekNine

From 2010.igem.org

(Difference between revisions)

Revision as of 22:46, 25 October 2010

Georgia Institute of Technology iGEM Team 2010 Homepage

mainbanner

9/26-10/2

9/27/2010

Goals

PCR purify digests of building blocks from 9/25/2010
Start first round of ligations for each construct
Check ligations on gel
Digest; troubleshoot ligations if necessary

Protocols

PCR Purification of Digests from 9/25/2010 (Ompa FR , AOX1a/b FR and FR2, RFP F2R)

Reactions I am purifying:

RFP-F2R (NdeI, SpeI)

OmpA FR (NotI, XmaI)

Aox1a-FR (Xma, SpeI)

Aox1a-FR2 (Xma, NdeI)

Aox1b-FR (Xma, SpeI)

Aox1b-FR2 (Xma, NdeI)

See Protocols page for PCR Purification

Nanospec of Purified digests

RFP-F2R (NdeI, SpeI)= 28.6 ng/uL

OmpA FR (NotI, XmaI)= 15 ng/uL

Aox1a-FR (Xma, SpeI)= 12 ng/uL

Aox1a-FR2 (Xma, NdeI)= 25 ng/uL

Aox1b-FR (Xma, SpeI)= 23 ng/uL

Aox1b-FR2 (Xma, NdeI)= 21.3 ng/uL

Ligations

hyb= [26.2 ng/ul ]/ 393 bp = 0.067 eq/uL

ompa = [15 ng/uL]/81 bp = 0.185 eq/uL

Ligation of HyBb+ Ompa

5.7 uL H20

2 uL of HybB

0.8 uL of Ompa

1 uL 10x Ligase Buffer

0.5 uL T4 Ligase (enzyme-- keep in freezer-- add last of all)

Total 10 uL

RT for 1 hr. - Start time: 11:25 am

Aliquot T4 Buffer:

Make aliquots (5 uL) of the T4 Ligase Buffer so as to not continuously repeat freeze-thaw cycles.

USE FROM ALIQUOTS FROM NOW ON - NOT THE GREEN-CAPPED EPPENDORF.

Miniprep of pSB1A3+hybB+ompA

1. Remove inoculation tubes from inoculation (37C shaker).

2. Obtain P1 buffer from 4C refrigerator.

3. Take centrifuge tubes and add 1.5mL of inoculated cells.

4. Centrifuge at 3000 rpm (low) for 1-2 min.

5. Spin until white pellet of cells forms at the bottom and liquid is more clear.

6. Take off supernatant and discard.

7. Repeat steps 4-6.

8. Resuspend pelleted bacterial cells in 250սL P1 buffer.

9. Add 250սL P2 buffer and invert 4-6 times (DO NOT VORTEX - doing so will shear DNA!)

10. Add 350սL buffer N3 and immediately invert 4-6 times.

11. Centrifuge for 10 min. at 13,000 rpm.

12. Take supernatant and add to spin columns.

13. Spin 30-60 sec. and discard flow through.

14. Wash column with 750սL buffer PE and centrifuge 1 min.

15. Discard flow through and centrifuge and additional minute.

16. Please column into a clean 1.5mL microcentrifuge tube.

17. Elute DNA by adding 30սL dH2O.

18. Let stand for 1 min., then centrifuge for 1 min.

Making a 1 % gel

25*4=100 mL

We found that we had extra left over.

Start at 1:13 pm

End: 2:13 pm

PCR of Hyb+OmpA ligation

3 uL of product of ligation reaction

25.5 uL H2O

10 uL PHUSION 5X Reaction buffer

5 uL HybB-F forward primer

5 uL OmpA-R reverse primer

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

Start: 12:57 pm

End: 3:00 pm (approx)

Plan:

Once PCR is finished, run 4 uL of the reaction on the gel. Check for a band running at a size of 393+81=474 bp, so approximately mid 400-500 bp. If band is observed, prepare for the digest (check for the RE sites based on what primers were used).

Gel Picture

insert gel pic from computer

band around 500 bp.

