Team:Freiburg Bioware/testpage

From 2010.igem.org

(Difference between revisions)

Latest revision as of 12:06, 6 September 2010

banner

6. Labday 03.05.2010

Theoretical cloning

Investigators: Adrian, Hanna, Bea, Patrick, Chris W.

There are several matters to do in theoretical cloning. The modularization/modification of the stratagene plasmids and the enzymes. :

1. Cap-Gen:

delete the PstI-restriction site
insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)
add prefix & suffix
disable binding of Heparan Sulphat Proteoglycan

2. Rep-Gen:

delete EcoRI (2x) and PstI (2x)

3. ITRs:

NotI and PstI (in sequence?) flank the ITRs: its the question if we can/must delete them?
where exactly starts and ends the sequence (Patrick)?
it should be checked up if there is a possibility to use all of the three ITRs.
we blasted the ITR (left) of the MCS vektor (Stratagene). we got a 92% "Coverage" with the AAV2 genom (to 100%). from the alignment (Stratagene ITR with ITR of the AAV2 genom) we got:

You can see, that the ITR sequence beginns 4 bp after the PstI restriction site. thereupon we did a secundary structure analyse (www.dinamelt.bioinfo.rpi.edu), with the following structurewe got:
Media:Freiburg10_AAV2ITR(left)nachBlast.pdf
conclusion: the big loop of the secondary structure dosent change if we delete the PstI restriction site (cf. with other uploadet secondary structures), it should be considered that we can't add random bp that could affect the secundary structure.
To do: which bp, which sequence could/can be insertet? cf. the genome of AAV2

4. MCS:

replacement through the iGEM-MCS
where is the beginning and ending of the MCS in the Vector? ß-globin function and sequence (search for literature and patents, which are denoted in the AAV-Helper-Free-System Manual)
in this context it would be also important to find out where the beta-Globulin-Intron exactly starts or rather we can cut out the MCS.

5. enzymes:

Thymidinkinase: find informations. TK30 (Bea), SR39 (Hanna)
Cytosindeaminase: find informations (Adrian)

in addition we downloadet, addet and anotated the sequence of the pHelper plasmid of stratagene in Geneious (see "Constructs").

insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)

7. Labday 07.05.2010

Protocolls

Investigators: Anissa, Kerstin

adaption and extension of the standart prorcolls (Cloning for Pro's)
we startet to create a protokoll-mask for the praktical-cloning (short version for labwork)

8. Labday 10.05.2010

Stock solutions

Investigators: Adrian, Chris W., Chris L., Bea, Achim, Patrick, Hanna, (Sven)

The following stock solutions were prepared:
1. Antibiotics:

Ampicillin: 2 g Ampicillin were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at -20°C.
Chloramphenicol: 0.5 g Chloramphenicol were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at the -20°C.
Kanamycin: 1 g Kanamycin was dissolved in 20 mL multipore-H2O, sterilized by filtration and filled into 2 mL tubes and stored at the -20°C.
Tetracyclin: 0.5 g Tetracyclin were dissolved in 20 mL ethanol (70%) and filled into 2 mL tubes. The tubes were wrapped with aluminium foil (light sensitive!) and stored at -20°C.

2. ITPG solution (1 M):

~ 4.766 g ITPG were dissolved in 20 mL multipore-H2O, sterilized by filtration, filled in 2 mL tubes and stored at -20°C.

3. DYT (5 litres)

80 g Bactotrypton, 50 g Bactoyeast, 25 g NaCl were weight out.
2 L multipore-H2O were added
after mixing, multipore-H2O was added -> endvolume 5 litres
medium was filled into flask and was autoclaved

4. Glycerol:

Glycerol was filled into a flask and was then autoclaved

To do: register at Mr. Gene!!!

9. Labday 17.05.2010

β-Globin

Investigators: Bea, Chris W., Patrick, Hanna (and instructors)

We blasted the sequence of the β-globin and additional nukleotides „vorne und hintendran“. We found only 70% coverage with the human β-globin-intron add. some parts of the exon 3. For this reason we think that the pAAV_MCS annotation of the β-Globin-intron of Stratagene is too generously.
In addition the alignment of the human ß-globin showed that only parts of the intron 2 (5’) and exon 3 are integratet into the vector. We assume that the informations from Stratagene are not total correctly ( intron flanket by the splicedonors and the acceptor-sequence). We blasted the sequence between the CMV-promoter and the origin beginning of the ß-globin intron. We found a 98,8% coverage with a synthetic CMV-promoterconstruct ( 1 nucleotide difference). Literature: „Diverse plasmid DNA vectors by directed molecular evolution of cytomegalovirus promoters. (Wright A. et al.)“
→The question arises if we can omit the ß-globin (because the exact function is unknown). For this we should contact various Companys (GeneArt, DNA2.0, Mr. Gene,…) to get more information. In addition we could test the expression with and without ß-globin.

10. Labortag 18.05.2010

pCMV_mVenus_YFP

Investigator: Bea, Chris W., Patrick, Hanna, Anissa, Kerstin, Adrian (und Instructors)

Theoretical cloning with Geneious of pCMV-MCS + pGA14_mVenus_YFP --> pCMV_mVenus_YFP

Enzyme set: RFC 25 (iGEM)
digest pGA14_mVenus_YFP (insert) with XbaI and PstI: mVenus_YFP_cut_XbaI+PstI
digest pCMV_MCS (vector) with XbaI and PstI: pCMV_MCS_cut_XbaI+PstI
ligate mVenus_YFP_cut_XbaI+PstI with pCMV_MCS_cut_XbaI+PstI

11. Labortag 19.05.2010

Cloning of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP

Investigators: Adrian, Bea, Chris W., Hanna, Patrick

Digestion

plasmid: insert: pGA14_mVenus_YFP; number: P1 production date: ____ origin: ____
plasmid: vector: pCMV_MCS; number: P2 production date: ____ origin: ____
new vector name: pCMV_mVenus_YFP
buffer used:3 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme PstI(no.Lab:___)
DNA concentration (vector): 375 ng/µl ; DNA concentration (insert): 476 ng/µl

components	V (pGA_mVenus_YFP)/ µl	V(pCMV_MCS) / µl
DNA	4	2,7
BSA (10x)	2	2
Buffer 3 (10x)	2	2
Enzyme: XbaI (no.Lab:___)	1,5	1,5
Enzyme: PstI (no.Lab:___)	1	1
H2O	9,5	10,8
Total volume	20	20

