Team:GeorgiaTech/WeekEleven

From 2010.igem.org

(Difference between revisions)

Revision as of 03:03, 21 October 2010

Georgia Institute of Technology iGEM Team 2010 Homepage

mainbanner

10/10-10-16

10/11/2010

Goals

Prepare a vector for transformation

either :

ligate parts to digested (and purified) linearized psb1a3
find a strain of ecoli that is resistant to ccdb toxic gene to transform psb1a7 into
pcr amplify psb1a7
find a Gaucher vector that is promoterless, amp resistant, and MCS with compatible ECORI and SPEI sites

Running 1% gel

Order:

100bp ladder|psb1a3 digest (from 10/9/2010) using SpeI|psb1a3 digest (from 10/9/2010) using EcoRI +SpeI|

start: 9:31 am

Gel from 10/11/2010

order:100bp ladder|psb1a3 digest (from 10/9/2010) using SpeI|psb1a3 digest (from 10/9/2010) using EcoRI +SpeI|

Predicted sizes: approx 1 kb insert and 2 kb backbone from the SpeI+EcoRI digest

(Note: the first band from the top in the second well (the double digest one) is undigested vector)

Picked white colonies from plates of HybB-ompA-AOX and added to 25 ul of water each. Used 5 ul for PCR, and added 250 ul of LB media to the rest. LOCATION LEFTOVERS

hybB-F,omp-R

hybB-F, Aox(b)-R

RFP-F,R

Colony PCR of hybB-F,omp-R (Christian, Margo, Christina)-Line 1

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 uL HybB-F forward primer

2.5 uL ompA-R reverse primer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 25 uL

Colony PCR of hybB-F, Aox(b)-R (Christian, Margo, Christina)-Line 2

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 uL HybB-F forward primer

2.5 uL AOXb-R reverse primer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 25 uL

Colony PCR of RFP-F,R (Christian, Margo, Christina) Line 3

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 uL RFP-F forward primer

2.5 uL RFP-R reverse primer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 25 uL

	1-HybB-F,ompA-R	2-HybB-F,AoxB-R	3-RFP-F,R
A	HybB,ompA,AoxB(1)	HybB,ompA,AoxB(1)	HybB,ompA,AoxB(1)
B	HybB,ompA,AoxB(1)	HybB,ompA,AoxB(1)	HybB,ompA,AoxB(1)
C	HybB,ompA,AoxB(2)	HybB,ompA,AoxB(2)	HybB,ompA,AoxB(2)
D	HybB,ompA,AoxB(2)	HybB,ompA,AoxB(2)	HybB,ompA,AoxB(2)
E	HybB,ompA,AoxB, pSB1A3 (1)	HybB,ompA,AoxB, pSB1A3 (1)	HybB,ompA,AoxB, pSB1A3 (1)
F	HybB,ompA,AoxB, pSB1A3 (1)	HybB,ompA,AoxB, pSB1A3 (1)	HybB,ompA,AoxB, pSB1A3 (1)
G	HybB,ompA,AoxB, pSB1A3 (2)	HybB,ompA,AoxB, pSB1A3 (2)	HybB,ompA,AoxB, pSB1A3 (2) Contaminated With ice*
H	HybB,ompA,AoxB, pSB1A3 (2)	HybB,ompA,AoxB, pSB1A3 (2)	HybB,ompA,AoxB, pSB1A3 (2) Contaminated with ice*

*note - I dont think that these will be affected too much - water is already an “ingredient.”

Psb1a3 SpeI and EcoRI digest (2 kb band) gel extraction(scott,Debika)

|1kb ladder|4ul of psb1a3 SpeI+EcoRI Digest| 21 uL of psb1a3 SpeI+EcoRI Digest|

1. Excised DNA fragment from the agarose gel with a clean, sharp scalpel.

2. Weighed the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg or approximately 100 μL).

3. Incubated at 50ºC for 10 min (or until the gel slice had completely dissolved). To help dissolve gel, mixed by vortexing the tube every 2 – 3 min during the incubation.

4. After the gel slice has completely dissolved, checked that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).

5. Added 1 gel volume of isopropanol to the sample and mixed.

6. Placed a QIAquick spin column in a provided 2 mL collection tube.

7. To bind DNA, applied the sample to the QIAquick column, and centrifuged for 1 min @13,000k.

8. Discarded flow-through and placed QIAquick column back in the same collection tube.

9. Recommended: Added 0.5 mL of Buffer GQ to QIAquick column and centrifuged for 1 min.

10. To wash, added 0.75 mL of Buffer PE to QIAquick column and centrifuged for 1 min @13,000.

11. Discarded the flow-through and centrifuged the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).

12. Placeed QIAQuick column into a clean 1.5 mL microcentrifuge tube.

13. To elute DNA, added 30 μL water (pH 7.0 – 8.5), let the column stand for 1 min, and then centrifuged for 1 min @13,000k.

(Scott and Christina will do this)

Digest of psb1a7 directly from the well aliquot

7.5 uL H20 -

2 uL 10X ECORI Buffer -

5 uL pSB1A7 (10.11.2010, 107.5 ng/uL)(well aliquot of psb1a7) -

5 uL BSA (1ug/uL, to a final conc of .1mg/ml) - (*note - should have been 3uL)

0.75 uL SpeI -

0.75 uL EcoRI -

Total=22 ul total

Overnight 37C waterbath

Notes:

I propose we gel extract the linearized band by loading all the digest (from 10/9/2010) onto a larger well and cutting the 2kb band out (the middle band if you are looking at the gel picture, in the 3rd well from the left)- Debika and Scott (done)
We also need more 100bp ladder.
Ask Gaucher lab if they have chloramphenicol since psb1c3 needs it - (Done, in frig)
Ask gaucher lab for list of plasmid list -Christina (done)
Colony PCR the previous hyb.ompa.aox, but only the white colonies - Christian and Margo (done)

Order primers that igem suggest for checking our vectors, named VR and VF2 (check to make sure psb1c3, psb1a3, and psb1a7 use these primers)

psb1c3-VF2, VR
psb1a3-VF2, VR
psb1a7-VF2, VR
VF2

5’ tgccacctgacgtctaagaa 3’

check tm, since it is 50 and we may have to increase it

VR

5’ attaccgcctttgagtgagc 3’

check tm, since it is 50 and we may have to increase it

For Tomorrow (10/12/10)

Gel extraction of digested psb1a7 (Someone who has done gel extracts before should do this- we dont have anymore of this left, and Dr. Gaucher wants us to be super careful!)(remember to do it the Gaucher lab way- load ~4 ul in one well, then the rest in another, and only image the 4ul well) (COMPLETE - FAILED) -- we have about 2/3 uL of digested psb1A7 left over.
triple ligation of digested, gel extracted psb1a3 backbone to hyb.ompa and aox a/b

hyb.ompa+aoxa+psb1a3 (COMPLETE)
hyb.ompa+aoxb+psb1a3 (COMPLETE)
Transformation of above mentioned triple ligation into NB cells.

If any gel extracted psb1a3 is left over after triple ligations, load 4 uL on a gel to confirm that gel extraction worked (COMPLETE)
Check colony pcr results from yesterday on a gel (CPMPLETE)
Figure out alternative vectors from the Gaucher lab/ biobricks. pET-15b frp, from gaucher lab doesn’t have speI site, so it won’t work for the hyb.omp.aox construct.

10/12/10

Gel extraction of psb1A7

Done according to protocol, with the aim of extracting psb1A7. Bad results probably a combination of things: bad/old gel (ladder barely visible), etc. We have about 2/3 uL of digested psb1A7 left over for possible pcr, etc.

Results: No DNA observed or extracted

Triple ligation of digested, gel extracted psb1a3 backbone to hyb.ompa and aox a/b

hyb.ompa+aoxa+psb1a3 (see below for protocol)
hyb.ompa+aoxb+psb1a3 (see below for protocol)

Triple ligation of AOX1, HybB, and plasmid constructs

Calculating equivalents:

HybB-ompA [4.1 ng/uL]/474 bp= 0.00865 eq/uL

AOX1a-FR-[12 ng/uL]/1035 bp = 0.0116 eq/uL

AOX1b-FR-[23 ng/uL]/1035 bp = 0.0222 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation of AOX1a constructs:

2.7 uL of HybB-OmpA

1 uL of AOX1a-FR

2 uL of psb1A3

1 uL 10x Ligase Buffer

5.8 uL H20

0.5 uL T4 Ligase

Total=13 uL

Ligation of AOX1a constructs:

2.7 uL of HybB-OmpA

1 uL of AOX1b-FR

2 uL of psb1A3

1 uL 10x Ligase Buffer

5.8 uL H20

0.5 uL T4 Ligase

Total=13 uL

Left at room temp for one hour starting 1:24pm

Ligation of hyb.ompa to RFP-F3R

Calculating equivalents:

hyb.ompa= [4.1 ng/uL from 9.29.2010]

RFP-F3R=[ ng/uL from 10.8.2010]

psb1a3=[11.6 ng/uL from 10.11.2010]

HybB-ompA [4.1 ng/uL,]/474 bp= 0.00865 eq/uL

RFP-F3R= [17.50. ng/uL0.025

psb1a3=[11.6 ng/uL]/2000 bp =0.0058

for linear ligations, use a 2:2:1 ratio of products:product:vector

Protocol:

1 uL of RFP-F3R

2.6 uL of HybB-OmpA

2 uL of psb1A3

1 uL 10x Ligase Buffer

2.9 uL H20

0.5 uL T4 Ligase

Total= uL

Started 4: pm

Check colony pcr results from 10/11/10 on a gel:

pictures from colony PCR strips 1 and 2 (10/11/10) are in the igem gel pics notebook dated 10/12/10 1 and 2, A-H.
picture from colony PCR strip 3 (A-H) (10/11/10) are below. The last two lanes on the second gel are digested psb1a3, faint bands, but clearly present... the gel on the right is old (and also 1.5%).

Transformation of NB cells (to be done after ligations are completed)(Scott

Reactions

triple ligations of hyb.ompa+aox(a/b)+psb1a3
triple ligation of hyb.ompa+RFP-F3R

10 սL Nova Blue cells + 5 սL of Ligation Reaction

See Protocols page for Heat Shock Transformation

10/13/2010

Goals

Repeat the triple ligation of hyb.ompa+RFP-F3R+psb1a3 (try increasing time from1 hr to 2)

Include a negative control (just psb1a3)

Run remaining colony pcrs from 10/11/2010 on gel
Colony PCR or miniprep the colonies from the hyb.ompa+aoxa/b plates

Observations

Plates from 10/12/2010 had colonies (50-100) for the 100 uL hyb.ompa+aoxa/b plates

Protocols

Colony PCRs (to be done)

Rxns:

Hyb F omp R
Aox FR
RFP FR

Picked colonies from plates, added to 25 ul of water each (COMPLETED). Used 5 ul for PCR, and added 250 ul of LB media + .25uL 1000X CARB to the rest. (COMPLETED)

Note: notation is tricky- ask Christina, Scott, Debika

Reactions to do (Primers)>>	Hyb-F, OmpaR (MM same throughout) *	Aoxa/b FR (**,@)	RFP-FR @@	-control
Colony A	1-	2(AoxA)**-	3-	cells only, no primers
B	4-	5 (AoxA)**-	6-
C	7-	8 (AoxA)**-	9-
D	10-	11 (AoxA)**	12-
E	13-	14(AoxB)@-	15-
F	16-	17 (AoxB)@-	18-
G	19-	20 (AoxB)@-	21-
H	22-	23 (AoxB)@-	24-

Colony PCR of hybB-F,omp-R

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 uL HybB-F forward primer

2.5 uL ompA-R reverse primer

0.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, Go-TAQ

Total Volume= 25 uL

Master mix (for all colonies in this rxn) -- labelled *

11.75*8.5= 99.875 uL H20 -

5*8.5= 42.5 uL GOTAQ 5X Reaction buffer -

2.5*8.5 =21.25 uL HybB-F forward primer-

2.5*8.5 =21.25 uL ompA-R reverse primer-

0.5*8.5=4.25 uL dNTP 10 mM -

0.25*8.5=2.125 uL GOTAQ

To each rxn add:

22.5 ul of MM

2.5 uL cells -

Colony PCR of Aoxa-FR (or b)

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 uL Aoxa/b-F forward primer

2.5 uL Aoxa/b-R reverse primer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 25 uL