Nanospec PCR

Christina

326 ng/uL

BASIC PLAN FOR BUILDING PLASMID CONSTRUCTS

from the primered building blocks, which are stored in our freezer

A) RUN GEL - 2 uL each - to check size - this step completed for all building blocks

B) PCR PURIFY leftovers - this step completed for all building blocks

C) NANOSPEC - record concentrations - this step completed for all building blocks

D) DIGEST with restriction enzymes, overnight

E) PCR PURIFY digestion products

F) LIGATION of gene building blocks - we are starting with HybB & RFP

G) PCR ligation products, HybB-RFP

H) DIGEST products, HybB-RFP

I) RUN GEL on small amount of digestion products, HybB-RFP

J) PCR PURIFY the rest of the digestion products, HybB-RFP

K) DIGEST the vector - we are using pBS1A3

L) PCR PURIFY the vector

M) LIGATION of gene with vector, HybB-RFP and pBS1A3

N) TRANSFORMATION of plasmid into E. coli, run overnight

Note- Do a nanospec after PCR purifications

NOTES:

Steps in BOLD are going to be repeated with each plasmid construct. Steps A,B, and C have already been done for each building block and won’t be repeated unless there is a specific issue with a particular building block.
Steps K and L do not necessarily need to wait until step J is completed to be run. They are listed this way so there is no confusion about what is being digested or PCR purified at each step.

9/28/2010

Results from 9/27/2010:

The gel picture of the hybB+ompa is in the folder.

The band is bright at 500 bp, and our predictions confirm the results.
Nanospec results - 326.6 ng/uL
Goals for 9/28/10: PCR purify the PCR (in the yellow box)

Experimental Procedures:

1. Make cryostocks of mRFP:NB cells from starter cultures made on 9/27/2010. 900uL cells+100uL DMSO. Stored in -80C fridge in Gaucher Lab (iGEM box).

Notes

Christina+Rob PCR purified the hyb+ompa PCR.
Richard suggested we can PCR Aox+RFP, then pcr that to the hyb+ompa. This wil take care of two constructs. The other two require Aox a/b to be attached to the hybb+ompa construct
For the constructs that have Aox+RFP, we can do a ligation of Aox to RFP; then, PCR that part and ligate it to the Hyb+ompa.

For the AOX-RFP constructs:

Ligate Aox1a-FR2 to RFP-F2R
LigateAox1b-FR2 to RFP-F2R
PCR each ligation reaction
PCR purify
Check results on gel

Gel extract if PCR results in multiple bands

Digest the Aox-RFP construct
PCR purify
Ligate the Aox-RFP digests to Hyb-Ompa digest
PCR the entire constructs

For the HybB-Ompa-Aox constructs:

Ligate the HybB-Ompa to Aox1a-FR or Aox1b-FR
PCR the constructs
PCR Purify
Check results on gel

if multiple bands, gel extract

Ligate Hyb-Ompa-Aox to pSB1A3
Transform into cells or PCR entire vector

9/29/2010

Goals

Ligate Aox1a-FR2 to RFP-F2R (1hr) -COMPLETED
LigateAox1b-FR2 to RFP-F2R (1hr at same time as step 1) -COMPLETED
Digest HybB.Ompa (3 hours) - COMPLETED

PCR purify hybB.ompA -COMPLETED
Ligate the digested, purified HybB-Ompa to Aox1a-FR -COMPLETED
Ligate the digested, purified HybB-Ompa to Aox1b-FR -COMPLETED

PCR each ligation reaction (3 hr, run simultaneously)

Use Phusion Polymerase
Only 3 ul or so is needed for the PCR
PCR volume can be 30 or 50 uL (50 works fine and gets us lots of DNA)

PCR purify (45 mins max)
Check results on gel (40 mins max)

Gel extract if PCR results in multiple bands (1hr)

Digest the Aox-RFP construct (3 hours or overnight)