Incubation: 1 h at 37°C

1% Agarose gel and Gel extraction

prepare 1% agarose gel, run gel for 45 minutes(119 V)
cut out insert and vector
perform gel extraction following standard protocol provided by Qiagen

Ligation

Measure DNA-concentration with Nanodrop
c(mVenus_YFP) = 16,8 ng/µL
c(pCMV_MCS) = 22,8 ng/µL
Calculation of volume needed for ligation:
c(mVenus_YFP) = 3,66 µL
c(pCMV_MCS) = 5,34 µL

Transformation

Transformation has been followed the standard protocol Media:Freiburg10_Cloning Protocol.pdf

12. Labortag 20.05.2010

Picking clones

Investigators: Adrian, Bea

3 approaches from each plate

13. Labortag 21.05.2010: CMV-Promoter

Theoretical cloning: (Volker, Hanna)

The CMV promoter (mainly the regulatory region) was further characterized: For this purpose U.S. patent no. 5,385,839 was used. Media:Freiburg10_Patent_US5385839A.pdf
Further on the CMV promoter sequence was blasted. The results delivered a 98% query coverage with the "Human herpesvirus 5 strain Toledo, complete genome" (accession no.: GU937742.1). Interestingly the maximal identity was just 99%. This can be explained due to a nucleotide deletion and a C-T transition (red circles), which were also marked in Geneious.

To do: find "+1"-location (transcription start); which transcription factors bind to the regulatory region of the CMV promoter?

LB medium was prepared: (Patrick and Chris W.)

10 g Bacto-Tryptone, 5 g Bacto-Yeast, 10 g NaCl were mixed in 500 mL milipore-H2O.
Volume was adjusted to 1 L with milipore-H2O.
100 mL flasks were each filled with 50 mL medium.
0.75 g agar was added to each flask.
LB was sterilized by autoclaving and is now stored at room temperature.

Plasmid Mini-Prep according to the standard protocol

investigator: Adrian, Kira, Anna, Chris W., Patrick
Measure DNA-concentration with Nanodrop

	P3 (pCMV_mVenus_YFP)	P4 (pCMV_mVenus_YFP)	P5 (pCMV_mVenus_YFP)
concentration (ng/µl)	457	470,8	477,29

14. Labortag 25.05.2010

Cloning of pCMV_mVenus_YFP + pAAV_MCS

Investigators: Kira, Anna, Volker, Jessica

plasmid: insert: pCMV_mVenus_YFP; number: P5 production date: 21.05.2010 origin: ____

plasmid: vector: pAAV_MCS; number: P? production date: ____ origin: ____

new vector name: pAAV_mVenus_YFP

1st try:

buffer used:3 ; Restriction-enzymes used: Enzyme NotI (no. Lab:46)

DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl

components	V (pCMV_mVenus_YFP)/ µl	V(pAAV_MCS) / µl
DNA	4.2	3.5
BSA (10x)	3	3
Buffer 3 (10x)	3	3
Enzyme: NotI (no.Lab:46)	1	1
H2O	15.3	15.3
Total volume	26.4	25.8

Incubation: 1 1/2 h at 37°C
note: too little water was added

1% Agarose gel

1% agarose gel was prepared, gel ran for 45 minutes(119 V)

2nd try:

buffer used:4 ; Restriction-enzymes used: Enzyme NotI (no. Lab:159)

DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl

components	V (pCMV_mVenus_YFP)/ µl	V(pAAV_MCS) / µl
DNA	4.2	3.5
BSA (10x)	3	3
Buffer 4 (10x)	3	3
Enzyme: NotI (no.Lab:159)	1,5	1,5
H2O	18,3	19
Total volume	30	30

Incubation: 1 1/2 h at 37°C
1% Agarose gel

1% agarose gel was repared, gel ran for 45 minutes(119 V)
Results: unexpected sizes of fragments (see protocol), try again next day with an ethidium bromid gel

Production of chemical competent E.coli

Investigators: Patrick and Jessica

competent E.coli XL-1-blue and competent E.coli BL21 produced according to the standard-protocoll Media:production of competent E.coli.pdf

Design of MCS-Oligos

Investigators: Bea, Adrian, Hanna, Sven

In order to replace the multiple cloning site of the pAAV_MCS vector from Stratagene by RFC25, two oligos were designed. After their hybridization the overhangs correspond to ClaI- and BglII restriction sites. A digestion with BglII and ClaI will be performed with pAAV-MCS and then will be ligated with the designed oligos.
The oligos (see link) were ordered at Sigma-Aldrich. Estimated shipment: 31.05.2010 .

File:Freiburg10 Oligos MCS RFC25 for pAAV.pdf

15. Labortag 26.05.2010

Oligos (PstI + MCS)

Investigators: Bea, Hanna, Jessica

Repeat cloning of pAAV-MCS + pCMV_mVenus_YFP --> Goal: pAAV_mVenus_YFP
Cloning did not work (see lab day 25.05.2010) either with NotI or with NotI-HF. Gel did not show any proper band at the expected size.
There will be used EtBr instead of gelred in the agarose gel and the incubation time of digestion will be prolonged. Further details are followed.
NOTE: There are three restriction sites of NotI in the pCMV-mVenus_YFP. If cloning with NotI, the polyA hGH signal will be deleted. therefore cloning with NotI is not possible .

Test digestion of pCMV-mVenusYFP with PstI and MluI
Digestion

experiment date: 26.05.2010
plasmid: pCMV_mVenus_YFP; number: P5; production date: 21.05.2010/ pCMV-MSC; number: P2; production date:
buffer used: 3/4; Restriction-enzymes used: Enzyme PstI (no. Lab:48) and Enyzme MluI (no. Lab:40) / NotI HF (no. Lab:159)
DNA concentration plasmid: P5 477,3 ng/µl / P2 550ng/µl

components	V (pCMV_mVenus_YFP)/ µl	V(pCMV_MCS) / µl
DNA	4,2	3,6
BSA (10x)	2	2
Buffer 3 (10x)	2	2
Enzyme: PstI/NotI HF (no.Lab:48/159)	1	2
Enzyme: MluI (no.Lab:40)	1	-
H2O	9,8	10,4
Total volume	20	20