Master mix for AOXA (for all colonies in this rxn) labelled **

11.75*4.5= 49.93 uL H20 -

5*4.5= 21.25 uL GOTAQ 5X Reaction buffer-

2.5*4.5 =11.25 uL AoxA-F forward primer

2.5*4.5 =11.25 uL AoxA-R reverse primer

0.5*4.5=2.25 uL dNTP 10 mM-

0.25*4.5=1.125 uL GOTAQ

To each rxn add:

22.5 ul of MM

2.5 uL cells -

Master mix for AOXB (for all colonies in this rxn) labelled @

11.75*4.5= 49.93 uL H20 -

5*4.5= 21.25 uL GOTAQ 5X Reaction buffer-

2.5*4.5 =11.25 uL AoxB-F forward primer

2.5*4.5 =11.25 uL AoxB-R reverse primer

0.5*4.5=2.25 uL dNTP 10 mM-

0.25*4.5=1.125 uL GOTAQ

To each rxn add:

22.5 ul of MM

2.5 uL cells -

Colony PCR of RFP-F,R

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 uL RFP-F forward primer

2.5 uL RFP-R reverse primer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 25 uL

Master mix (for all colonies in this rxn) labelled @@

11.75*8.5= 99.875 uL H20 -

5*8.5= 42.5 uL GOTAQ 5X Reaction buffer-

2.5*8.5 =21.25 uL RFP-F forward primer

2.5*8.5 =21.25 uL RFP-R reverse primer

0.5*8.5=4.25 uL dNTP 10 mM-

0.25*8.5=2.125 uL GOTAQ

To each rxn add:

22.5 ul of MM

2.5 uL cells -

- control

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 20 uL

Master mix (for all colonies in this rxn) labelled -

11.75*8.5= 99.875 uL H20-

5*8.5= 42.5 uL GOTAQ 5X Reaction buffer-

0.5*8.5=4.25 uL dNTP 10 mM-

0.25*8.5=2.125 uL GOTAQ-

To each rxn add:

17.5 ul of MM

2.5 uL cells

Get aliquot from Gaucher lab of gotaq. Also send ryan email to order more?

Meeting notes

now( 2 pm)

screen 10 colonies of hyb.ompa+RFP-F3R+psb1a3
check the current colony pcr that is running now by checking on gel

if successful- grow up liquid cultures!
if not

Run more colony pcrs!

pick 10 colonies from each 100uL plate of hyb.ompa+aox+psb1a3
do only 1 rxn

hybF+ompa-R
Aox-F+AoxR

Run on gel

tonight

Set up double digest of psb1a3 miniprep (from 10/7/2010) digest with speI and EcorI

Tomorrow:

gel extract digested psb1a3
triple ligation hyb.ompa+aox+psb1a3
transformation
minipreps if liquid cultures from yesterday were succesful

Colony PCR of hyb.ompa+RFP-F3R+Psb1a3 (from 10/12/2010)

Rxn:

Hyb-F, Ompa-R

Picked colonies from plates, added to 25 ul of water each. Used 2.5 ul for PCR, and added 250 ul of LB media + .25uL 1000X CARB to the rest.

Colony PCR of hyb.ompa+RFP-F3,R+psb1a3

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 u Hyb-F forward primer

2.5 uL Ompa-R reverse primer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 25 uL

Master mix (for all colonies in this rxn) labelled

11.75*11= 129.25 uL H20 -

5*11= 55uL GOTAQ 5X Reaction buffer-

2.5*11 = 27.5 uL hyb-F forward primer

2.5*11= 27.5 uL ompa-R reverse primer

0.5*11= 5.5 uL dNTP 10 mM-

0.25*11= 2.75 uL GOTAQ

To each rxn add:

22.5 ul of MM

2.5 uL cells -

RE Double Digest Recipe for pSB1A3 miniprep (from 10/7/2010) -- digest with speI and EcorI

6.5 uL H20 -

3uL EcoRI Buffer -

16 uL pSB1A3 (10.8.2010, 56 ng/uL)(tube 2) - (note: this was a little less than 16 uL, used the rest of the tube).

3 uL BSA (1ug/uL, to a final conc of .1mg/ml) -

0.75 uL SpeI

0.75 uL EcoRI

Total=30 ul total

Digest overnight - waterbath 37C

Predict a insert (1000 bp) and plasmid (2000 bp)

Results

Loading colony PCRS on gel

Notes: we loaded without adding dyes since Green buffer has dye!

Loading Colony pcrs A-H of hyb.ompa.aox.psb1a3 (10/13/2010) from plates from 10/12/2010 done this morning by Christina, Scott, Debika.

Order:

Exacto ladder|samples 1-6 from colony pcr of colonies A-H on 10/13/2010|ladder|samples 7-14 of colonies A-H from colony PCR on 10/13/2010|ladder

Order:

exacto ladder|samples 15-20 of colonies A-H from colony pcr on 10/13/2010|ladder|samples 20-24 and -control from colonies A-H from colony pcr on 10/13/2010|samples 1(possibly 2-3 but wells were leaky after this well) of rfp-f3r colony pcr from 10/13/2010|ladder

Notes:Note: The wells for 24 and 2 (RFP) are leaky

Reference table:

Reactions to do (Primers)>>	Hyb-F, OmpaR (MM same throughout) *	Aoxa/b FR (**,@)	RFP-FR @@	-control
Colony A	1-	2(AoxA)**-	3-	cells only, no primers
B	4-	5 (AoxA)**-	6-
C	7-	8 (AoxA)**-	9-
D	10-	11 (AoxA)**	12-
E	13-	14(AoxB)@-	15-
F	16-	17 (AoxB)@-	18-
G	19-	20 (AoxB)@-	21-
H	22-	23 (AoxB)@-	24-

Repeat of colony pcrs of hyb.ompa.aoxa.psb1a3 from plates from 10/12/2010 (scott)

Colony	Rxn:Hyb-f Omp R
1a
2a
3a
4a
5a
6a
7a
8a
9a
10a

Colony PCR of hyb.ompa+aoxa+psb1a3 (for above table rxns)

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 uL Hyb-F forward primer

2.5 uL Ompa-R reverse primer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 25 uL

Master mix (for all colonies in this rxn) labelled

11.75*11= 129.25 uL H20 -

5*11= 55uL GOTAQ 5X Reaction buffer-

2.5*11 = 27.5 uL hyb-F forward primer-

2.5*11= 27.5 uL ompa-R reverse prime-r

0.5*11= 5.5 uL dNTP 10 mM-

0.25*11= 2.75 uL GOTAQ

To each rxn add:

22.5 ul of MM

2.5 uL cells -

Notes for people after 6pm:

I did 10 colonies from the aoxA plate- they are in the thermocycler now.

do 10 colonies from aoxB plate

If time alots, make chloramphenicol plates (http://www.k-state.edu/hermanlab/protocols/AntibioticUsage.html)

ours is 1000 x, so use 1uL per 1mL of LB

10/14/2010

Goals

perform colony pcrs on 10 colonies from hyb.ompa.aox.psb1a3 plates from 10/13/2010 (the 100 uL plates) using the reaction hyb-f and omp-r

Gel pictures

Images below are the same gel (different exposures )

samples 1-10 of the RFP-F3R colony pcr of hyb.ompa.RFP-F3R from 10/13/2010 (in freezer)

predicted band ~ 678 bp

Protocols

labelled 1-10B for the aox1b plates (10 colonies/rxns)

Colony	Rxn:Hyb-f Omp R
1b
2b
3b
4b
5b
6b
7b
8b
9b
10b

Colony PCR of hyb.ompa+aoxb-+psb1a3 (for above table rxns) (from 100ul plate from 10/13/2010)

2.5 uL of cells

11.75 uL H2O

5 uL GOTAQ 5X Reaction buffer

2.5 u Hyb-F forward primer

2.5 uL Ompa-R reverse primer

.5 uL dNTP 10 mM - (thawed & kept on ice)

0.25 uL polymerase enzyme, TAQ

Total Volume= 25 uL

Master mix (for all colonies in this rxn) labelled

11.75*11= 129.25 uL H20 --

5*11= 55uL GOTAQ 5X Reaction buffer--

2.5*11 = 27.5 uL hyb-F forward primer--

2.5*11= 27.5 uL ompa-R reverse primer--

0.5*11= 5.5 uL dNTP 10 mM--

0.25*11= 2.75 uL GOTAQ

To each rxn add:

22.5 ul of MM

2.5 uL cells -

Making gels

Gel start: 343pm

loading gels

loading:

the colony pcrs of psb1a3.hyb.ompa.aoxa colonies 1-10 (from 100 uL plates from 10.13.2010)
and the colony pcrs of psb1a3.hyb.ompa.aoxb colonies 1-10( from 100 uL plates from 10.13.2010)

(loaded 10 ul of rxns)

order: (ver 1-4 gels)

Version 1 (left side, high exposure)

Version 2 (left side, normal exposure)

Version 3 (right side, high exposure)

Version 4 (right side, normal exposure)

order

samples 4-6 of aoxb colony pcr|ladder| samples 7-10 of aoxb colony pcr

Making LB media

To make 1L LB (Lysogeny broth) medium:

5g Yeast abstract

10g Tryptone

5g NaCl

To make solid plates, follow the above recipe and add 16g agar per 1L.

Prepared 1L of LB media

.75L liquid broth and .25L to make plates.

Add 4g agar to plate broth (250mL).

Autoclave, leaving lids slightly loosened.

Let cool in water bath at 55C.

Add antibiotic (250uL CMP) to 250 mL LB media used for plates.

For the agar plates, pipetted 25mL into each plate, allow to harden in hood overnight.

Picking colonies (scott)

I am growing up:

colony 10 of aoxa colony pcr (done on 10/13/2010 by Scott)
colonies 1,2,3, of aoxb colony pcr (done on 10/14/2010 by Christina)

chloramphenicol plates

plates made

pick up and put in fridge very early in morn! (COMPLETED)

for tomorrow

reload the 10 colony pcrs of aoxb from 10.14.2010

10/15/10

plan for today:

1. reload the 10 colony pcrs of aoxb from 10.14.2010 ( COMPLETED)

2.Miniprep the liquid cultures in the incubator (large tubes ) (COMPLETED)

3. Gel extract purified and digested psb1a3 from 10-13-10. (COMPLETED)

Protocols:

1. reload the 10 colony pcrs of aoxb from 10.14.2010

note rxn is hyb-f and ompa-r

Results:

ladder| B1|B2| B3|B4| B5|lad.| B6| B7| B8| B9|B10|ladder

2.Miniprep the 4 liquid cultures (10-14-10) in the incubator.

colony 10, Aox1a colony PCR from 10-13 (miniprep label: 10)

33.3 ng/uL
54.7 ng/uL

colony 2, Aox1b colony PCR from 10-14 (miniprep label: 2)

101.7 ng/uL
137.8 ng/uL

colony 1, Aox1b colony PCR from 10-14 (miniprep label: 1)

136.1 ng/uL
186.9 ng/uL

colony 3, Aox1b colony PCR from 10-14 (miniprep label: 3)

92.9 ng/uL
148.4 ng/uL

Psb1a3 SpeI and EcoRI digest (2 kb band) gel extraction(Debika)

|1kb ladder|4ul of psb1a3 SpeI+EcoRI Digest| 21 uL of psb1a3 SpeI+EcoRI Digest|

1. Excised DNA fragment from the agarose gel with a clean, sharp scalpel.

2. Weighed the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg or approximately 100 μL).

top band: .25g = 250mg (add 750 uL buffer QG)

labelled “top” psb1a3

bottom band: .18 g = 180mg (add 540 uL buffer QG)

labelled “bottom”psb1a3

3. Incubated at 50ºC for 10 min (or until the gel slice had completely dissolved). To help dissolve gel, mixed by vortexing the tube every 2 – 3 min during the incubation.