Protocols

Make sure all products are digested

hyb.ompa is not digested, so start that today

Ligation of AOX1a-FR2 to RFP-F2R (Scott)

using AOX1a-FR2 from 9/27/2010 and RFP-F2R from 9/27/2010

Calculating equivalents:

RFPF2R- [ 29 ng/uL]/678 bp= 0.0428 eq/uL

AOX1a-FR2-[ 25 ng/uL]/1035 bp = 0.0242 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation:

1.1 uL of RFP F2R

2 uL of AOX1a-FR2

1 uL 10x Ligase Buffer

5.4 uL H20

0.5 uL T4 Ligase

Total=10 uL

Leave RT for 1 hour

Started 10:42 am

Ligation of AOX1b-FR2 to RFP-F2R (Scott)

using AOX1a-FR2 from 9/27/2010 and RFP-F2R from 9/27/2010

Calculating equivalents:

RFP F2,R- [ 29 ng/uL]/678 bp= 0.0428 eq/uL

AOX1b F,R2-[ 21.3 ng/uL]/1047 bp = 0.0203 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation:

1 uL of RFP F2R

2 uL of Aox1b-FR2

1 uL 10x Ligase Buffer

5.5 uL H20

0.5 uL T4 Ligase

Total=10 uL

Leave RT for 1 hour

Started 10:42 am

Digest of HybB.Ompa (Christina)

17 uL of Hyb.Ompa (58.2 ng/uL)

8.5 uL h20

3 uL 10x Buffer B (Promega)

0.75 uL EcoRI

0.75 uL XmaI

Total= 30 uL

37c heating block (with water) for 3 hours

Start: 10:00 pm

End: 1pm

Following digestion, perform a PCR purification according to kit instructions. (See Protocols page for PCR Purification)

Nanospec results of purified, digested hybB.OmpA: 4.1 ng/uL

PCR of Aox1a-FR2.RFP ligation

3 uL of product of ligation reaction

25.5 uL H2O

10 uL PHUSION 5X Reaction buffer

5 uL Aox1a-F forward primer

5 uL RFP-R reverse primer

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

PCR of Aox1b-FR2.RFP ligation

3 uL of product of ligation reaction

25.5 uL H2O

10 uL PHUSION 5X Reaction buffer

5 uL Aox1b-F forward primer

5 uL RFP-R reverse primer

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

PCR ended at 3- Scott and Christina will grab them.

The tube labels could not be read! The tubes were crushed- I have had this happen to me as well. Slight pressure is sufficient. I don’t know which one is aox1a+rfp or aox1b+rfp. I assume the one that looked like “b” is aox1b. PCRS are the in yellow box- I put pcrs in there usually. Note: (@Scott - I (Christina) looked again at the tubes and I think they were labelled “1” and “2” - I in front of the ones you put in the yellow box to verify)

Heat shock transformation of the plasmids into our bacteria

10 սL BL21 cells + 5 սL of plasmid

See Protocols page for Heat Shock Transformation

Picked colonies from plates of HybB+RFP and added to 25 ul of water each. Used 5 ul for PCR, and added 250 ul of LB media to the rest. These tubes are in a green holder in the 37 degrees incubator.

Colony PCR of Hyb.RFP

5 uL of cells

25.5 uL H2O

10 uL GOTAQ 5X Reaction buffer

5 uL HybB-F forward primer

5 uL RFP-R reverse primer

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, TAQ

Total Volume= 50 uL

10 tubes in Block B. Should end at 5 pm. First 5 tubes are from plate 1, and the -10 are from plate 2. Wrote details in Scott’s notebook. Ran out of GOTAQ enzymed for tube 10. Got some from Ryan for this specific PCR, but still ran out =/ So tube 10 may have funky results.

nanospec of digested and purified hybB.ompA: 4.1 ng/uL

Ligation of AOX1a-FR to HybB.Ompa

using purified, digested AOX1a-FR from 9/27/2010 and digested Hyb.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa - [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1a-FR-[ 12 ng/uL]/1035 bp = 0.0116 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation:

2 uL of Aox1a-FR -

2.5 uL of Hyb.Ompa-

1 uL 10x Ligase Buffer-

4 uL H20 -

0.5 uL T4 Ligase

Total=10 uL

leave in 4C overnight.labelled with an “A” on top.