Incubation: 1 h at 37°C
1% Agarose gel
1% agarose gel was repared, gel ran for 45 minutes(119 V)
Results: Test digestion of pCMV_MCS with NotI delivered plausibel results (expected fragment size: ~ 27 kbp and 17 kbp). Unfortunately the digestion of pCMV_mVenus_YFP with PstI and MluI resulted in one 2.9 kbp and one 1.2 kbp fragment, which didn't correspond to the expected fragment sizes of 19 kbp and 33 kbp - but to fragment sizes of pCMV_MCS without mVenus_YFP!
Ordering oligos:(Sigma-Aldrich)
(Bea)
Oligos have been ordered for modifying the ITRs. Deletion of PstI restriction site in ITR.

right ITR of pAAV_MCS
oligos ordered:
fwd: 5´- gcgcagctgcctgcaCGGGCGCCTGATGCGG -3´ 77 °C, 31 bp
rev: 5´- CCGCATCAGGCGCCCGTGCAGGCAGCTGCGC -3´

leftITR of pAAV_MCS
oligos ordered:
fwd: 5´- CCTTTTGCTCACATGTCGTGCAGGCAGCTGCGCG -3´ 74 °C, 34 bp
rev: 5´- CGCGCAGCTGCCTGCACGACATGTGAGCAAAAGG -3´

For further details see link
http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/4/44/Freiburg10_Oligos_ITR_mutagenesis_for_pAAV_delete_PstI.pdf

Test-Trafo of chemical competent E.coli cells
(Hanna)
The competent E.coli XL-1-blue and competent E.coli BL21 which were prepared the day before were test-transformed with pUC18 - following the standard protocol. Cells were plated on agar plates containing ampicillin and stored over night at 37°C. Further on two control plates containing ampicillin or kanamycin were prepared. Non-transformed cells were plated on them and also stored over night at 37°C.

16. Labortag 27.05.2010

Cell counting

Investigator: Patrick, Adrian, Chris W. Christian L.

Meeting

cell counting:

BL21 + PUC18 Trafo 54*4 = 216
XL1B + PUC18 Trafo 30*4 = 120

digitalization of recipe-cards (Christian L.)

17. Labortag 31.05.2010

pAAV_RC R585A and R588A transistions

In order to alter the tropism of AAV2 several modifications have to be performed. First of all the binding to Heparan Sulfate Proteoglycan has to be disrupted. This can be done by R585A and R588A transistions:

@@ Line 122: / Line 122: @@
 <div class="box_right">
 </html>
-==== 18. Labortag 01.06.2010:  Modifying MCS of pAAV_MCS vector====
+===6. Labday 03.05.2010===
-<br>
-Investigators: Anissa, Adrian, Bea, Chris W., Hanna, Patrick, Volker, Sven <br>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Theoretical cloning</b></p>====
+<p><b>Investigators: Adrian, Hanna, Bea, Patrick, Chris W. </b></p><br>
-'''Oligos received from Sigma-Aldrich''' <br>
-(right ITR of pAAV_MCS, left ITR of pAAV_MCS and MCS RFC25 for pAAV)
+There are several matters to do in theoretical cloning. The modularization/modification of the stratagene plasmids and the enzymes. :<br>
 <br>
-*Hybrization of received oligos: MCS RFC25 for pAAV (forward) and MCS RFC25 for pAAV (reverse)
+. Cap-Gen:
-*Centrifuge tubes prior to open tubes (13.000 rpm, 30 sec)
+* delete the PstI-restriction site
-**MCS RFC25 for pAAV (forward): Add 92µL Millipore H<sub>2</sup>O (Volume on obtained sheet)
+* insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)
-**MCS RFC25 for pAAV (reverse): Add 394 µL Millipore H<sub>2</sup>O (Volume on obtained sheet)
+* add prefix & suffix
-*Vortex the resuspended DNA
+* disable binding of Heparan Sulphat Proteoglycan
-*Make aliquots of both Oligos (1:10): 10 µL Oligo + 90 µLH<sub>2</sup>O (final volume usually 100 µl)
-*Mix together(into PCR-tube):
 <br>
+. Rep-Gen:
-{| border="1"
+* delete EcoRI (2x) and PstI (2x)
-| align="right" | '''Volume/µL''' ||align="right"| '''solution'''
-|-
-|  align="right" | 10 (1:10)||align="right"|Oligo 1: MCS RFC25 for pAAV (forward)
-|-
-|  align="right" |10||align="right"|Oligo 2: MCS RFC25 for pAAV (reverse)
-|-
-|  align="right" |4||align="right"| 100mM TrisHCl pH8
-|-
-|  align="right" |8||align="right"|5mM MgCl2
-|-
-|  align="right" |8||align="right"| H20
-|}
 <br>
-* Program: ORIGAMI 1 modified for long oligos:
+. ITRs:
-** 1    99°C    7’
+* NotI and PstI (in sequence?) flank the ITRs: its the question if we can/must delete them?
-** 2    99°C    1’
+* where exactly starts and ends the sequence (Patrick)?
-** -1°C  R=0.3 °/s
+* it should be checked up if there is a possibility to use all of the three ITRs.
-** Goto 2 rep 74
+* we blasted the ITR (left) of the MCS vektor (Stratagene). we got a 92% "Coverage" with the AAV2 genom (to 100%). from the  alignment (Stratagene ITR with ITR of the AAV2 genom) we got:<br>
-** Hold 4°C
+ [[File:Freiburg10 ITR(left)-Stratagene vs. ITR AAV2.jpg|500x500px|]]
+You can see, that the ITR sequence beginns 4 bp after the PstI restriction site. thereupon we did a secundary structure analyse (www.dinamelt.bioinfo.rpi.edu), with the following structurewe got: <br>
+[[Media:Freiburg10_AAV2ITR(left)nachBlast.pdf]] <br>
+conclusion: the big loop of the secondary structure dosent change if we delete the PstI restriction site (cf. with other uploadet secondary structures), it should be considered that we can't add random bp that could affect the secundary structure. <br>
+<b>To do: which bp, which sequence could/can be insertet? cf. the genome of AAV2</b> <br>
 <br>
-*While hybridization of oligos is performed, digestion of pAAV_MCS vector can be conducted <br>
+. MCS:
-following standard protocol for cloning.
+* replacement through the iGEM-MCS
+* where is the beginning and ending of the MCS in the Vector? ß-globin function and sequence (search for literature and patents, which are denoted in the AAV-Helper-Free-System Manual)
+* in this context it would be also important to find out where the beta-Globulin-Intron exactly starts or rather we can cut out the MCS.
 <br>
-*Title: Ligation MCS_Oligo with pAAV_MCS
+. enzymes:
-*Plasmid: pAAV_MCS
+* Thymidinkinase: find informations. TK30 (Bea), SR39 (Hanna)
-*Buffer used: 3
+* Cytosindeaminase: find informations (Adrian)
-*BSA: Yes
-*Measure DNA-concentration with Nanodrop
-*DNA-Concentration:260 ng/uL
-*Restriction-enzyms used: http://www.neb.com/nebecomm/DoubleDigestCalculator.asp
-Enzyme1 (Nr. Lab: 152): ClaI
-Enzyme2 (Nr. Lab: 15): BglII
 <br>
-*Digestion components :
+in addition we downloadet, addet and anotated the sequence of the pHelper plasmid of stratagene in Geneious (see "Constructs").
-{| border="1"
-| '''components'''   || align="right" | '''pAAV_MCS'''
+insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)
-|-
-| DNA  ||  align="right" | 4
+===7. Labday 07.05.2010===
-|-
-| BSA (10x) ||  align="right" |3
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Protocolls</b></p>====
-|-
-| Buffer 3 (10x)||  align="right" |3
+<p><b>Investigators: Anissa, Kerstin </b></p><br>
-|-
-|Enzyme: ClaI (no.Lab:152)||  align="right" |2
+* adaption and extension of the standart prorcolls (Cloning for Pro's)
-|-
+* we startet to create a protokoll-mask for the praktical-cloning (short version for labwork)
-|Enzyme: BglII (no.Lab:15)||  align="right" |1
-|-
+===8. Labday 10.05.2010 ===
-|H<sub>2</sup>O||  align="right" |17
-|-
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Stock solutions</b></p>====
-|'''Total volume'''||  align="right" |<b>30</b>
-|}
+<p><b>Investigators: Adrian, Chris W., Chris L., Bea, Achim, Patrick, Hanna, (Sven)</b></p><br>
-*Incubate for 1,5 h at 37°C
+The following stock solutions were prepared: <br>
+. Antibiotics:
+* Ampicillin: 2 g Ampicillin were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at -20°C.
+* Chloramphenicol: 0.5 g Chloramphenicol were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at the -20°C.
+* Kanamycin: 1 g Kanamycin was dissolved in 20 mL multipore-H2O, sterilized by filtration and filled into 2 mL tubes and stored at the -20°C.
+* Tetracyclin: 0.5 g Tetracyclin were dissolved in 20 mL ethanol (70%) and filled into 2 mL tubes. The tubes were wrapped with aluminium foil (light sensitive!) and stored at -20°C.
+. ITPG solution (1 M):
+* ~ 4.766 g ITPG were dissolved in 20 mL multipore-H2O, sterilized by filtration, filled in 2 mL tubes and stored at -20°C.
+. DYT (5 litres)
+* 80 g Bactotrypton, 50 g Bactoyeast, 25 g NaCl were weight out.
+* 2 L multipore-H2O were added
+* after mixing, multipore-H2O was added -> endvolume 5 litres