4. After the gel slice has completely dissolved, checked that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose). If not, add 10 uLsodium acetate (5.5 pH, 3M).

added 10uL sodium acetate (5.5 pH, 3M) to psb1a3 “bottom”

5. Added 1 gel volume of isopropanol to the sample and mixed.

add 250 uL isopropanol to “top”
add 180 uL isopropanol to “bottom”

6. Placed a QIAquick spin column in a provided 2 mL collection tube.

7. To bind DNA, applied the sample to the QIAquick column, and centrifuged for 1 min @13,000rmp.

8. Discarded flow-through and placed QIAquick column back in the same collection tube.

9. Recommended: Added 0.5 mL of Buffer GQ to QIAquick column and centrifuged for 1 min.

10. To wash, added 0.75 mL of Buffer PE to QIAquick column and centrifuged for 1 min @13,000.

11. Discarded the flow-through and centrifuged the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).

12. Placeed QIAQuick column into a clean 1.5 mL microcentrifuge tube.

13. To elute DNA, added 30 μL water (pH 7.0 – 8.5), let the column stand for 1 min, and then centrifuged for 1 min @13,000k.

top band nanospec concentration 9.4 ng/uL

labelled “T, 10-15, top band”

bottom band nanospec concentration 9.5 ng/uL

labelled “B, 10-15, bottom band”

both tubes are in the yellow box in the freezer. there’s a big “T” and “B” on top of the tubes.

10/16/2010

Goals

look at gel pictures for aoxa 1-10, aoxb 1-10, rfp-F3r 1-10 and see pick appropriate colonies

note this has been done for colony 10 of aoxa and 1-3 of aoxb, but look at the gel pic of aoxb run again on 10.15.2010.

check the minipreps from 10.15.2010 via digests
redigest the aoxa/b we have now
if needed, start pcrs for new aoxa,b, rfp-F3R

Transform psb1c3 plasmids on chloamphenicol plates (done)

check registry to see if insert is rfp coding or toxic gene (rfp)

overnight digest of purified, digested aoxa-FR and aoxb-FR from (9.23 and 9.27)
digests of minipreps of colony 10 of aoxa and 1-3 of aoxb, (in heat block, 2pm 10.16)

digest the predicted insert out

EcoRI and SpeI

glycerol stocks of the colony pcrs of interest (done)

Protocols

Observations of gel pics

gel pic from 10.15.2010 of hyb.ompa.aoxb.psb1a3

colony 5 appears to have the predicted 500 bp band
colonies 1, 3 6, 8, 9 have a 500 bp band along with 700 bp band
Suggestion: grow up colony 5 and perhaps 2 of the other colonies

gel pic from 10.14.2010 of hyb.ompa.aoxa.psb1a3

The colonies did not exclusively have the predicted 500 bp band, but a few had the band along with a mix of bands. In particular, colony 10 was picked and miniprepped yesterday.

Growing up colony 5 of aoxb (as visualized in gel pic from 10.15.2010)(plate from 10.12.2010) (completed)(Scott)

I inoculated 3 mL of LB+3uL of Carb with 3uL of cells.

Digests of minipreps of colony 10 of aoxa and 1-3 of aoxb (Scott)

colony 10, Aox1a colony PCR from 10-13 (label 10)(54.7 ng/uL)

4.5 uL H20

2uL 10X EcoRI buffer

10 uL hyb.ompa.aoxa.psb1a3 colony 10 miniprep

2 uL BSA (1ug/uL, to a final conc of .1mg/ml)

0.75 uL SpeI

0.75 uL EcoRI

Total=20 ul total

colony 1, Aox1b colony PCR from 10-14 (miniprep label: 1) (186.9 ng/uL)

9.3 uL H20

2uL 10X EcoRI buffer

5.2 uL hyb.ompa.aoxb.psb1a3 colony 1 miniprep

2 uL BSA (1ug/uL, to a final conc of .1mg/ml)

0.75 uL SpeI

0.75 uL EcoRI

Total=20 ul total

colony 2, Aox1b colony PCR from 10-14 (miniprep label: 2)(137.8 ng/uL)

7.5 uL H20

2uL 10X EcoRI buffer

7 uL hyb.ompa.aoxb.psb1a3 colony 2 miniprep

2 uL BSA (1ug/uL, to a final conc of .1mg/ml)

0.75 uL SpeI

0.75 uL EcoRI

Total=20 ul total

colony 3, Aox1b colony PCR from 10-14 (miniprep label: 3) (148.4 ng/uL)

7.5 uL H20

2uL 10X EcoRI buffer

7 uL hyb.ompa.aoxb.psb1a3 colony 3 miniprep

2 uL BSA (1ug/uL, to a final conc of .1mg/ml)

0.75 uL SpeI

0.75 uL EcoRI

Total=20 ul total

Digests started at 11:44 am

Can go all night- I may take them out around 8pm or so. Gaucher suggested overnight digest as norm.

Reconstituting psb1c3 from kit (Scott)

Spring 2010 Distribution

2010 Kit Plate 1

3A

BBa_J04450

Added 10 ul of autoclaved water to well 3a of plate 1.

I also reconstituted Plate 1 1a (psb1a10)

Transformation of NB with psb1c3 (Scott)(completed)

I added 10 ul of NB and 2 uL of psb1c3

started 12:09 pm-end 12:39

incubation start: 12:46 pm

plate at 1:46pm

Cryostocks (Scott)(Completed)

Colonies 1,2,3,5 of hyb.ompa.aoxb.psb1a3 cells in NB (from liq cultures picked from plates made on 10.12.201)

Colony 10 of hyb.ompa.aoxa.psb1a3 cells in NB(from liq cultures picked from plates made on 10.12.201)

250 uL of cells

370 uL Glycerol

Total 0.62 mL

Mix, place in -80c Freezer

Ligation of gel extracted psb1a3 (top band, from 10.15.2010) to [hyb.ompa+aox a] (done Rob)

hyb.ompa= [4.1 ng/uL from 9.29.2010]/478 bp= 0.009 eq/uL

AOX1a-FR -[ 12 ng/uL (from 9.27.2010)]/1035 bp = 0.0115 eq/uL

pSB1A3- [9.4ng/uL]/2056bp=0.00457 eq/uL (labeled T)

for linear ligations, use a 2:2:1 ratio of products:product:vector

2 uL hyb.ompa

1.6 ul aoxa-FR

2 ul psb1a3 (T

1 uL 10 x Ligase buffer

2.9 ul H20

0.5 uLT4 Ligase

Total 10 uL

Ligation of gel extracted psb1a3 (top band, from 10.15.2010) to [hyb.ompa+aox b] (Done Rob)

hyb.ompa= [4.1 ng/uL from 9.29.2010]/478 bp= 0.009 eq/uL

AOX1b-FR -[ 23 ng/uL (from 9.27.2010)]/1035 bp = 0.0222 eq/uL

pSB1A3- [9.4ng/uL]/2056bp=0.00457 eq/uL (labeled T)

for linear ligations, use a 2:2:1 ratio of products:product:vector

2uL hyb.ompa

0.82 ul aoxb-FR

2ul psb1a3

1 uL 10 x Ligase buffer

3.68 ul h20

0.5 uLT4 Ligase

Total 10 uL

Ligation of gel extracted psb1a3 (top band, from 10.15.2010) to [hyb.ompa+RFP-F3R] (Done Rob)

hyb.ompa= [4.1 ng/uL from 9.29.2010]/478 bp= 0.009 eq/uL

RFP-F3R -[ 17.5 ng/uL (from 10.8.2010)]/1035 bp = 0.0169 eq/uL

pSB1A3- [9.4ng/uL]/2056bp=0.00457 eq/uL (labeled T)

for linear ligations, use a 2:2:1 ratio of products:product:vector

2uL hyb.ompa

1.65ul Rfp-F3R (from 10/8/2010)

2ul psb1a3

1 uL 10 x Ligase buffer

2.85 ul h20

0.5 uLT4 Ligase

Total 10 uL

Negative control of ligation(Done Rob)

1.6 ul aoxa-FR

2 ul psb1a3 (T

1 uL 10 x Ligase buffer

4.9 ul H20

0.5 uLT4 Ligase

Total 10 uL

Miniprep of colony b5 of aoxb.hyb.ompa.psb1a3 (from 10.16.2010) (Scott)(done)

Notes: eluted witrh 30 ul of water

To do tomorrow:

miniprep of aoxb colony b5 in the incubator (in large tube)

I used 2ml, so there is 1 ml left if the nanospec of today’s miniprep does not turn out well

Nanospec the minipreps done today
check results of digest on gel

if needed, start pcrs for new aoxa,b, rfp-F3R

overnight digest of purified, digested aoxa-FR and aoxb-FR from (9.23 and 9.27) (or just the purified)
Transform using the ligations done today (hyb.ompa+aoxa/b, hyb.ompa.rfp-F3R)