Ligation of AOX1b-FR to HybB.Ompa

using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation:

1 uL of Aox1b-FR -

2.4 uL of Hyb.Ompa

1 uL 10x Ligase Buffer

5.1 uL H20

0.5 uL T4 Ligase

Total=10 uL

leave in 4C overnight - labelled with a “B” on top.

9/30/2010

Goals

Check results form 9.29.2010
Richard/Megan suggested we can do a double ligation for:

[HybB.OmPa.AOX1a-FR.]+[pSB1A3]
[HybB.OmPa.AOX1b-FR].+[pSB1A3]

Similarly, we can do a triple ligation of:

[Hyb.Ompa]+[Aox1a-FR2.RFP]+[pSB1A3]
[Hyb.Ompa]+[Aox1b-FR2.RFP]+[pSB1A3]

Results from 9/29/2010

Plates from 9/29/2010 of the hyb+rfp construct have many red colonies. Each colony has a red center and brownish outer ring surrounding that center.

I put the plates in the refrigerator.

Two gels were prepared to check the results from 9/29:

Gel 1:

Lane 1: 1KB Ladder

Lane 2: Colony pcr tube 1

Lane 3: Colony pcr tube 2

Lane 4: Colony pcr tube 3

Lane 5: Colony pcr tube 4

Lane 6: Colony pcr tube 5

Lane 7: Colony pcr tube 6

Lane 8: Colony pcr tube 7

Results:

Gel 2:

Lane 1: 1KB Ladder

Lane 2: Colony tube 8

Lane 3: Colony tube 9

Lane 4: Colony tube 10

Lane 5: [Aox1a-FR2.RFP] (9.29.2010)

Lane 6: [Aox1b-FR2.RFP] (9.29.2010)

Lane 7:

Lane 8:

Results

The pcrs of Aoxa/b+RFP do not appear clean. The predicted 1700 bp is very faint. We need to troubleshoot!

Successful tubes (All except 7 + 10) placed in 37C shaker in Gauche lab at 3:00pm

Protocols

Ask Richard/Megan volume for triple ligation. Do we need to check concentration of ligations?

I have laid out the proposed double ligation recipes, but check with Richard/Megan. I predict the triple ligations are similar except less water will be used .

What is our plan- do digests from the ligations, or PCR them up and then digest?

PCR of hybB.ompA-Aox1a F,R ligation (Christina)

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL PHUSION 5X Reaction buffer-

5 uL hybB forward primer-

5 uL AOX1a reverse primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

labelled “A, 9-30-10”

PCR of hybB.ompA-Aox1b F,R ligation (Christina)

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL PHUSION 5X Reaction buffer-

5 uL hybB forward primer-

5 uL AOX1B reverse primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

labelled “B, 9-30-10”

Gel for hyb.ompa.aox1a/b PCRs

order:

Lane 1:1kb ladder|

Lane 2: HybB.OmPa.AOX1a-FR (predicted=1509)

Lane 3: HybB.OmPa.AOX1b-FR (predicted=1521 bp)

Results

Inconclusive- the predicted bands do not appear.

List of what is done now:

[HybB.OmPa.AOX1a-FR.] (low volume) (ligations)

[HybB.OmPa.AOX1b-FR] (low volume) (ligations)

[HybB.OmPa.AOX1a-FR] (pcr) (loaded on gel 9.30.2010) (troubleshoot)

[HybB.OmPa.AOX1b-FR] (pcr) (loaded on gel 9.30.2010) (troubleshoot)

[Aox1a-FR2.RFP] (pcr) (doing gel extract today)

[Aox1b-FR2.RFP] (pcr) (doing gel extract today)

[hyb.RFP] (in NB and BL21) (create expression profile)

Notes:

Troubleshooting the

[HybB.OmPa.AOX1a-FR] and [HybB.OmPa.AOX1b-FR] :

make sure elongation time is 2 minutes
make thermocycler compatible with lowest melting temp of primers
troubleshoot pcr by making shorter pcr products, like ompa+aox or hyb+ompa, to make sure template is there
Or just not do PCR and do a triple ligation

[Aox1a-FR2.RFP] and [Aox1b-FR2.RFP]:

Richard suggested we gel extract the aox1a/b+RFP

Triple Ligation of AOX1a/b-FR to HybB.Ompa and pSB1a3(Gita)

using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL

pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL

for linear ligations, use a 2:2:1 ratio of products:product:vector

Ligation:

1.2 uL of Aox1b-FR -

2 uL of Hyb.Ompa

3 ul pSB1A3

1 uL 10x Ligase Buffer

2.3 uL H20

0.5 uL T4 Ligase

Total=10 uL

leave in 4C overnight - labelled with a “B” on top.

Triple Ligation of AOX1a/b-FR to HybB.Ompa and psb1a3 (Gita)

using AOX1a-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1a-FR -[ 25 ng/uL]/1035 bp = 0.0241 eq/uL

pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL

for linear ligations, use a 2:2:1 ratio of products:product:vector

Ligation:

1.4 uL of Aox1a/b-FR -

2 uL of Hyb.Ompa

3 ul pSB1A3

1 uL 10x Ligase Buffer

2.1 uL H20

0.5 uL T4 Ligase

Total=10 uL

leave in 4C overnight - labelled with a “B” on top.

Repeat PCR of hybB.ompA+Aox1a F,R ligation (Christian)

5 uL of product of ligation reaction -

23.5 uL H2O-

10 uL PHUSION 5X Reaction buffer-

5 uL hybbB F primer-

5 uL AOX1a R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

Started 6:50pm

iGEM 2

Changed extension time to 2 mins

Labeled “A” on top and sides

PCR of hybB.ompA+Aox1b F,R ligation (Christian)

5 uL of product of ligation reaction -

23.5 uL H2O-

10 uL PHUSION 5X Reaction buffer-

5 uL hybB F primer-

5 uL AOX1B R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

Started 6:50pm

iGEM 2

Changed extension time to 2 mins

Labeled “B” on top and sides

1% Gel for gel extraction for aox1a-FR2 +RFP, aox1b-FR2+RFP

Notes- about 70-80 mL

See Protocols page for Preparing 1% Agarose Gels

Loading Gel for Gel Extract (going to perform 7pm today)

order:

empty....empty|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP

[loaded 40 ul of each pcr reaction, 9.5 ul of ladder]

start 6:40 pm

Before Gel Extraction

|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP

Targeting the 1500 bp bands

AfterGel Extraction

|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP

Gel Extraction

Notes: similar to the previous ones, elute in 30 uL of water

For Tomorromow

Nanospec the gel extractions and run on gel to check for 1500 bp band
Order Primers!!:

Sequencing Primers for PSB1A3

20-30 bp bindign region

Tm~60

psb1a3-R1

5’ tcgccggcgacgtcag 3’; Tm=62, GC=75%

psb1a3-F1

5’ tccttagctttcgctaaggatgatttctg 3’ tTM=60 GC=41%

Make sequence files for all constructs!
Troubleshoot

[HybB.OmPa.AOX1a-FR] (pcr) (loaded gel 9.30.2010) (troubleshoot) (repeated PCR today)
[HybB.OmPa.AOX1b-FR] (pcr) (loaded gel 9.30.2010) (troubleshoot) (repeated PCR today)
[Aox1a-FR2.RFP] (pcr) (did gel extract today)(but PCR was messy)
[Aox1b-FR2.RFP] (pcr) (did gel extract today)(but PCR was messy)

10/1/2010

Goals

Run gel to check for:

Gel extractions to check for 1500 bp band (aox+rfp)
PCRs of:

[HybB.OmPa.AOX1a-FR] (from 9.30.2010)
[HybB.OmPa.AOX1b-FR] (from 9.30.2010)