+* medium was filled into flask and was autoclaved
+. Glycerol:
+* Glycerol was filled into a flask and was then autoclaved
+'''To do: register at Mr. Gene!!!'''
 <br>
-*1% Agarose gel
-**1% agarose gel was prepared, gel ran for 45 minutes( first: 90V, after 15 minutes: 115 V)
-<br>
-*Amount of loading dye added
-{| border="1"
-|<b>sample/µL </b>||align="right"| '''loading dye/µL'''
-|-
-| marker: 8 ||align="right"|contains loading dye
-|-
-|pAAV_MCS: 24 ||align="right"|6
-|-
-|}
-<br>
-*Expected size of fragments
-{| border="1"
+===9. Labday 17.05.2010===
-|  '''sample''' ||align="right"| '''expected size'''
-|-
-|  align="right" | pAAV_MCS: cut with ClaI and BglII||align="right"|4580 bp
-|-
-|}
-<br>
-==== 19. Labortag 02.06.2010: Oligos (NotI)====
+====<p style="font-size:15px; background-color:#66bbFF;"><b>β-Globin</b></p>====
-Investigators: Adrian, Bea, Chris W., Hanna, Anissa<br>
+<p><b>Investigators: Bea, Chris W., Patrick, Hanna (and instructors)</b></p><br>
 <br>
-'''Practical work:''' <br>
+We blasted the sequence of the β-globin and additional nukleotides „vorne und hintendran“.
-Control plate contained no clones. :)
+We found only 70% coverage with the human β-globin-intron add. some parts of the exon 3.
-colonies were picked and grown @ 37°C over night.
+For this reason we think that the pAAV_MCS annotation of the β-Globin-intron of Stratagene is too generously.<br>
-<br>
+In addition the alignment of the human ß-globin showed that only parts of the intron 2 (5’) and exon 3 are integratet into the vector.
-'''Theoretical work:'''<br>
+We assume that the informations from Stratagene are not total correctly ( intron flanket by the splicedonors and the acceptor-sequence).
-Oligos for site directed mutagenesis of the NotI restriction sites in pAAV_MCS (ITRs) were designed:[[File:Freiburg10 NotI ITR Oligos.pdf]]
+We blasted the sequence between the CMV-promoter and the origin beginning of the ß-globin intron.
+We found a 98,8% coverage with a synthetic CMV-promoterconstruct ( 1 nucleotide difference).
+Literature: „Diverse plasmid DNA vectors by directed  molecular evolution of cytomegalovirus promoters. (Wright A. et al.)“<br>
+→The question arises if we can omit the ß-globin (because the exact function is unknown).
+For this we should contact various Companys (GeneArt, DNA2.0, Mr. Gene,…) to get more information.
+In addition we could test the expression with and without ß-globin.
 <br>
-'''Sponsoring work:''' <br>
-Sponsoring letter was adapted for Quiagen.
-====20. Labortag 03.06.2010:  pAAV_RFC25_MCS -> problem====
+===10. Labortag 18.05.2010===
-Investigators: Anissa, Bea, Melanie, Christian L.
+====<p style="font-size:15px; background-color:#66bbFF;"><b>pCMV_mVenus_YFP</b></p>====
-<br>
-'''Comment''': Continue with Mini-Prep and test digestion of pAAV_RFC25_MCS <br>
-Mini-Prep and test digestion have been performed: <br>
-<span style="color:red; font-weight:bold;">Problem</span>: Designed oligos (MCS_RFC25) for altering the MCS of the pAAV_MCS vector cannot be used. <br> Two startcodons are in the MCS.
+<p><b>Investigator: Bea, Chris W., Patrick, Hanna, Anissa, Kerstin, Adrian (und Instructors)</b></p>
-[[File:Oligo RFC25 MCS.jpg|800px|thumb|left| Oligo MCS_RFC25: contains 2 Startcodons. the "wrong" Codon is the first ATG which results in peptide chain with 30 aa. The second ATG is the right ATG which is right before the Gene of Interest.]]
+Theoretical cloning with Geneious of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP</b>
+<ul>
+<li>Enzyme set: RFC 25 (iGEM)
+<li> digest pGA14_mVenus_YFP (insert) with XbaI and PstI: mVenus_YFP_cut_XbaI+PstI
+<li> digest pCMV_MCS (vector) with XbaI and PstI: pCMV_MCS_cut_XbaI+PstI
+<li> ligate mVenus_YFP_cut_XbaI+PstI with pCMV_MCS_cut_XbaI+PstI
 <br>
-<br>
+ [[File:Freiburg10 pCMV MCS mVenus YFP.png|500x500px|]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-The two startcodons are not in the same open reading frame (ORF). Therefore two proteins will be produced. The Gene of Interest and the short peptide (30 aa).<br>
-The idea of the oligos was to ligate the oligos into the pAAV_MCS vector. The oligos contained two overhangs which correspond to the sequences of the two restriction sites ClaI and BglII: <br>
-The pAAV_MCS vector was digested with ClaI and BglII and then we ligated the oligo and the vector. Problem was that we did not notice that the overhang of ClaI and the sequence of EcoRI of the MCS_RFC25 resulted in another ATG startcodon.
-<br>
-<br>
-'''Possible Solutions''':
-<ul>
-# first: modify MCS with ordered oligos of Sven (shorter MCS which cannot be used for pEX)and clone mVenus
-# Perform site-directed-mutagenesis (QuikChange from Stratagene)
-# Order new MCS-oligos and consider that '''no''' new ATG is produced. For example: add another base between ClaI overhang and EcoRI sequence. -----AT'''X'''G---- '''This solution is the more possible one we are going to perform.'''
 </ul>
-<br>
-<span style="color:blue; font-weight:bold;">Practical work</span>
+===11. Labortag 19.05.2010===
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP</b></p>====
+<p><b>Investigators: Adrian, Bea, Chris W., Hanna, Patrick</b></p>
+<b>Digestion</b>
 <br>
 <ul>
-*Preparing four glycerol stocks (2:1)
+<li>plasmid: insert: pGA14_mVenus_YFP; number: P1 production date: ____ origin: ____ </li>
-**numbers: B4 - B7 (for details see nomenclature)
+<li>plasmid: vector: pCMV_MCS; number: P2 production date: ____ origin: ____ </li>
-**stored in -80°C, Box 1
+<li>new vector name: pCMV_mVenus_YFP <br></li>
-</ul>
+<li>buffer used:3 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme PstI(no.Lab:___)</li>
-*<b>MiniPrep</b>
+<li>DNA concentration (vector): 375 ng/µl ; DNA concentration (insert): 476 ng/µl</li>
-**Nanodrop concentrations
-<br>
 {| border="1"
-| align="right" | '''Sample''' ||align="right"| '''Concentration/ng*µl-1'''
+| components   || align="right" | V (pGA_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl
 |-
-|  align="right" | P11 ||align="right"|340,5
+| DNA  ||  align="right" | 4||align="right"|2,7
 |-
-|  align="right" | P12 ||align="right"|364,0