@@ Line 74: / Line 74: @@
    </map>
 </a></p>
+<title>10/10-10-16</title><style type="text/css">ol{margin:0;padding:0}p{margin:0}.c7{vertical-align:top;width:234.0pt;border-style:solid;border-color:#000000;border-width:1.0pt;padding:5.0pt 5.0pt 5.0pt 5.0pt}.c11{vertical-align:top;width:117.0pt;border-style:solid;border-color:#000000;border-width:1.0pt;padding:5.0pt 5.0pt 5.0pt 5.0pt}.c1{vertical-align:top;width:93.6pt;border-style:solid;border-color:#000000;border-width:1.0pt;padding:5.0pt 5.0pt 5.0pt 5.0pt}.c26{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:216.0pt}.c12{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:36.0pt}.c9{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:72.0pt}.c19{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:108.0pt}.c8{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:144.0pt}.c25{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:180.0pt}.c5{line-height:1.0;text-indent:0pt;direction:ltr}.c0{color:#ffffff;font-size:10pt;font-family:Arial}.c23{line-height:1.15;text-indent:36.0pt;direction:ltr}.c2{line-height:1.15;text-indent:0pt;direction:ltr}.c18{border-collapse:collapse}.c20{list-style-type:square}.c13{list-style-type:disc}.c10{text-decoration:line-through}.c14{height:24pt}.c3{font-weight:bold}.c16{height:0pt}.c22{height:33pt}.c21{margin-left:36.0pt}.c15{list-style-type:circle}.c24{background-color:#ffffff}.c4{text-decoration:underline}.c17{margin-left:10.0pt}.c6{font-style:italic}</style></head><body class="c24"><p class="c2"><span class="c0 c3">10/11/2010</span></p><p class="c2"><span class="c0 c4">Goals</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">Prepare a vector for transformation</span></li></ol><ol class="c15"><li class="c9" value="1"><span class="c0">either :</span></li></ol><ol class="c20"><li class="c19" value="1"><span class="c0">ligate parts to digested (and purified) linearized psb1a3</span></li><li class="c19"><span class="c0">find a strain of ecoli that is resistant to ccdb toxic gene to transform psb1a7 into</span></li><li class="c19"><span class="c0">pcr amplify psb1a7</span></li><li class="c19"><span class="c0">find a Gaucher vector that is promoterless, amp resistant, and MCS with compatible ECORI and SPEI sites</span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Running 1% gel</span></p><p class="c2"><span class="c0">Order:</span></p><p class="c2"><span class="c0">100bp ladder|psb1a3 digest (from 10/9/2010) using SpeI|psb1a3 digest (from 10/9/2010) using EcoRI +SpeI|</span></p><p class="c2"><span class="c0">start: 9:31 am</span></p><p class="c2"><img height="295.0" src="images/image1.png" width="395.0"></p><p class="c2"><span class="c0 c6">Gel from 10/11/2010</span></p><p class="c2"><span class="c0 c6">order:100bp ladder|psb1a3 digest (from 10/9/2010) using SpeI|psb1a3 digest (from 10/9/2010) using EcoRI +SpeI|</span></p><p class="c2"><span class="c0 c6">Predicted sizes: approx 1 kb insert and 2 kb backbone from the SpeI+EcoRI digest</span></p><p class="c2"><span class="c0">(Note: the first band from the top in the second well (the double digest one) is undigested vector)</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2 c21"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Picked white colonies from plates of HybB-ompA-AOX and added to 25 ul of water each. Used 5 ul for PCR, and added 250 ul of LB media to the rest. LOCATION LEFTOVERS</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">hybB-F,omp-R</span></p><p class="c2"><span class="c0">hybB-F, Aox(b)-R</span></p><p class="c2"><span class="c0">RFP-F,R</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of </span><span class="c0">hybB-F,omp-R</span><span class="c0 c4"> (Christian, Margo, Christina)-Line 1</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 uL HybB-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL ompA-R reverse primer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of </span><span class="c0">hybB-F, Aox(b)-R</span><span class="c0 c4"> (Christian, Margo, Christina)-Line 2</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 uL HybB-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL AOXb-R reverse primer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of </span><span class="c0">RFP-F,R</span><span class="c0 c4"> (Christian, Margo, Christina) Line 3</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 uL RFP-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL RFP-R reverse primer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><table cellpadding="0" cellspacing="0" class="c18"><tbody><tr><td class="c11"><p class="c5"><span class="c0 c3">&nbsp;</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">1-HybB-F,ompA-R</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">2-HybB-F,AoxB-R</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">3-RFP-F,R</span></p></td></tr><tr><td class="c11"><p class="c5"><span class="c0 c3">A</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(1)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(1)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(1)</span></p></td></tr><tr><td class="c11"><p class="c5"><span class="c0 c3">B</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(1)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(1)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(1)</span></p></td></tr><tr><td class="c11"><p class="c5"><span class="c0 c3">C</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(2)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(2)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(2)</span></p></td></tr><tr><td class="c11"><p class="c5"><span class="c0 c3">D</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(2)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(2)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB(2)</span></p></td></tr><tr><td class="c11"><p class="c5"><span class="c0 c3">E</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (1)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (1)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (1)</span></p></td></tr><tr><td class="c11"><p class="c5"><span class="c0 c3">F</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (1)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (1)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (1)</span></p></td></tr><tr><td class="c11"><p class="c5"><span class="c0 c3">G</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (2)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (2)</span></p></td><td class="c11"><p class="c5"><span class="c0 c10 c3">HybB,ompA,AoxB, pSB1A3 (2) </span><span class="c0 c3">Contaminated With ice*</span></p></td></tr><tr><td class="c11"><p class="c5"><span class="c0 c3">H</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (2)</span></p></td><td class="c11"><p class="c5"><span class="c0 c3">HybB,ompA,AoxB, pSB1A3 (2)</span></p></td><td class="c11"><p class="c5"><span class="c0 c10 c3">HybB,ompA,AoxB, pSB1A3 (2) </span><span class="c0 c3">Contaminated with ice*</span></p></td></tr></tbody></table><p class="c2"><span class="c0 c3">*note - I dont think that these will be affected too much &nbsp;- water is already an &ldquo;ingredient.&rdquo;</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">Psb1a3 SpeI and EcoRI digest (2 kb band) gel extraction(scott,Debika)</span></p><p class="c2"><span class="c0">|1kb ladder|4ul of psb1a3 SpeI+EcoRI Digest| 21 uL of psb1a3 SpeI+EcoRI Digest|</span></p><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0">1. Excised DNA fragment from the agarose gel with a clean, sharp scalpel.</span></p><p class="c2"><span class="c0">2. Weighed the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg or approximately 100 &mu;L).</span></p><p class="c2"><span class="c0">3. Incubated at 50&ordm;C for 10 min (or until the gel slice had completely dissolved). To help dissolve gel, mixed by vortexing the tube every 2 &ndash; 3 min during the incubation.</span></p><p class="c2"><span class="c0">4. After the gel slice has completely dissolved, checked that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose).</span></p><p class="c2"><span class="c0">5. Added 1 gel volume of isopropanol to the sample and mixed.</span></p><p class="c2"><span class="c0">6. Placed a QIAquick spin column in a provided 2 mL collection tube.</span></p><p class="c2"><span class="c0">7. To bind DNA, applied the sample to the QIAquick column, and centrifuged for 1 min @13,000k.</span></p><p class="c2"><span class="c0">8. Discarded flow-through and placed QIAquick column back in the same collection tube.</span></p><p class="c2"><span class="c0 c10">9. Recommended: Added 0.5 mL of Buffer GQ to QIAquick column and centrifuged for 1 min.</span></p><p class="c2"><span class="c0">10. To wash, added 0.75 mL of Buffer PE to QIAquick column and centrifuged for 1 min @13,000.</span></p><p class="c2"><span class="c0">11. Discarded the flow-through and centrifuged the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm).</span></p><p class="c2"><span class="c0">12. Placeed QIAQuick column into a clean 1.5 mL microcentrifuge tube.</span></p><p class="c2"><span class="c0">13. To elute DNA, added 30 &nbsp;&mu;L water (pH 7.0 &ndash; 8.5), let the column stand for 1 min, and then centrifuged for 1 min @13,000k.</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">(Scott and Christina will do this)</span></p><p class="c2"><span class="c0 c4">Digest of psb1a7 directly from the well aliquot</span></p><p class="c2"><span class="c0">7.5 uL H20 -</span></p><p class="c2"><span class="c0">2 uL 10X ECORI Buffer -</span></p><p class="c2"><span class="c0">5 uL pSB1A7 (10.11.2010, 107.5 ng/uL)(well aliquot of psb1a7) -</span></p><p class="c2"><span class="c0">5 uL BSA (1ug/uL, to a final conc of .1mg/ml) - (*note - should have been 3uL)</span></p><p class="c2"><span class="c0">0.75 uL SpeI -</span></p><p class="c2"><span class="c0">0.75 uL EcoRI -</span></p><p class="c2"><span class="c0 c3">Total=22 ul total</span></p><p class="c2"><span class="c0">Overnight 37C waterbath</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Notes:</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">I propose we gel extract the linearized band by loading all the digest (from 10/9/2010) onto a larger well and cutting the 2kb band out (the middle band if you are looking at the gel picture, in the 3rd well from the left)- Debika and Scott (done)</span></li><li class="c12"><span class="c0">We also need more 100bp ladder.</span></li><li class="c12"><span class="c0">Ask Gaucher lab if they have chloramphenicol since psb1c3 needs it - (Done, in frig)</span></li><li class="c12"><span class="c0">Ask gaucher lab for list of plasmid list -Christina (done)</span></li><li class="c12"><span class="c0">Colony PCR the previous hyb.ompa.aox, but only the white colonies - Christian and Margo (done)</span></li></ol><ol class="c13"><li class="c12" value="1"><span class="c0">Order primers that igem suggest for checking our vectors, named VR and VF2 (check to make sure psb1c3, psb1a3, and psb1a7 use these primers)</span></li></ol><ol class=""><li class="c9" value="1"><span class="c0">psb1c3-VF2, VR</span></li><li class="c9"><span class="c0">psb1a3-VF2, VR</span></li><li class="c9"><span class="c0">psb1a7-VF2, VR</span></li><li class="c9"><span class="c0">VF2</span></li></ol><ol class=""><li class="c19" value="1"><span class="c0">5&rsquo; tgccacctgacgtctaagaa 3&rsquo;</span></li></ol><ol class=""><li class="c8" value="1"><span class="c0">check tm, since it is 50 and we may have to increase it</span></li></ol><ol class="c15"><li class="c9" value="5"><span class="c0">VR</span></li></ol><ol class="c20"><li class="c19" value="2"><span class="c0">5&rsquo; attaccgcctttgagtgagc 3&rsquo;</span></li></ol><ol class="c13"><li class="c8" value="1"><span class="c0">check tm, since it is 50 and we may have to increase it</span></li></ol><p class="c2"><span class="c0 c4">For Tomorrow (10/12/10)</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">Gel extraction of digested psb1a7 (Someone who has done gel extracts before should do this- we dont have anymore of this left, and Dr. Gaucher wants us to be super careful!)(remember to do it the Gaucher lab way- load ~4 ul in one well, then the rest in another, and only image the 4ul well) (COMPLETE - FAILED) -- we have about 2/3 uL of digested psb1A7 left over.</span></li><li class="c12"><span class="c0">triple ligation of digested, gel extracted psb1a3 backbone to hyb.ompa and aox a/b</span></li></ol><ol class="c15"><li class="c9" value="1"><span class="c0">hyb.ompa+aoxa+psb1a3 (COMPLETE)</span></li><li class="c9"><span class="c0">hyb.ompa+aoxb+psb1a3 (COMPLETE)</span></li><li class="c9"><span class="c0">Transformation of above mentioned triple ligation into NB cells.