Running Gel (Scott)
Predicted:

[HybB.OmPa.AOX1a-FR] ~1500 bp
[HybB.OmPa.AOX1b-FR]~1500 bp
[Aox1a+RFP]~1700 bp
[Aox1b+RFP~1700 bp

Results

The PCRs of Hyb.Ompa.Aox were vey messy- PCR purify them and run them again on a gel:

Gel (Version 1) order:

Gel (Version 2) (Same as Version 1)

For Mitesh, Margo: I ran wrong PCR- Run on gel the PCR labeled from 9.30.2010 as “Repeat” with Christian’s name on it.

Gel extraction has two bands- one is the 1700 one we want, the other isn’t. We need to plan how get the 1700 one; perhaps another gel extract?
We need annotated sequence files-Richard has some starting ones.
We need to design sequencing primers for all the parts once they are in pSB1A3
Debika- Start starter cultures of colonies 9,10, 5 ,6 of hyb+RFP

Protocols

Gel of Repeated PCRs:

Lane 2 [HybB.OmPa.AOX1a-FR] (from 9.30.2010)
Lane 3 [HybB.OmPa.AOX1b-FR] (from 9.30.2010)
Ladder in lane 1 (left most well)

PCRs to troubleshoot hyb.ompa.aox pcrs

PCR of hybB.ompA.Aox1a F,R ligation using Hyb-F and OmpaR [tube label 1]

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL Gotaq 5X Reaction buffer-

5 uL hybB F primer-

5 uL Ompa R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, Gotaq

Total Volume= 50 uL

PCR of hybB.ompA.Aox1b F,R ligation using Hyb-F and OmpaR [tube label 2]

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL Gotaq 5X Reaction buffer-

5 uL hybB F primer-

5 uL Ompa R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, Gotaq

Total Volume= 50 uL

PCR of hybB.ompA.Aox1a F,R ligation using OmpaF and Aox1a-R [tube label 3]

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL Gotaq 5X Reaction buffer-

5 uL Ompa F primer-

5 uL AOX1a R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, Gotaq

Total Volume= 50 uL

PCR of hybB.ompA.Aox1b F,R ligation using OmpaF and Aox1b-R [tube label 4]

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL Gotaq 5X Reaction buffer-

5 uL
5 uL Ompa F primer-

5 uL AOX1B R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, Gotaq

Total Volume= 50 uL

Suggestions

Dr. Gaucher suggested doing a PCR purification of the Ligation reactions, since PCR is sensitive to salts and buffers.

Also a gradient would be useful.

Try increasign annealing temp to 56 or so, 52 is too low he said!

Triple Ligation

richard suggested triple ligation, screen with 20 colonies

Sequences

Primers:

Ompa_3’ end_F_Seq

5’ GCTACCGTTGCGCAAGCT3’

tm=60

GC= 61%

Hybb_3’ end_F_Seq

5’ GCCGCCACCATGGGGTTAAGTAG 3’

tm=63

GC= 61%

Sequencing Primers for PSB1A3

20-30 bp binding region

Tm~60

psb1a3-R1

5’ tcgccggcgacgtcag 3’; Tm=62, GC=75%

psb1a3-F1

5’ tccttagctttcgctaaggatgatttctg 3’ tTM=60 GC=41%

Primer to construct hyb.omp.rfp

RFP-F3

5’[GAGAGA ][CCCGGG]ATGGCGTCTTCTGAAGACGTTAT

RE from RFP-F2 replaced with an XmaI site

For Tomorrow

(Check to make sure the proposed actions for tomorrow make sense!)

Troubleshooting the PCR of hyb.ompa.aox

run the troubleshooting PCRs Margo did today on a gel to check results

Prepare the reactions needed to make hyb.ompa+aox+psb1a3 using a triple ligation

Digest the Pcr of hyb.ompa from
Ligate hyb.ompa+aox+psb1a3

Order primers!