+| BSA (10x) ||  align="right" |2||align="right"|2
 |-
-|  align="right" | P13 ||align="right"|358,5
+| Buffer 3 (10x)||  align="right" |2||align="right"|2
 |-
-|  align="right" | P14 ||align="right"|284,4
+|Enzyme: XbaI (no.Lab:___)||  align="right" |1,5||align="right"|1,5
 |-
-|}
+|Enzyme: PstI (no.Lab:___)||  align="right" |1||align="right"|1
-<br>
-*Test digestion
-<br>
-{| border="1"
-| Components   || align="right" |Volume µl ||align="right"| Mastermix µl
 |-
-| DNA  ||  align="right" | 800 ||  align="right" | --
+|H2O||  align="right" |9,5||align="right"|10,8
 |-
-| BSA (10x) ||  align="right" | 1,5 ||  align="right" | 7,5
+|'''Total volume'''||  align="right" |<b>20</b>||align="right"|<b>20</b>
-|-
-| Buffer No.2 (10x)||  align="right" | 1,5 ||  align="right" | 7,5
-|-
-|Enzyme 1 (no.Lab:45) Nde I ||  align="right" | 0,5 ||  align="right" | 2,5
-|-
-|Enzyme 2 (no.Lab:71) Spe I ||  align="right" | 0,5 ||  align="right" | 2,5
-|-
-|H<sub>2</sup>O||  align="right" | variable ||  align="right" | --
-|-
-|'''Total volume '''||  align="right" | 15 ||  align="right" | 20
 |}
-<br>
-{| border="1"
-| Sample   || align="right" | Volume/ µl ||align="right"| H<sub>2</sup>O / µl
-|-
-| P11  ||  align="right" | 2,3 ||align="right"| 8,7
-|-
-| P12  ||  align="right" | 2,2 ||align="right"| 8,8
-|-
-| P13  ||  align="right" | 2,2 ||align="right"| 8,8
-|-
-| P14  ||  align="right" | 2,8 ||align="right"| 8,2
-|-
-|}
-*Incubation: 1,5 h
-<br>
-<li>Agarose-Gel
-*Materials
+<li> Incubation: 1 h at 37°C</li>
-,5 g Agarose, 50 ml TAE, 3µl GELRED, at 100 Volt, running time: 45 minutes
+</ul>
+<b>1% Agarose gel and Gel extraction</b>
+<ul>
+<li>prepare 1% agarose gel, run gel for 45 minutes(119 V)</li>
+<li>cut out insert and vector</li>
+<li>perform gel extraction following standard protocol provided by Qiagen</li>
+</ul>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+<b>Ligation</b>
-!Sample
-!Sample/µl]
-!Loading dye (5x/6x)/µl
-!Expected size 1 (Geneious)
-!Expected size 2 (Geneious)
-|--
-|P11
-|15 µl
-|3 µl
-|3677 bp
-| 974 bp
-|--
-|P12
-|15 µl
-|3 µl
-|3677 bp
-| 974 bp
-|--
-|P13
-|15 µl
-|4 µl
-|3677 bp
-| 974 bp
-|--
-|P14
-|15 µl
-|4 µl
-|3677 bp
-| 974 bp
-|--
-|}
-{| align=right
-|}
-{| border="1"
-|
-!Marker
-!Sample P11 /18 µl
-!Sample P12 /18 µl
-!Sample P13 /19 µl
-!Sample P14 /19 µl
-|-
-!Lane
-| 1
-| 3
-| 5
-| 7
-| 9
-|-
-|}
-'''Results of agarose-gel:'''
-<br>
 <ul>
-*Expected fragments of 3677 bp and 974 bp can be cerified. The insertion of the RFC25_MCS has been inserted. <br>
+<li>Measure DNA-concentration with Nanodrop </li>
-For further verification the insert has to be sequenced has to be conducted (to do for 04.06.2010). <br>
+<li>c(mVenus_YFP) = 16,8 ng/µL</li>
+<li>c(pCMV_MCS) = 22,8 ng/µL</li>
+<li>Calculation of volume needed for ligation:
+<li>c(mVenus_YFP) = 3,66 µL</li>
+<li>c(pCMV_MCS) = 5,34 µL</li></li>
 </ul>
-<br>
-<span style="color:blue; font-weight:bold;">Picking clones of Thymindinkinase of Amor</span>
+<b>Transformation</b>
-**5 clones of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 with the thymidinkinase''' have been picked from LBamp-agarplates
-**1 clone of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 without the thymidinkinase (control) has been picked from LBamp-agarplates
-**all clones have been inoculated in 10 mL LB containing 10 µL Amp. Incubation: 37°C over-night.
-**'''to do: Mini-Prep of pUB6/HV5/His6 with the thymidinkinase and pUB6/HV5/His6 without the thymidinkinase (control)'''
-<br>
-<span style="color:blue; font-weight:bold;">Idea</span>
 <ul>
-*Insertion of Kozak consensus sequence before MCS to enhance gene expression (cloning consideration in Stratagene manual)
+<li>Transformation has been followed the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]] </li>
-** New RFC standard with Kozak sequence for eucaryotes??
+</ul>
-====21. Labortag 04.06.2010: DKFZ plasmid Retrafos, TK/GMK Mini-Prep====
+===12. Labortag 20.05.2010===
-Investigators: Adrian, Bea, Chris W., Hanna<br>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Picking clones</b></p>====
-<p style="font-size:15px; font-weight: bold; color: green;"><u>DKFZ</u></p>
-'''Comments''': Plasmids of PD Kleinschmidt of the DKFZ arrived. The DNA was dried on a whatman paper.<br>
+<p><b>Investigators: Adrian, Bea</b></p>
-Plasmids received: <br>
+<ul><br/>
+Clones were picked according to the standard protocol.
-*'''pXX6''' alle Adenovirus Helfer Gene ohne AAV Gene; Plasmid von J. Samulski; evtl. Anfragen für Benutzererlaubnis
+*3 approaches from each plate</li>
-*'''pKEX-2XL.Rep40''' Expressionsplasmide für das Rep Proteine 40
-*'''pKEX-2XL.Rep 52''' Expressionsplasmide für das Rep Proteine 52
-*'''pKEX-2XL.Rep 68''' Expressionsplasmide für das Rep Proteine 68
-*'''pKEX-2XL.Rep 78''' Expressionsplasmide für das Rep Proteine 78
-*'''pCMV-VP(HS)''' Expressionsplasmid der drei VP Proteine in Kombination (assemly kompetent
-*'''pKEX-VP1''' Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
-*'''pKEX-VP2'''Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
-*'''pKEX-VP3'''Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
-*'''pTRUF_CMV_eGFP'''Einzelstrang Vektor zur Expression von eGFP
-*'''dsAAV_CMV_eGFP'''"self complementary" Expressionsvektor von X. Xiao; evtl. anfragen wegen Benutzererlaubnis
-*'''pTAV2 (gesamtes AAV Genom im "blue script" Vektor)
-*'''pDG''' komplettes Helferplasmid zur Vektorherstellung; Grimm et al. 1998
-<br>
-*In order to obtain the DNA following steps have been performed:
-**cut out the spot where the DNA is spotted with a clean scalpel (note: scalpel should not have any contamination).
-**put a 0,5 mL Eppi in a 1,5 mL Eppi. Put little holes in the smaller eppi.
-**transfer Whatman paper into Eppi
-**add 50 µL TE-EF (Redissolving buffer) to whatman paper and wait 15 minutes
-**centrifuge eppis at 2000 rpm, 10 minutes
-*Transformation with obtained plasmids was performed.
 </ul>
-<br>
-<p style="font-size:15px; font-weight: bold; color: green;"><u>Fusion Enzyme: Thymidinkinase/Guanylate Kinase (TK/GMK)</u></p>