</span></li></ol><ol class="c13"><li class="c12" value="3"><span class="c0">If any gel extracted psb1a3 is left over after triple ligations, load 4 uL on a gel to confirm that gel extraction worked (COMPLETE)</span></li><li class="c12"><span class="c0">Check colony pcr results from yesterday on a gel (CPMPLETE)</span></li><li class="c12"><span class="c0">Figure out alternative vectors from the Gaucher lab/ biobricks. pET-15b frp, from gaucher lab doesn&rsquo;t have speI site, so it won&rsquo;t work for the hyb.omp.aox construct. &nbsp;</span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3 c4">10/12/10</span></p><p class="c2"><span class="c0 c3 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">Gel extraction of psb1A7</span></p><p class="c2"><span class="c0">Done according to protocol, with the aim of extracting psb1A7. &nbsp;Bad results probably a combination of things: bad/old gel (ladder barely visible), etc. We have about 2/3 uL of digested psb1A7 left over for possible pcr, etc.</span></p><p class="c23"><span class="c0 c4">Results: No DNA observed or extracted</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Triple ligation of digested, gel extracted psb1a3 backbone to hyb.ompa and aox a/b</span></p><ol class="c15"><li class="c9" value="1"><span class="c0">hyb.ompa+aoxa+psb1a3 (see below for protocol)</span></li><li class="c9"><span class="c0">hyb.ompa+aoxb+psb1a3 (see below for protocol)</span></li></ol><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">Triple ligation of AOX1, HybB, and plasmid constructs</span></p><p class="c2"><span class="c0 c6">Calculating equivalents:</span></p><p class="c2"><span class="c0">HybB-ompA [4.1 ng/uL]/474 bp= 0.00865 eq/uL</span></p><p class="c2"><span class="c0">AOX1a-FR-[12 ng/uL]/1035 bp = 0.0116 eq/uL</span></p><p class="c2"><span class="c0">AOX1b-FR-[23 ng/uL]/1035 bp = 0.0222 eq/uL</span></p><p class="c2"><span class="c0">for linear ligations, use a 1:1 ratio of products</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Ligation of AOX1a constructs:</span></p><p class="c2"><span class="c0">2.7 uL of HybB-OmpA</span></p><p class="c2"><span class="c0">1 uL of AOX1a-FR</span></p><p class="c2"><span class="c0">2 uL of psb1A3</span></p><p class="c2"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c2"><span class="c0">5.8 uL H20</span></p><p class="c2"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c2"><span class="c0 c3">Total=13 uL</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Ligation of AOX1a constructs:</span></p><p class="c2"><span class="c0">2.7 uL of HybB-OmpA</span></p><p class="c2"><span class="c0">1 uL of AOX1b-FR</span></p><p class="c2"><span class="c0">2 uL of psb1A3</span></p><p class="c2"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c2"><span class="c0">5.8 uL H20</span></p><p class="c2"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c2"><span class="c0 c3">Total=13 uL</span></p><p class="c2"><span class="c0">Left at room temp for one hour starting 1:24pm</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Ligation of hyb.ompa to RFP-F3R</span></p><p class="c2"><span class="c0 c6">Calculating equivalents:</span></p><p class="c2"><span class="c0">hyb.ompa= [4.1 ng/uL from 9.29.2010]</span></p><p class="c2"><span class="c0">RFP-F3R=[ ng/uL from 10.8.2010]</span></p><p class="c2"><span class="c0">psb1a3=[11.6 ng/uL from 10.11.2010]</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">HybB-ompA [4.1 ng/uL,]/474 bp= 0.00865 eq/uL</span></p><p class="c2"><span class="c0">RFP-F3R= [17.50. &nbsp;ng/uL0.025</span></p><p class="c2"><span class="c0">psb1a3=[11.6 ng/uL]/2000 bp =0.0058</span></p><p class="c2"><span class="c0">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c2"><span class="c0 c3">Protocol:</span></p><p class="c2"><span class="c0">1 uL of RFP-F3R</span></p><p class="c2"><span class="c0">2.6 uL of HybB-OmpA</span></p><p class="c2"><span class="c0">2 uL of psb1A3</span></p><p class="c2"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c2"><span class="c0">2.9 uL H20</span></p><p class="c2"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c2"><span class="c0 c3">Total= uL</span></p><p class="c2"><span class="c0">Started 4: pm</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Check colony pcr results from 10/11/10 on a gel:</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">pictures from colony PCR strips 1 and 2 (10/11/10) are in the igem gel pics notebook dated 10/12/10 1 and 2, A-H. </span></li><li class="c12"><span class="c0">picture from colony PCR strip 3 &nbsp;(A-H) (10/11/10) are below. The last two lanes on the second gel are digested psb1a3, faint bands, but clearly present... the gel on the right is old (and also 1.5%). </span></li><li class="c12"><img height="194.0" src="images/image3.png" width="260.0"></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Transformation of NB cells (to be done after ligations are completed)(Scott</span></p><p class="c2"><span class="c0">Reactions</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">triple ligations of hyb.ompa+aox(a/b)+psb1a3</span></li><li class="c12"><span class="c0">triple ligation of hyb.ompa+RFP-F3R</span></li></ol><p class="c2"><span class="c0">10 &#1405;L Nova Blue cells + 5 &#1405;L of Ligation Reaction </span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3 c6">See Protocols page for Heat Shock Transformation</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">10/13/2010</span></p><p class="c2"><span class="c0 c4">Goals</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">Repeat the triple ligation of hyb.ompa+RFP-F3R+psb1a3 (try increasing time from1 hr to 2)</span></li></ol><ol class="c15"><li class="c9" value="1"><span class="c0">Include a negative control (just psb1a3)</span></li></ol><ol class=""><li class="c12" value="2"><span class="c0">Run remaining colony pcrs from 10/11/2010 on gel</span></li><li class="c12"><span class="c0">Colony PCR or miniprep the colonies from the hyb.ompa+aoxa/b plates</span></li></ol><p class="c2"><span class="c0 c4">Observations</span></p><p class="c2"><span class="c0">Plates from 10/12/2010 had colonies (50-100) for the 100 uL hyb.ompa+aoxa/b plates</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Protocols</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCRs (to be done)</span></p><p class="c2"><span class="c0">Rxns:</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">Hyb F omp R</span></li><li class="c12"><span class="c0">Aox FR</span></li><li class="c12"><span class="c0">RFP FR</span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Picked colonies from plates, added to 25 ul of water each (COMPLETED). Used 5 ul for PCR, and added 250 ul of LB media + .25uL 1000X CARB to the rest. (COMPLETED)</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Note: notation is tricky- ask Christina, Scott, Debika</span></p><table cellpadding="0" cellspacing="0" class="c18"><tbody><tr><td class="c1"><p class="c5"><span class="c0">Reactions to do (Primers)&gt;&gt;</span></p></td><td class="c1"><p class="c5"><span class="c0">Hyb-F, OmpaR</span></p><p class="c5"><span class="c0">(MM same throughout)</span></p><p class="c5"><span class="c0">*</span></p></td><td class="c1"><p class="c5"><span class="c0">Aoxa/b FR</span></p><p class="c5"><span class="c0">(**,@)</span></p></td><td class="c1"><p class="c5"><span class="c0">RFP-FR</span></p><p class="c5"><span class="c0">@@</span></p></td><td class="c1"><p class="c5"><span class="c0">-control</span></p></td></tr><tr><td class="c1"><p class="c5"><span class="c0">Colony </span><span class="c0 c3">A</span></p><p class="c5"><span class="c0">&nbsp;</span></p></td><td class="c1"><p class="c5"><span class="c0">1-</span></p></td><td class="c1"><p class="c5"><span class="c0">2</span><span class="c0 c3">(AoxA)**-</span></p></td><td class="c1"><p class="c5"><span class="c0">3-</span></p></td><td class="c1"><p class="c5"><span class="c0">cells only, no primers</span></p></td></tr><tr><td class="c1"><p class="c5"><span class="c0 c3">B</span></p></td><td class="c1"><p class="c5"><span class="c0">4-</span></p></td><td class="c1"><p class="c5"><span class="c0">5 </span><span class="c0 c3">(AoxA)**-</span></p></td><td class="c1"><p class="c5"><span class="c0">6-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c1"><p class="c5"><span class="c0 c3">C</span></p></td><td class="c1"><p class="c5"><span class="c0">7-</span></p></td><td class="c1"><p class="c5"><span class="c0">8 </span><span class="c0 c3">(AoxA)**-</span></p></td><td class="c1"><p class="c5"><span class="c0">9-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c1"><p class="c5"><span class="c0 c3">D</span></p></td><td class="c1"><p class="c5"><span class="c0">10-</span></p></td><td class="c1"><p class="c5"><span class="c0">11 </span><span class="c0 c3">(AoxA)**</span></p></td><td class="c1"><p class="c5"><span class="c0">12-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c14"><td class="c1"><p class="c5"><span class="c0 c3">E</span></p></td><td class="c1"><p class="c5"><span class="c0">13-</span></p></td><td class="c1"><p class="c5"><span class="c0">14</span><span class="c0 c3">(AoxB)@-</span></p></td><td class="c1"><p class="c5"><span class="c0">15-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c1"><p class="c5"><span class="c0 c3">F</span></p></td><td class="c1"><p class="c5"><span class="c0">16-</span></p></td><td class="c1"><p class="c5"><span class="c0">17 (</span><span class="c0 c3">AoxB)@-</span></p></td><td class="c1"><p class="c5"><span class="c0">18-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c1"><p class="c5"><span class="c0 c3">G</span></p></td><td class="c1"><p class="c5"><span class="c0">19-</span></p></td><td class="c1"><p class="c5"><span class="c0">20 (</span><span class="c0 c3">AoxB)@-</span></p></td><td class="c1"><p class="c5"><span class="c0">21-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c1"><p class="c5"><span class="c0 c3">H</span></p></td><td class="c1"><p class="c5"><span class="c0">22-</span></p></td><td class="c1"><p class="c5"><span class="c0">23 (</span><span class="c0 c3">AoxB)@-</span></p></td><td class="c1"><p class="c5"><span class="c0">24-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr></tbody></table><p class="c2"><span class="c0 c10">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of hybB-F,omp-R </span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 uL HybB-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL ompA-R reverse primer</span></p><p class="c2"><span class="c0">0.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, Go-TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">Master mix (for all colonies in this rxn) -- labelled *</span></p><p class="c2"><span class="c0 c3">11.75*8.5= 99.875 uL H20 -</span></p><p class="c2"><span class="c0 c3">5*8.5= 42.5 uL GOTAQ 5X Reaction buffer -</span></p><p class="c2"><span class="c0 c3">2.5*8.5 =21.25 uL HybB-F forward primer-</span></p><p class="c2"><span class="c0 c3">2.5*8.5 =21.25 uL ompA-R reverse primer-</span></p><p class="c2"><span class="c0 c3">0.5*8.5=4.25 uL dNTP 10 mM -</span></p><p class="c2"><span class="c0 c3">0.25*8.5=2.125 uL GOTAQ</span></p><p class="c2"><span class="c0 c6">To each rxn add:</span></p><p class="c2"><span class="c0 c6">22.5 ul of MM</span></p><p class="c2"><span class="c0 c6">2.5 uL cells -</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of Aoxa-FR (or b)</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 uL Aoxa/b-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL Aoxa/b-R reverse primer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">Master mix for AOXA (for all colonies in this rxn) labelled **</span></p><p class="c2"><span class="c0 c3">11.75*4.5= 49.93 uL H20 -</span></p><p class="c2"><span class="c0 c3">5*4.5= 21.25 uL GOTAQ 5X Reaction buffer-</span></p><p class="c2"><span class="c0 c3">2.5*4.5 =11.25 uL AoxA-F forward primer</span></p><p class="c2"><span class="c0 c3">2.5*4.5 =11.25 uL AoxA-R reverse primer</span></p><p class="c2"><span class="c0 c3">0.5*4.5=2.25 uL dNTP 10 mM-</span></p><p class="c2"><span class="c0 c3">0.25*4.5=1.125 uL GOTAQ</span></p><p class="c2"><span class="c0 c6">To each rxn add:</span></p><p class="c2"><span class="c0 c6">22.5 ul of MM</span></p><p class="c2"><span class="c0 c6">2.5 uL cells -</span></p><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><span class="c0 c3">Master mix for AOXB (for all colonies in this rxn) labelled @</span></p><p class="c2"><span class="c0 c3">11.75*4.5= 49.93 uL H20 -</span></p><p class="c2"><span class="c0 c3">5*4.5= 21.25 uL GOTAQ 5X Reaction buffer-</span></p><p class="c2"><span class="c0 c3">2.5*4.5 =11.25 uL AoxB-F forward primer</span></p><p class="c2"><span class="c0 c3">2.5*4.5 =11.25 uL AoxB-R reverse primer</span></p><p class="c2"><span class="c0 c3">0.5*4.5=2.25 uL dNTP 10 mM-</span></p><p class="c2"><span class="c0 c3">0.25*4.5=1.125 uL GOTAQ</span></p><p class="c2"><span class="c0 c6">To each rxn add:</span></p><p class="c2"><span class="c0 c6">22.5 ul of MM</span></p><p class="c2"><span class="c0 c6">2.5 uL cells - </span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of RFP-F,R</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 uL RFP-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL RFP-R reverse primer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL </span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">Master mix (for all colonies in this rxn) labelled @@</span></p><p class="c2"><span class="c0 c3">11.75*8.5= 99.875 uL H20 -</span></p><p class="c2"><span class="c0 c3">5*8.5= 42.5 uL GOTAQ 5X Reaction buffer-</span></p><p class="c2"><span class="c0 c3">2.5*8.5 =21.25 uL RFP-F forward primer</span></p><p class="c2"><span class="c0 c3">2.5*8.5 =21.25 uL RFP-R reverse primer</span></p><p class="c2"><span class="c0 c3">0.5*8.5=4.25 uL dNTP 10 mM-</span></p><p class="c2"><span class="c0 c3">0.25*8.5=2.125 uL GOTAQ</span></p><p class="c2"><span class="c0 c6">To each rxn add:</span></p><p class="c2"><span class="c0 c6">22.5 ul of MM</span></p><p class="c2"><span class="c0 c6">2.5 uL cells -</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">- control</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 20 uL</span></p><p class="c2"><span class="c0 c4 c6">&nbsp;</span></p><p class="c2"><span class="c0 c3">Master mix (for all colonies in this rxn) labelled -</span></p><p class="c2"><span class="c0 c3">11.75*8.5= 99.875 uL H20-</span></p><p class="c2"><span class="c0 c3">5*8.5= 42.5 uL GOTAQ 5X Reaction buffer-</span></p><p class="c2"><span class="c0 c3">0.5*8.5=4.25 uL dNTP 10 mM-</span></p><p class="c2"><span class="c0 c3">0.25*8.5=2.125 uL GOTAQ-</span></p><p class="c2"><span class="c0 c6">To each rxn add:</span></p><p class="c2"><span class="c0 c6">17.5 ul of MM</span></p><p class="c2"><span class="c0 c6">2.5 uL cells </span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">Get aliquot from Gaucher lab of gotaq. Also send ryan email to order more?