10/2/2010

Goals

If Gaucher lab is open, run results on gel and visualize
Else, start Triple ligation

Do we start from the digested products we have or start from scratch?

Problem: we didn’t transform the triple ligation (hyb.ompa+aox+psb1a4) from 9.30.2010 that Gita did! We can transform that today and start a new triple ligation, and make sure to transform that tomorrow
Make cryo stocks of starter cultures

Protocols:

Heat shock transformation of the NB with triple ligations (hyb.ompa+aox_psb1a3) (Scott)

1. hyb.ompa+aox1a-FR+psb1a3

2. hyb.ompa+aoox1b-FR+psb1a3

10 սL Nova Blue cells + 5 սL of Ligation Reaction (hyb.ompa+aox+psb1a3) from 9.30.2010 that Gita did

See Protocols page for Heat Shock Transformation

Observations of Starter cultures

Culture1 has a slight pink hue, while culture 2 does not; the rest have pink hues less than that of culture 1.

CryoStocks of Start cultures from 10.1.2010 of hyb+RFP+psb1a3 in BL21

Cryostocks

Colonies 1,2,3,4,5,6,8 of HybB+RFP+pSB1A3 in Bl21 cells

600 uL of cells

900 uL Glycerol

Total 1.5 mL

Mix, place in -80c Freezer

Repeat of Triple Ligations (hyb.ompa +aox+psb1a3)

Triple Ligation of AOX1a-FR to HybB.Ompa and psb1a3 (Margo)

using AOX1a-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1a-FR -[ 25 ng/uL]/1035 bp = 0.0241 eq/uL

pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL

for linear ligations, use a 2:2:1 ratio of products:product:vector

Ligation:

1.4 uL of Aox1a/b-FR -

2 uL of Hyb.Ompa

3 ul pSB1A3

1 uL 10x Ligase Buffer

2.1 uL H20

0.5 uL T4 Ligase

Total=10 uL

1 hr RT, labeled A

Ligation Start: 1:14 pm

Triple Ligation of AOX1b-FR to HybB.Ompa (Margo)

using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL

pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL

for linear ligations, use a 2:2:1 ratio of products:product:vector

Ligation:

1.2 uL of Aox1b-FR -

2 uL of Hyb.Ompa

3 ul pSB1A3

1 uL 10x Ligase Buffer

2.3 uL H20

0.5 uL T4 Ligase

Total=10 uL

1 hr RT labeled B

Ligation Start: 1:14 pm

Checking PCR from 10.1.2010 on Gel

Gel start 1:11 pm

Order :

1kb ladder|PCR 1|PCR 2|PCR3|PCR 4 hyb+ompa from 9.28.2010|ladder

PCR1= PCR of hybB.ompA.Aox1a F,R ligation using Hyb-F and OmpaR

PCR2= PCR of hybB.ompA.Aox1b F,R ligation using Hyb-F and OmpaR

PCR3= PCR of hybB.ompA.Aox1a F,R ligation using OmpaF and Aox1a-R

PCR4= PCR of hybB.ompA.Aox1b F,R ligation using OmpaF and Aox1a-R

Observations of Gel

Well 3 (the empty one) should not be empty! Perhaps misloaded?

Heat shock transformation of the NB with triple ligations (HybB.OmpA+AOX_psb1a3) (Margo)

1. hyb.ompa+aox1a-FR+psb1a3 (from 10.2.2010)

2. hyb.ompa+aoox1b-FR+psb1a3 (from 10.2.2010)

10 սL Nova Blue cells + 5 սL of Ligation Reaction (hyb.ompa+aox+psb1a3) from 2 OCT 2010 that Margo did

See Protocols page for Heat Shock Transformation

For Tomorrow

Run on a gel

aoxa, aoxb next to the troubleshooting pcrs from today, specifically of the PCRS using Ompa-F and Aoxa/b-R since they are similar sizes

Take out plates from incubator. Record observations

Run colony PCRs on at least 20 colonies per construct (yes 20)

Check which primers to use for colony pcr! We can likely use the primers we already have
Run results on gel