-<p style="font-size:12px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
-*experiment date: 04.06.2010 ; time: 3,5h
-*name of investigator: Adrian, Bea, ChrisW.,Hanna
-*new vector name: pUB_V5_His6 + TK/GMK (fusionenzyme)
-<br />
-<u>Glycerol Stocks</u>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5'''||align="left"|'''Control'''
-|-
-| align="left" | '''Bacteria strain''' ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue
-|-
-| align="left" | '''Plasmidname''' ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK
-|-
-| align="left" | '''Date''' ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010  ||align="left"| 04.06.2010 ||align="left"| 04.06.2010
-|-
-| align="left" | '''given number''' ||align="left"| B8 ||align="left"| B9 ||align="left"| B10 ||align="left"| B11 ||align="left"| B12 ||align="left"| B13
-|}
-<br />
-<u>Given Plasmid-Number</u>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Control'''
-|-
-| align="left" | '''given number''' ||align="left"| P15 ||align="left"| P16 ||align="left"| P17 ||align="left"| P18 ||align="left"| P19 ||align="left"| P20
-|}
-<br />
-<p style="font-size:12px; font-weight: bold; color: blue;"><u>Nanodrop concentration</u></p>
-*Plasmid
-**Given Plasmid-Number: P15; DNA concentration: 493,7 ng/µL ;
-**Given Plasmid-Number: P16; DNA concentration: 464,4 ng/µL;
-**Given Plasmid-Number: P17; DNA concentration: 445,6 ng/µL;
-**Given Plasmid-Number: P18; DNA concentration: 562,9 ng/µL;
-**Given Plasmid-Number: P19; DNA concentration: 528,1 ng/µL;
-**Given Plasmid-Number: P20; DNA concentration: 499,9 ng/µL;
-<br />
-'''Comments:'''A Plasmid-Mini Prep with the received Fusionenzyme Thymidinkinase/Guanylate Kinase (TK/GMK)from Amor has been performed.<br>
-The DNA will be sent to GATC for sequencing.
-*pUB6_V5_His6 - clone 1 (P15) (3 µL added to 27µL H20) has been sent to GATC.
-*Expected results: Saturday
-<br />
+====13. Labortag 21.05.2010: CMV-Promoter====
 <br>
+<b>Theoretical cloning:</b> (Volker, Hanna)
-====22. Labortag 05.06.2010: Insertion of iGEM expression parts into pAAV_MCS====
+* The CMV promoter (mainly the regulatory region) was further characterized: For this purpose U.S. patent no. 5,385,839 was used. [[Media:Freiburg10_Patent_US5385839A.pdf]]
+* Further on the CMV promoter sequence was blasted. The results delivered a 98% query coverage with the "Human herpesvirus 5 strain Toledo, complete genome" (accession no.: GU937742.1). Interestingly the maximal identity was just 99%. This can be explained due to a nucleotide deletion and a C-T transition (red circles), which were also marked in Geneious.
-Investigators: Adrian, Bea, Melanie, Hanna<br>
+[[File:Freiburg10_CMV-Alignment.jpg|500x500px|]]
 <br>
-<p style="font-size:15px; font-weight: bold; color: blue;">Hybridization:</p>
+[[File:Freiburg10 CMV.jpg|800x800px|]]
-*Hybridization of received oligos: iGEM expression parts (RFC25 without EcoRI, NotI)
-*Prior to opening the tubes, they were centrifugated at 13.000 rpm for 30 sec.
-**expression part MCS_for (charge-no: ST00114065): 108 µL Millipore H<sub>2</sup>O (Volume on obtained sheet)were added.
-**expression part MCS_for (charge-no: ST00114066): 165 µL Millipore H<sub>2</sup>O (Volume on obtained sheet)were added.
-*Resuspended DNA was vortexted.
-*Aliquots of both Oligos (1:10) were prepared: 10 µL Oligo + 90 µL H<sub>2</sup>O (final volume usually 100 µl).
-*Mix together(into PCR-tube):
 <br>
-{| border="1"
+'''To do''': find "+1"-location (transcription start); which transcription factors bind to the regulatory region of the CMV promoter?
-| align="right" | '''Volume/µL''' ||align="right"| '''solution'''
-|-
-|  align="right" | 10 (1:10)||align="right"|Oligo 1: expression part MCS_for (charge-no: ST00114065)
-|-
-|  align="right" |10 (1:10)||align="right"|Oligo 2: expression part MCS_for (charge-no: ST00114066)
-|-
-|  align="right" |4||align="right"| 100 mM TrisHCl pH8
-|-
-|  align="right" |8||align="right"|5 mM MgCl2
-|-
-|  align="right" |8||align="right"| H20
-|}
 <br>
-* Program: ORIGAMI 1 modified for long oligos:
-** 1    99°C    7’
-** 2    99°C    1’
-** -1°C  R=0.3 °/s
-** Goto 2 rep 74
-** Hold 4°C
 <br>
-*While hybridization of oligos was performed, digestion of pAAV_MCS vector was conducted <br>
+'''LB medium''' was prepared: (Patrick and Chris W.)
-following standard protocol for cloning.
+* 10 g Bacto-Tryptone, 5 g Bacto-Yeast, 10 g NaCl were mixed in 500 mL milipore-H2O.
+* Volume was adjusted to 1 L with milipore-H2O.
+* 100 mL flasks were each filled with 50 mL medium.
+* 0.75 g agar was added to each flask.
+* LB was sterilized by autoclaving and is now stored at room temperature.
 <br>
 <br>
-<p style="font-size:15px; font-weight: bold; color: blue;">Digestion:</p>
+<b>Plasmid Mini-Prep according to the standard protocol</b>
-*Title: Ligation iGEM expression parts (="iGEM-MCS") with pAAV_MCS
-*Plasmid: pAAV_MCS
-*Buffer used: 3
-*BSA: Yes
-*DNA-Concentration: 260 ng/uL
-*Restriction-enzyms used:
-Enzyme1 (Nr. Lab: 152): ClaI
-Enzyme2 (Nr. Lab: 15): BglII
-<br>
-*Digestion components :
-{| border="1"
+<ul>
-| '''components'''   || align="right" | '''pAAV_MCS'''
+<li>investigator: Adrian, Kira, Anna, Chris W., Patrick</li>
-|-
+<li>Measure DNA-concentration with Nanodrop</li>
-| DNA  ||  align="right" | 5.8 µL
+</ul>
-|-
-| BSA (10x) ||  align="right" |3 µL
-|-
-| Buffer 3 (10x)||  align="right" |2 µL
-|-
-|Enzyme: ClaI (no.Lab:152)||  align="right" |2 µL
-|-
-|Enzyme: BglII (no.Lab:15)||  align="right" |1 µL
-|-
-|H<sub>2</sup>O||  align="right" |16.2 µL
-|-
-|'''Total volume'''||  align="right" |<b>30 µL</b>
-|}
-*Mixture was incubated for 1,5 h at 37°C.
-<br>
-<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
-*1% agarose gel was prepared, gel ran for 45 minutes(110 V)
-<br>
-*Amount of loading dye added
-{| border="1"
-|<b>sample/µL </b>||align="right"| '''loading dye/µL'''
-|-
-| marker: 8 ||align="right"|contains loading dye
-|-
-|pAAV_MCS: 30 ||align="right"|6 (6x loading dye)
-|-
-|}
-<br>
-*Expected size of fragments
 {| border="1"
-|  '''sample''' ||align="right"| '''expected size'''