</span></p><hr><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0">Meeting notes</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">now( 2 pm)</span></li></ol><ol class="c15"><li class="c9" value="1"><span class="c0">screen 10 colonies of hyb.ompa+RFP-F3R+psb1a3</span></li><li class="c9"><span class="c0">check the current colony pcr that is running now by checking on gel</span></li></ol><ol class="c20"><li class="c19" value="1"><span class="c0">if successful- grow up liquid cultures!</span></li><li class="c19"><span class="c0">if not</span></li></ol><ol class="c13"><li class="c8" value="1"><span class="c0">Run more colony pcrs!</span></li></ol><ol class="c15"><li class="c25" value="1"><span class="c0">pick 10 colonies from each 100uL plate of hyb.ompa+aox+psb1a3</span></li><li class="c25"><span class="c0">do only 1 rxn</span></li></ol><ol class="c20"><li class="c26" value="1"><span class="c0">hybF+ompa-R</span></li><li class="c26"><span class="c0">Aox-F+AoxR</span></li></ol><ol class="c15"><li class="c25" value="3"><span class="c0">Run on gel</span></li></ol><ol class="c13"><li class="c12" value="2"><span class="c0">tonight </span></li></ol><ol class="c15"><li class="c9" value="3"><span class="c0">Set up double digest of psb1a3 &nbsp;miniprep (from 10/7/2010) digest with speI and EcorI</span></li></ol><ol class="c13"><li class="c12" value="3"><span class="c0">Tomorrow:</span></li></ol><ol class=""><li class="c9" value="1"><span class="c0">gel extract digested psb1a3</span></li><li class="c9"><span class="c0">triple ligation hyb.ompa+aox+psb1a3</span></li><li class="c9"><span class="c0">transformation</span></li><li class="c9"><span class="c0">minipreps if liquid cultures from yesterday were succesful</span></li></ol><hr><p class="c2 c21"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of hyb.ompa+RFP-F3R+Psb1a3 (from 10/12/2010)</span></p><p class="c2"><span class="c0">Rxn:</span></p><p class="c2"><span class="c0">Hyb-F, Ompa-R</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Picked colonies from plates, added to 25 ul of water each. Used 2.5 ul for PCR, and added 250 ul of LB media + .25uL 1000X CARB to the rest. </span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of hyb.ompa+RFP-F3,R+psb1a3</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 u Hyb-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL Ompa-R reverse primer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL </span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">Master mix (for all colonies in this rxn) labelled </span></p><p class="c2"><span class="c0 c3">11.75*11= 129.25 uL H20 -</span></p><p class="c2"><span class="c0 c3">5*11= &nbsp;55uL GOTAQ 5X Reaction buffer-</span></p><p class="c2"><span class="c0 c3">2.5*11 = 27.5 uL hyb-F forward primer</span></p><p class="c2"><span class="c0 c3">2.5*11= 27.5 uL ompa-R reverse primer</span></p><p class="c2"><span class="c0 c3">0.5*11= 5.5 uL dNTP 10 mM-</span></p><p class="c2"><span class="c0 c3">0.25*11= 2.75 uL GOTAQ</span></p><p class="c2"><span class="c0 c6">To each rxn add:</span></p><p class="c2"><span class="c0 c6">22.5 ul of MM</span></p><p class="c2"><span class="c0 c6">2.5 uL cells -</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">RE Double Digest Recipe for pSB1A3 miniprep (from 10/7/2010) -- digest with speI and EcorI</span></p><p class="c2"><span class="c0">6.5 uL H20 - </span></p><p class="c2"><span class="c0">3uL EcoRI Buffer -</span></p><p class="c2"><span class="c0">16 uL pSB1A3 (10.8.2010, 56 ng/uL)(tube 2) - </span><span class="c0 c6"> (note: this was a little less than 16 uL, used the rest of the tube).</span></p><p class="c2"><span class="c0">3 uL BSA (1ug/uL, to a final conc of .1mg/ml) &nbsp;-</span></p><p class="c2"><span class="c0">0.75 uL SpeI</span></p><p class="c2"><span class="c0">0.75 uL EcoRI</span></p><p class="c2"><span class="c0 c3">Total=30 ul total</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0">Digest overnight - waterbath 37C</span></p><p class="c2"><span class="c0">Predict a insert (1000 bp) and plasmid (2000 bp)</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Results</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Loading colony PCRS on gel</span></p><p class="c2"><span class="c0">Notes: we loaded without adding dyes since Green buffer has dye!</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Loading Colony pcrs A-H of hyb.ompa.aox.psb1a3 (10/13/2010) from plates from 10/12/2010 done this morning by Christina, Scott, Debika.</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><img height="333.0" src="images/image4.png" width="445.0"></p><p class="c2"><span class="c0 c6">Order: </span></p><p class="c2"><span class="c0 c6">Exacto ladder|samples 1-6 from colony pcr of colonies A-H on 10/13/2010|ladder|samples 7-14 of colonies A-H from colony PCR on 10/13/2010|ladder</span></p><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><img height="349.0" src="images/image2.png" width="467.0"></p><p class="c2"><span class="c0 c6">Order: </span></p><p class="c2"><span class="c0 c6">exacto ladder|samples 15-20 of colonies A-H from colony pcr on 10/13/2010|ladder|samples 20-24 and -control from colonies A-H from colony pcr on 10/13/2010|samples 1(possibly 2-3 but wells were leaky after this well) of rfp-f3r colony pcr from 10/13/2010|ladder</span></p><p class="c2"><span class="c0 c6">Notes:</span><span class="c0">Note: The wells for 24 and 2 (RFP) are leaky</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">Reference table:</span></p><table cellpadding="0" cellspacing="0" class="c18"><tbody><tr><td class="c1"><p class="c5"><span class="c0">Reactions to do (Primers)&gt;&gt;</span></p></td><td class="c1"><p class="c5"><span class="c0">Hyb-F, OmpaR</span></p><p class="c5"><span class="c0">(MM same throughout)</span></p><p class="c5"><span class="c0">*</span></p></td><td class="c1"><p class="c5"><span class="c0">Aoxa/b FR</span></p><p class="c5"><span class="c0">(**,@)</span></p></td><td class="c1"><p class="c5"><span class="c0">RFP-FR</span></p><p class="c5"><span class="c0">@@</span></p></td><td class="c1"><p class="c5"><span class="c0">-control</span></p></td></tr><tr class="c16"><td class="c1"><p class="c5"><span class="c0">Colony </span><span class="c0 c3">A</span></p><p class="c5"><span class="c0">&nbsp;</span></p></td><td class="c1"><p class="c5"><span class="c0">1-</span></p></td><td class="c1"><p class="c5"><span class="c0">2</span><span class="c0 c3">(AoxA)**-</span></p></td><td class="c1"><p class="c5"><span class="c0">3-</span></p></td><td class="c1"><p class="c5"><span class="c0">cells only, no primers</span></p></td></tr><tr class="c16"><td class="c1"><p class="c5"><span class="c0 c3">B</span></p></td><td class="c1"><p class="c5"><span class="c0">4-</span></p></td><td class="c1"><p class="c5"><span class="c0">5 </span><span class="c0 c3">(AoxA)**-</span></p></td><td class="c1"><p class="c5"><span class="c0">6-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c1"><p class="c5"><span class="c0 c3">C</span></p></td><td class="c1"><p class="c5"><span class="c0">7-</span></p></td><td class="c1"><p class="c5"><span class="c0">8 </span><span class="c0 c3">(AoxA)**-</span></p></td><td class="c1"><p class="c5"><span class="c0">9-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c1"><p class="c5"><span class="c0 c3">D</span></p></td><td class="c1"><p class="c5"><span class="c0">10-</span></p></td><td class="c1"><p class="c5"><span class="c0">11 </span><span class="c0 c3">(AoxA)**</span></p></td><td class="c1"><p class="c5"><span class="c0">12-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c14"><td class="c1"><p class="c5"><span class="c0 c3">E</span></p></td><td class="c1"><p class="c5"><span class="c0">13-</span></p></td><td class="c1"><p class="c5"><span class="c0">14</span><span class="c0 c3">(AoxB)@-</span></p></td><td class="c1"><p class="c5"><span class="c0">15-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c1"><p class="c5"><span class="c0 c3">F</span></p></td><td class="c1"><p class="c5"><span class="c0">16-</span></p></td><td class="c1"><p class="c5"><span class="c0">17 (</span><span class="c0 c3">AoxB)@-</span></p></td><td class="c1"><p class="c5"><span class="c0">18-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c1"><p class="c5"><span class="c0 c3">G</span></p></td><td class="c1"><p class="c5"><span class="c0">19-</span></p></td><td class="c1"><p class="c5"><span class="c0">20 (</span><span class="c0 c3">AoxB)@-</span></p></td><td class="c1"><p class="c5"><span class="c0">21-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c1"><p class="c5"><span class="c0 c3">H</span></p></td><td class="c1"><p class="c5"><span class="c0">22-</span></p></td><td class="c1"><p class="c5"><span class="c0">23 (</span><span class="c0 c3">AoxB)@-</span></p></td><td class="c1"><p class="c5"><span class="c0">24-</span></p></td><td class="c1"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr></tbody></table><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2 c21"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Repeat of colony pcrs of hyb.ompa.aoxa.psb1a3 from plates from 10/12/2010 (scott)</span></p><p class="c2"><span class="c0 c4">&nbsp;</span></p><table cellpadding="0" cellspacing="0" class="c18"><tbody><tr><td class="c7"><p class="c5"><span class="c0 c4">Colony</span></p></td><td class="c7"><p class="c5"><span class="c0 c4">Rxn:Hyb-f Omp R</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">1a</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">2a</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">3a</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">4a</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">5a</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">6a</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">7a</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">8a</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0">9a</span></p></td><td class="c7"><p class="c5"><span class="c0 c4">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0 c4">10a</span></p></td><td class="c7"><p class="c5"><span class="c0 c4">&nbsp;</span></p></td></tr></tbody></table><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of hyb.ompa+aoxa+psb1a3 (for above table rxns)</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 uL Hyb-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL Ompa-R reverse primer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL </span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">Master mix (for all colonies in this rxn) labelled </span></p><p class="c2"><span class="c0 c3">11.75*11= 129.25 uL H20 -</span></p><p class="c2"><span class="c0 c3">5*11= &nbsp;55uL GOTAQ 5X Reaction buffer-</span></p><p class="c2"><span class="c0 c3">2.5*11 = 27.5 uL hyb-F forward primer-</span></p><p class="c2"><span class="c0 c3">2.5*11= 27.5 uL ompa-R reverse prime-r</span></p><p class="c2"><span class="c0 c3">0.5*11= 5.5 uL dNTP 10 mM-</span></p><p class="c2"><span class="c0 c3">0.25*11= 2.75 uL GOTAQ</span></p><p class="c2"><span class="c0 c6">To each rxn add:</span></p><p class="c2"><span class="c0 c6">22.5 ul of MM</span></p><p class="c2"><span class="c0 c6">2.5 uL cells -</span></p><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><span class="c0">Notes for people after 6pm:</span></p><p class="c2"><span class="c0">&nbsp;</span></p><ol class=""><li class="c12" value="1"><span class="c0">I did 10 colonies from the aoxA plate- they are in the thermocycler now. </span></li></ol><ol class="c15"><li class="c9" value="1"><span class="c0">do 10 colonies from aoxB plate</span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><ol class="c13"><li class="c12" value="2"><span class="c0">If time alots, make chloramphenicol plates (</span><span class="c0 c4"><a href="http://www.google.com/url?q=http%3A%2F%2Fwww.k-state.edu%2Fhermanlab%2Fprotocols%2FAntibioticUsage.html&amp;sa=D&amp;sntz=1&amp;usg=AFQjCNG4kXkgqH9sT8u_IUeCSJJq2aZSMg">http://www.k-state.edu/hermanlab/protocols/AntibioticUsage.html</a></span><span class="c0">)</span></li></ol><ol class=""><li class="c9" value="1"><span class="c0">ours is 1000 x, so use 1uL per 1mL of LB</span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">10/14/2010</span></p><p class="c2"><span class="c0 c4">Goals</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">perform colony pcrs on 10 colonies from hyb.ompa.aox.psb1a3 plates from 10/13/2010 (the 100 uL plates) using the reaction hyb-f and omp-r</span></li></ol><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3 c4">Gel pictures</span></p><p class="c2"><span class="c0">Images below are the same gel (different exposures ) </span></p><p class="c2"><span class="c0 c6">samples 1-10 of the RFP-F3R colony pcr of hyb.ompa.RFP-F3R from 10/13/2010 (in freezer)</span></p><p class="c2"><img height="386.0" src="images/image11.png" width="516.0"><img height="384.0" src="images/image5.png" width="514.0"></p><p class="c2"><span class="c0 c6">predicted band ~ 678 bp</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Protocols</span></p><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2 c21"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">labelled 1-10B for the aox1b plates (10 colonies/rxns)</span></p><p class="c2"><span class="c0 c4">&nbsp;</span></p><table cellpadding="0" cellspacing="0" class="c18"><tbody><tr class="c16"><td class="c7"><p class="c5"><span class="c0 c4">Colony</span></p></td><td class="c7"><p class="c5"><span class="c0 c4">Rxn:Hyb-f Omp R</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">1b</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">2b</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">3b</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">4b</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">5b</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">6b</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">7b</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">8b</span></p></td><td class="c7"><p class="c5"><span class="c0">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0">9b</span></p></td><td class="c7"><p class="c5"><span class="c0 c4">&nbsp;</span></p></td></tr><tr class="c16"><td class="c7"><p class="c5"><span class="c0 c4">10b</span></p></td><td class="c7"><p class="c5"><span class="c0 c4">&nbsp;</span></p></td></tr><tr><td class="c7"><p class="c5"><span class="c0 c4">&nbsp;</span></p></td><td class="c7"><p class="c5"><span class="c0 c4">&nbsp;</span></p></td></tr></tbody></table><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">Colony PCR of hyb.ompa+aoxb-+psb1a3 (for above table rxns) (from 100ul plate from 10/13/2010)</span></p><p class="c2"><span class="c0">2.5 uL of cells</span></p><p class="c2"><span class="c0">11.75 uL H2O</span></p><p class="c2"><span class="c0">5 uL GOTAQ</span><span class="c0 c3"> 5X Reaction buffer</span></p><p class="c2"><span class="c0">2.5 u Hyb-F forward primer</span></p><p class="c2"><span class="c0">2.5 uL Ompa-R reverse primer</span></p><p class="c2"><span class="c0">.5 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c2"><span class="c0">0.25 uL polymerase enzyme, TAQ</span></p><p class="c2"><span class="c0 c3">Total Volume= 25 uL </span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c3">Master mix (for all colonies in this rxn) labelled </span></p><p class="c2"><span class="c0 c3">11.75*11= 129.25 uL H20 --</span></p><p class="c2"><span class="c0 c3">5*11= &nbsp;55uL GOTAQ 5X Reaction buffer--</span></p><p class="c2"><span class="c0 c3">2.5*11 = 27.5 uL hyb-F forward primer--</span></p><p class="c2"><span class="c0 c3">2.5*11= 27.5 uL ompa-R reverse primer--</span></p><p class="c2"><span class="c0 c3">0.5*11= 5.5 uL dNTP 10 mM--</span></p><p class="c2"><span class="c0 c3">0.25*11= 2.75 uL GOTAQ</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c6">To each rxn add:</span></p><p class="c2"><span class="c0 c6">22.5 ul of MM</span></p><p class="c2"><span class="c0 c6">2.5 uL cells -</span></p><hr><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><span class="c0 c4">Making gels </span></p><p class="c2"><span class="c0">Gel start: 343pm</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">loading gels</span></p><ol class=""><li class="c12" value="1"><span class="c0">loading:</span></li></ol><ol class="c15"><li class="c9" value="1"><span class="c0"> the colony pcrs of psb1a3.hyb.ompa.aoxa colonies 1-10 (from 100 uL plates from 10.13.2010)</span></li><li class="c9"><span class="c0">and the colony pcrs of psb1a3.hyb.ompa.aoxb colonies 1-10( from 100 uL plates from 10.13.2010)</span></li></ol><ol class="c13"><li class="c12" value="2"><span class="c0">(loaded 10 ul of rxns)</span></li></ol><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><span class="c0 c6">order: (ver 1-4 gels)</span></p><p class="c2"><span class="c0 c6">exact ladder|samples 1-6 of aoxa colony pcr|ladder| samples 7-10 of aoxa colony pcr +control| samples 1-3 of aoxb colony pcr|exact ladder</span></p><p class="c2"><span class="c0 c6">Version 1 (left side, high exposure)</span></p><p class="c2"><img height="286.0" src="images/image9.png" width="383.0"></p><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><span class="c0 c6">Version 2 (left side, normal exposure)</span></p><p class="c2"><img height="287.0" src="images/image10.png" width="383.0"></p><p class="c2"><span class="c0 c6">Version 3 (right side, high exposure)</span><img height="324.0" src="images/image8.png" width="434.0"></p><p class="c2"><span class="c0 c6">Version 4 (right side, normal exposure)</span></p><p class="c2"><img height="324.0" src="images/image6.png" width="434.0"></p><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><span class="c0 c6">order </span></p><p class="c2"><span class="c0 c6">samples 4-6 of aoxb colony pcr|ladder| samples 7-10 of aoxb colony pcr</span></p><p class="c2"><img height="392.0" src="images/image0.png" width="525.0"></p><p class="c2"><span class="c0 c6">&nbsp;</span></p><hr><p class="c2"><span class="c0 c6">&nbsp;</span></p><p class="c2"><span class="c0 c4">Making LB media</span></p><p class="c2"><span class="c0">To make 1L LB (Lysogeny broth) medium:</span></p><p class="c2"><span class="c0">5g Yeast abstract</span></p><p class="c2"><span class="c0">10g Tryptone</span></p><p class="c2"><span class="c0">5g NaCl</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">To make solid plates, follow the above recipe and add 16g agar per 1L.</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Prepared 1L of LB media</span></p><p class="c2"><span class="c0">.75L liquid broth and .25L to make plates. </span></p><p class="c2"><span class="c0">Add 4g agar to plate broth (250mL). </span></p><p class="c2"><span class="c0">Autoclave, leaving lids slightly loosened.</span></p><p class="c2"><span class="c0">Let cool in water bath at 55C.</span></p><p class="c2"><span class="c0">Add antibiotic (250uL CMP) to 250 mL LB media used for plates.</span></p><p class="c2"><span class="c0">For the agar plates, pipetted 25mL into each plate, allow to harden in hood overnight.</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Picking colonies (scott)</span></p><p class="c2"><span class="c0">I am growing up:</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">colony 10 of aoxa colony pcr (done on 10/13/2010 by Scott)</span></li><li class="c12"><span class="c0">colonies 1,2,3, &nbsp;of aoxb colony pcr (done on 10/14/2010 by Christina)</span></li></ol><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">chloramphenicol plates </span></p><p class="c2"><span class="c0">plates made</span></p><p class="c2"><span class="c0">pick up and put in fridge very early in morn! (COMPLETED)</span></p><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">for tomorrow</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">reload the 10 colony pcrs of aoxb from 10.14.2010 </span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">10/15/10</span></p><p class="c2"><span class="c0 c4">plan for today: </span></p><p class="c2"><span class="c0">1. reload the 10 colony pcrs of aoxb from 10.14.2010 ( COMPLETED)</span></p><p class="c2"><span class="c0">2.Miniprep the liquid cultures in the incubator (large tubes ) (COMPLETED)</span></p><p class="c2"><span class="c0">3. Gel extract purified and digested psb1a3 from 10-13-10. (COMPLETED)</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Protocols: </span></p><p class="c2"><span class="c0">1. reload the 10 colony pcrs of aoxb from 10.14.2010</span></p><p class="c2"><span class="c0">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;note rxn is hyb-f and ompa-r</span></p><p class="c2"><span class="c0">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Results: </span><img height="322.0" src="images/image7.png" width="431.0"></p><p class="c2"><span class="c0">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ladder| &nbsp; B1|B2| B3|B4| B5|lad.| B6| B7| B8| B9|B10|ladder</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">2.Miniprep the 4 liquid cultures (10-14-10) in the incubator. </span></p><ol class="c15"><li class="c9" value="1"><span class="c0">colony 10, Aox1a colony PCR from 10-13 (miniprep label: 10)</span></li></ol><ol class=""><li class="c19" value="1"><span class="c0">33.3 ng/uL</span></li><li class="c19"><span class="c0">54.7 ng/uL</span></li></ol><ol class="c15"><li class="c9" value="2"><span class="c0">colony 2, Aox1b colony PCR from 10-14 (miniprep label: 2)</span></li></ol><ol class=""><li class="c19" value="1"><span class="c0">101.7 ng/uL</span></li><li class="c19"><span class="c0">137.8 ng/uL </span></li></ol><ol class="c15"><li class="c9" value="3"><span class="c0">colony 1, Aox1b colony PCR from 10-14 (miniprep label: 1) </span></li></ol><ol class="c20"><li class="c19" value="1"><span class="c0">136.1 ng/uL</span></li><li class="c19"><span class="c0">186.9 ng/uL</span></li></ol><ol class="c15"><li class="c9" value="4"><span class="c0">colony 3, Aox1b colony PCR from 10-14 (miniprep label: 3)</span></li></ol><ol class=""><li class="c19" value="1"><span class="c0">92.9 ng/uL</span></li><li class="c19"><span class="c0">148.4 ng/uL</span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Psb1a3 SpeI and EcoRI digest (2 kb band) gel extraction(Debika)</span></p><p class="c2"><span class="c0">|1kb ladder|4ul of psb1a3 SpeI+EcoRI Digest| 21 uL of psb1a3 SpeI+EcoRI Digest|</span></p><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0">1. Excised DNA fragment from the agarose gel with a clean, sharp scalpel.</span></p><p class="c2"><span class="c0">2. Weighed the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg or approximately 100 &mu;L). </span></p><ol class="c15"><li class="c9" value="1"><span class="c0">top band: .25g = 250mg (add 750 uL buffer QG) </span></li></ol><ol class="c20"><li class="c19" value="1"><span class="c0">labelled &ldquo;top&rdquo; psb1a3</span></li></ol><ol class="c15"><li class="c9" value="2"><span class="c0">bottom band: .18 g = 180mg (add 540 uL buffer QG)</span></li></ol><ol class=""><li class="c19" value="1"><span class="c0">labelled &ldquo;bottom&rdquo;psb1a3</span></li></ol><p class="c2"><span class="c0">3. Incubated at 50&ordm;C for 10 min (or until the gel slice had completely dissolved). To help dissolve gel, mixed by vortexing the tube every 2 &ndash; 3 min during the incubation.</span></p><p class="c2"><span class="c0">4. After the gel slice has completely dissolved, checked that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose). If not, add 10 uLsodium acetate (5.5 pH, 3M).</span></p><ol class="c15"><li class="c9" value="1"><span class="c0">added 10uL sodium acetate (5.5 pH, 3M) to psb1a3 &ldquo;bottom&rdquo;</span></li></ol><p class="c2"><span class="c0">5. Added 1 gel volume of isopropanol to the sample and mixed.</span></p><ol class="c15"><li class="c9" value="1"><span class="c0">add 250 uL isopropanol to &ldquo;top&rdquo;</span></li><li class="c9"><span class="c0">add 180 uL isopropanol to &ldquo;bottom&rdquo;</span></li></ol><p class="c2"><span class="c0">6. Placed a QIAquick spin column in a provided 2 mL collection tube.</span></p><p class="c2"><span class="c0">7. To bind DNA, applied the sample to the QIAquick column, and centrifuged for 1 min @13,000rmp.</span></p><p class="c2"><span class="c0">8. Discarded flow-through and placed QIAquick column back in the same collection tube.</span></p><p class="c2"><span class="c0 c10">9. Recommended: Added 0.5 mL of Buffer GQ to QIAquick column and centrifuged for 1 min.</span></p><p class="c2"><span class="c0">10. To wash, added 0.75 mL of Buffer PE to QIAquick column and centrifuged for 1 min @13,000.</span></p><p class="c2"><span class="c0">11. Discarded the flow-through and centrifuged the QIAquick column for an additional 1 min at 17,900 x g (13,000 rpm). </span></p><p class="c2"><span class="c0">12. Placeed QIAQuick column into a clean 1.5 mL microcentrifuge tube.</span></p><p class="c2"><span class="c0">13. To elute DNA, added 30 &nbsp;&mu;L water (pH 7.0 &ndash; 8.5), let the column stand for 1 min, and then centrifuged for 1 min @13,000k.</span></p><ol class=""><li class="c9" value="1"><span class="c0">top band nanospec concentration 9.4 ng/uL </span></li></ol><ol class="c20"><li class="c19" value="1"><span class="c0">labelled &ldquo;T, 10-15, top band&rdquo;</span></li></ol><ol class="c15"><li class="c9" value="2"><span class="c0">bottom band nanospec concentration 9.5 ng/uL</span></li></ol><ol class=""><li class="c19" value="1"><span class="c0">labelled &ldquo;B, 10-15, bottom band&rdquo;</span></li></ol><p class="c2"><span class="c0">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;both tubes are in the yellow box in the freezer. there&rsquo;s a big &ldquo;T&rdquo; and &ldquo;B&rdquo; on top of the tubes.</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">10/16/2010</span></p><p class="c2"><span class="c0 c4">Goals</span></p><ol class=""><li class="c12" value="1"><span class="c0">look at gel pictures for aoxa 1-10, aoxb 1-10, rfp-F3r 1-10 and see pick appropriate colonies</span></li></ol><ol class="c15"><li class="c9" value="1"><span class="c0">note this has been done for colony 10 of aoxa and 1-3 of aoxb, but look at the gel pic of aoxb run again on 10.15.2010. </span></li></ol><ol class="c13"><li class="c12" value="2"><span class="c0">check the minipreps from 10.15.2010 via digests</span></li><li class="c12"><span class="c0">redigest the aoxa/b we have now</span></li><li class="c12"><span class="c0">if needed, start pcrs for new aoxa,b, rfp-F3R</span></li></ol><ol class=""><li class="c12" value="1"><span class="c0">Transform psb1c3 plasmids on chloamphenicol plates (done)</span></li></ol><ol class=""><li class="c9" value="1"><span class="c0">check registry to see if insert is rfp coding or toxic gene &nbsp;(rfp)</span></li></ol><ol class=""><li class="c12" value="2"><span class="c0">overnight digest of purified, digested aoxa-FR and aoxb-FR from (9.23 and 9.27)</span></li><li class="c12"><span class="c0">digests of minipreps of colony 10 of aoxa and 1-3 of aoxb, (in heat block, 2pm 10.16)</span></li></ol><ol class=""><li class="c9" value="1"><span class="c0">digest the predicted insert out</span></li></ol><ol class="c20"><li class="c19" value="1"><span class="c0">EcoRI and SpeI</span></li></ol><ol class=""><li class="c12" value="4"><span class="c0">glycerol stocks of the colony pcrs of interest (done)</span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Protocols</span></p><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">Observations of gel pics</span></p><ol class="c13"><li class="c12" value="5"><span class="c0">gel pic from 10.15.2010 of hyb.ompa.aoxb.psb1a3</span></li></ol><ol class="c15"><li class="c9" value="2"><span class="c0">colony 5 appears to have the predicted 500 bp band</span></li><li class="c9"><span class="c0">colonies 1, &nbsp;3 6, 8, 9 have a 500 bp band along with 700 bp band</span></li><li class="c9"><span class="c0 c3">Suggestion: grow up colony 5 and perhaps 2 of the other colonies</span></li></ol><ol class=""><li class="c12" value="6"><span class="c0">gel pic from 10.14.2010 of hyb.ompa.aoxa.psb1a3</span></li></ol><ol class=""><li class="c9" value="1"><span class="c0">The colonies did not exclusively have the predicted 500 bp band, but a few had the band along with a mix of bands. In particular, colony 10 was picked and miniprepped yesterday. </span></li></ol><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Growing up colony 5 of aoxb (as visualized in gel pic from 10.15.2010)(plate from 10.12.2010) (completed)(Scott)</span></p><p class="c2"><span class="c0">I inoculated 3 mL of LB+3uL of Carb with 3uL of cells. </span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Digests of minipreps of colony 10 of aoxa and 1-3 of aoxb (Scott)</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">colony 10, Aox1a colony PCR from 10-13 (label 10)(54.7 ng/uL)</span></p><p class="c2"><span class="c0">4.5 &nbsp;uL H20 </span></p><p class="c2"><span class="c0">2uL 10X EcoRI buffer</span></p><p class="c2"><span class="c0">10 uL hyb.ompa.aoxa.psb1a3 colony 10 miniprep</span></p><p class="c2"><span class="c0">2 uL BSA (1ug/uL, to a final conc of .1mg/ml)</span></p><p class="c2"><span class="c0">0.75 uL SpeI</span></p><p class="c2"><span class="c0">0.75 uL EcoRI</span></p><p class="c2"><span class="c0 c3">Total=20 ul total </span></p><p class="c2 c21"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">colony 1, Aox1b colony PCR from 10-14 (miniprep label: 1) (186.9 ng/uL)</span></p><p class="c2"><span class="c0">9.3 &nbsp;uL H20 </span></p><p class="c2"><span class="c0">2uL 10X EcoRI buffer</span></p><p class="c2"><span class="c0">5.2 uL hyb.ompa.aoxb.psb1a3 colony 1 miniprep</span></p><p class="c2"><span class="c0">2 uL BSA (1ug/uL, to a final conc of .1mg/ml)</span></p><p class="c2"><span class="c0">0.75 uL SpeI</span></p><p class="c2"><span class="c0">0.75 uL EcoRI</span></p><p class="c2"><span class="c0 c3">Total=20 ul total </span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">colony 2, Aox1b colony PCR from 10-14 (miniprep label: 2)(137.8 ng/uL) </span></p><p class="c2"><span class="c0">7.5 &nbsp;uL H20 </span></p><p class="c2"><span class="c0">2uL 10X EcoRI buffer</span></p><p class="c2"><span class="c0">7 uL hyb.ompa.aoxb.psb1a3 colony 2 miniprep</span></p><p class="c2"><span class="c0">2 uL BSA (1ug/uL, to a final conc of .1mg/ml)</span></p><p class="c2"><span class="c0">0.75 uL SpeI</span></p><p class="c2"><span class="c0">0.75 uL EcoRI</span></p><p class="c2"><span class="c0 c3">Total=20 ul total </span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c3">colony 3, Aox1b colony PCR from 10-14 (miniprep label: 3) (148.4 ng/uL)</span></p><p class="c2"><span class="c0">7.5 &nbsp;uL H20 </span></p><p class="c2"><span class="c0">2uL 10X EcoRI buffer</span></p><p class="c2"><span class="c0">7 uL hyb.ompa.aoxb.psb1a3 colony 3 &nbsp;miniprep</span></p><p class="c2"><span class="c0">2 uL BSA (1ug/uL, to a final conc of .1mg/ml)</span></p><p class="c2"><span class="c0">0.75 uL SpeI</span></p><p class="c2"><span class="c0">0.75 uL EcoRI</span></p><p class="c2"><span class="c0 c3">Total=20 ul total </span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0">Digests started at 11:44 am</span></p><p class="c2"><span class="c0">Can go all night- I may take them out around 8pm or so. Gaucher suggested overnight digest as norm. </span></p><p class="c2"><span class="c0 c4">Reconstituting psb1c3 from kit (Scott)</span></p><p class="c2 c17"><span class="c0 c4">&nbsp;</span></p><table cellpadding="0" cellspacing="0" class="c18"><tbody><tr class="c22"><td class="c11"><p class="c2 c17"><span class="c0">Spring 2010 Distribution</span></p></td><td class="c11"><p class="c2 c17"><span class="c0 c4"><a href="http://www.google.com/url?q=http%3A%2F%2Fpartsregistry.org%2Fcgi%2Fassembly%2Fplates.cgi%3Fid%3D1257&amp;sa=D&amp;sntz=1&amp;usg=AFQjCNGcYN2xbetR8zSVZgN9O11n-Ge4lQ">2010 Kit Plate 1</a></span></p></td><td class="c11"><p class="c2 c17"><span class="c0">3A</span></p></td><td class="c11"><p class="c2 c17"><span class="c0">BBa_J04450</span></p></td></tr></tbody></table><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">Added 10 ul of autoclaved water to well 3a of plate 1. </span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0">I also reconstituted Plate 1 1a (psb1a10) </span></p><p class="c2"><span class="c0 c3 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">Transformation of NB with psb1c3 (Scott)(completed)</span></p><p class="c2"><span class="c0">I added 10 ul of NB and 2 uL of psb1c3</span></p><p class="c2"><span class="c0">started 12:09 pm-end 12:39</span></p><p class="c2"><span class="c0">incubation start: 12:46 pm</span></p><p class="c2"><span class="c0">plate at 1:46pm</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Cryostocks (Scott)(Completed)</span></p><p class="c2"><span class="c0">Colonies 1,2,3,5 of hyb.ompa.aoxb.psb1a3 cells in NB (from liq cultures picked from plates made on 10.12.201)</span></p><p class="c2"><span class="c0">Colony 10 of hyb.ompa.aoxa.psb1a3 cells in NB(from liq cultures picked from plates made on 10.12.201)</span></p><p class="c2"><span class="c0">250 uL of cells</span></p><p class="c2"><span class="c0">370 uL Glycerol</span></p><p class="c2"><span class="c0 c3">Total 0.62 mL</span></p><p class="c2"><span class="c0">Mix, place in -80c Freezer</span></p><p class="c2"><span class="c0">&nbsp;</span></p><p class="c2"><span class="c0 c4">Ligation of gel extracted psb1a3 (top band, from 10.15.2010) to [hyb.ompa+aox a] &nbsp;(done Rob)</span></p><p class="c2"><span class="c0">hyb.ompa= [4.1 ng/uL from 9.29.2010]/478 bp= 0.009 eq/uL</span></p><p class="c2"><span class="c0">AOX1a-FR -[ 12 ng/uL (from 9.27.2010)]/1035 bp = 0.0115 eq/uL</span></p><p class="c2"><span class="c0">pSB1A3- [9.4ng/uL]/2056bp=0.00457 eq/uL (labeled T)</span></p><p class="c2"><span class="c0">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c2"><span class="c0">2 uL hyb.ompa</span></p><p class="c2"><span class="c0">1.6 ul aoxa-FR</span></p><p class="c2"><span class="c0">2 ul psb1a3 (T</span></p><p class="c2"><span class="c0">1 uL 10 x Ligase buffer</span></p><p class="c2"><span class="c0">2.9 ul H20</span></p><p class="c2"><span class="c0">0.5 uLT4 Ligase</span></p><p class="c2"><span class="c0 c3">Total 10 uL</span></p><p class="c2"><span class="c0 c3 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">Ligation of gel extracted psb1a3 (top band, from 10.15.2010) to [hyb.ompa+aox b] (Done Rob)</span></p><p class="c2"><span class="c0">hyb.ompa= [4.1 ng/uL from 9.29.2010]/478 bp= 0.009 eq/uL</span></p><p class="c2"><span class="c0">AOX1b-FR -[ 23 ng/uL (from 9.27.2010)]/1035 bp = 0.0222 eq/uL</span></p><p class="c2"><span class="c0">pSB1A3- [9.4ng/uL]/2056bp=0.00457 eq/uL (labeled T)</span></p><p class="c2"><span class="c0">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c2"><span class="c0">2uL hyb.ompa</span></p><p class="c2"><span class="c0">0.82 ul aoxb-FR</span></p><p class="c2"><span class="c0">2ul psb1a3 </span></p><p class="c2"><span class="c0">1 uL 10 x Ligase buffer</span></p><p class="c2"><span class="c0">3.68 ul h20</span></p><p class="c2"><span class="c0">0.5 uLT4 Ligase</span></p><p class="c2"><span class="c0 c3">Total 10 uL</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">Ligation of gel extracted psb1a3 (top band, from 10.15.2010) to [hyb.ompa+RFP-F3R] (Done Rob)</span></p><p class="c2"><span class="c0">hyb.ompa= [4.1 ng/uL from 9.29.2010]/478 bp= 0.009 eq/uL</span></p><p class="c2"><span class="c0">RFP-F3R -[ 17.5 ng/uL (from 10.8.2010)]/1035 bp = 0.0169 eq/uL</span></p><p class="c2"><span class="c0">pSB1A3- [9.4ng/uL]/2056bp=0.00457 eq/uL (labeled T)</span></p><p class="c2"><span class="c0">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c2"><span class="c0">2uL hyb.ompa</span></p><p class="c2"><span class="c0">1.65ul Rfp-F3R (from 10/8/2010)</span></p><p class="c2"><span class="c0">2ul psb1a3 </span></p><p class="c2"><span class="c0">1 uL 10 x Ligase buffer</span></p><p class="c2"><span class="c0">2.85 ul h20</span></p><p class="c2"><span class="c0">0.5 uLT4 Ligase</span></p><p class="c2"><span class="c0 c3">Total 10 uL</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">Negative control of ligation(Done Rob)</span></p><p class="c2"><span class="c0">1.6 ul aoxa-FR</span></p><p class="c2"><span class="c0">2 ul psb1a3 (T</span></p><p class="c2"><span class="c0">1 uL 10 x Ligase buffer</span></p><p class="c2"><span class="c0">4.9 ul H20</span></p><p class="c2"><span class="c0">0.5 uLT4 Ligase</span></p><p class="c2"><span class="c0 c3">Total 10 uL</span></p><p class="c2"><span class="c0 c3">&nbsp;</span></p><p class="c2"><span class="c0 c4">Miniprep of colony b5 of aoxb.hyb.ompa.psb1a3 (from 10.16.2010) (Scott)(done)</span></p><p class="c2"><span class="c0">Notes: eluted witrh 30 ul of water</span></p><p class="c2"><span class="c0 c4">&nbsp;</span></p><p class="c2"><span class="c0 c4">To do tomorrow:</span></p><ol class="c13"><li class="c12" value="1"><span class="c0">miniprep of aoxb colony b5 in the incubator (in large tube)</span></li></ol><ol class="c15"><li class="c9" value="1"><span class="c0">I used 2ml, so there is 1 ml left if the nanospec of today&rsquo;s miniprep does not turn out well</span></li></ol><ol class=""><li class="c12" value="2"><span class="c0">Nanospec the minipreps done today</span></li><li class="c12"><span class="c0">check results of digest on gel</span></li></ol><ol class=""><li class="c12" value="5"><span class="c0">if needed, start pcrs for new aoxa,b, rfp-F3R</span></li></ol><ol class=""><li class="c12" value="7"><span class="c0">overnight digest of purified, digested aoxa-FR and aoxb-FR from (9.23 and 9.27) (or just the purified)</span></li><li class="c12"><span class="c0">Transform using the ligations done today (hyb.ompa+aoxa/b, hyb.ompa.rfp-F3R)</span></li></ol>