+| || align="right" | P3 (pCMV_mVenus_YFP)   ||align="right"| P4 (pCMV_mVenus_YFP)  ||align="right"| P5 (pCMV_mVenus_YFP)
-|-
-|  align="right" | pAAV_MCS: cut with ClaI and BglII||align="right"|4580 bp
 |-
+| concentration (ng/µl)||  align="right" | 457||align="right"|470,8||  align="right" | 477,29
 |}
+===14. Labortag 25.05.2010===
-</ul>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV_mVenus_YFP + pAAV_MCS</b></p>====
-<br>
-<br>
+<p><b>Investigators: Kira, Anna, Volker, Jessica</b></p>
-<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction:</p>
-<br />
-Gel measurement:
-<br />
-{| border="1"
-| align="left" | '''Sample''' ||align="left"| '''weight'''
-|-
-| align="left" |pAAV_MCS ||align="left"| 60 mg
-|-
-|}
-*Gelextraction was performed following standard protocol.
-*DNA-concentrations were meassured: pAAV_MCS 18.2 ng/µL, Oligos: 136.7 ng/µL -> 1:10 dilution was prepared: 13.67 ng/µL
-<br /><br />
-<p style="font-size:15px; font-weight: bold; color: blue;">Ligation:</p>
-<br />
-{| border="1"
-| align="left" |  ||align="left"| '''iGEM-MCS''' ||align="left"| '''pAAV_MCS'''
-|-
-| align="left" | '''Volume/µl''' ||align="left"| 0.4 ||align="left"| 8.6
-|}
-<br />
-Trafo was performed (using XL1B cells) following standard protocol.
-<br>
-<br>
-====23. Labortag 07.06.2010: Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)====
-investigators: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-MCS</u></p>
-<p style="font-size:15px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
-*experiment date:07.06.2010; time: whole day
-*name of investigator: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea
-<br />
+<li>plasmid: insert: pCMV_mVenus_YFP; number: P5 production date: 21.05.2010 origin: ____
-<u>Glycerol Stocks</u>
+<li>plasmid: vector: pAAV_MCS; number: P? production date: ____ origin: ____
-{| border="1"
+<li>new vector name: pAAV_mVenus_YFP <br>
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''
-|-
-| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
-|-
-| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM-MCS ||align="left"| pAAV_iGEM-MCS||align="left"| pAAV_iGEM-MCS||align="left"| pAAV_iGEM-MCS
-|-
-| align="left" | '''Date''' ||align="left"| 07.06.2010 ||align="left"| 07.06.2010||align="left"| 07.06.2010||align="left"| 07.06.2010
-|-
-| align="left" | '''given number''' ||align="left"| - ||align="left"| B27 ||align="left"| B28||align="left"| B29
-|}
-<br />
-<u>Given Plasmid-Number</u>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''
-|-
-| align="left" | '''given number''' ||align="left"| - ||align="left"| P34.2 ||align="left"| P34.3||align="left"| P34.4
-|}
-<br />
-<p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
-*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) NdeI
-*Plasmid
-**Given Plasmid-Number: P34.2; DNA concentration: 433.78 ng/µL ;
-**Given Plasmid-Number: P34.3; DNA concentration: 408.48 ng/µL ;
-**Given Plasmid-Number: P34.4; DNA concentration: 409.80 ng/µL ;
-<br />
+<br>
-'''Comments:'''Clone no.1 was dismissed...
+'''1st try:
-<br />
-<br />
-'''Test digestion:'''
-{| border="1"
-| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix'''
-|-
-| align="left" | DNA (clone 2)||align="left"| 1000 ng ||align="left"| -
-|-
-| align="left" | BSA (10x) ||align="left"| no ||align="left"| -
-|-
-| align="left" | Buffer no. 4 (10x) ||align="left"| 1.5 µL||align="left"| -
-|-
-| align="left" | Enzyme 1 (no. Lab:    ) AgeI ||align="left"| 0.75 µL ||align="left"| -
-|-
-| align="left" | Enzyme 2 (no. Lab:    ) NdeI ||align="left"| 0.5 µL||align="left"| -
-|-
-| align="left" | H<sub>2</sup>O ||align="left"| variable ||align="left"| -
-|-
-| align="left" | '''Total volume''' ||align="left"| '''15 µL''' ||align="left"| -
-|}
-<br />
-{| border="1"
-| Sample   || align="right" | Volume sample/ µl ||align="right"| Volume H<sub>2</sup>O / µl
-|-
-| P34.2  ||  align="right" |2.3 ||align="right"| 9.95
-|-
-| P34.3  ||  align="right" | 2.4 ||align="right"| 9.85
-|-
-| P34.4  ||  align="right" | 2.4||align="right"| 9.85
-|-
-|-
+<li>buffer used:3 ; Restriction-enzymes used: Enzyme NotI (no. Lab:46)
-|}
+<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl
-*Incubation: 45 min, 37°C
-<br />
-<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
-<br />
-.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 110 Volt, running time: 45 minutes
-<br />
-<br />
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
-!Sample
-!Sample/µl]
-!Loading dye (5x/6x)/µl
-!Expected size 1 (Geneious)
-!Expected size 2 (Geneious)
-|--
-|P34.2
-|15 µl
-|3 µl
-|3686 bp
-|951 bp
-|--
-|P34.3
-|15 µl
-|3 µl
-|3686 bp
-|951 bp
-|--
-|P34.4
-|15 µl
-|3 µl
-|3686 bp
-|951 bp
-|--
-|}
-{| align=right
-|}
-<br />
-*Marker: GeneRuler ladder mix
 {| border="1"
-|
+| components   || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl
-!Marker
-!Sample
-!Sample
-!Sample
 |-
-!Lane
+| DNA  ||  align="right" | 4.2||align="right"|3.5
-|34.2 / 18 µl
-| 34.3 / 18 µl
-|34.4 / 18 µl
 |-
-|}
+| BSA (10x) ||  align="right" |3||align="right"|3
-<br />
-<br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Kleinschmidt-plasmids</u></p>
-<p style="font-size:15px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
-*experiment date: 07.06.2010 ; time: 10 – 20 h
-*name of investigator: Kira, Achim, Jessy, Bea, Adrian, Hanna
-*Kleinschmidt-plasmids
-<br />
-<u>Glycerol Stocks</u>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7''' ||align="left"| '''Clone 8''' ||align="left"| '''Clone 9''' ||align="left"| '''Clone 10''' ||align="left"| '''Clone 11''' ||align="left"| '''Clone 12''' ||align="left"| '''Clone 13'''
 |-
-| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
+| Buffer 3 (10x)||  align="right" |3||align="right"|3
 |-
-| align="left" | '''Plasmidname''' ||align="left"| pXX6 ||align="left"| pKEX-2XL.Rep 40 ||align="left"| pKEX-2XL.Rep 52 ||align="left"| pKEX-2XL.Rep 68 ||align="left"| pKEX-2XL.Rep 78 ||align="left"| pCMV-VP(HS) ||align="left"| pKEX-VP1 ||align="left"| pKEX-VP2 ||align="left"| pKEX-VP3 ||align="left"| pTRUF_CMV_eGFP ||align="left"| dsAAV_CMV_eGFP ||align="left"| pTAV2||align="left"| pDG
+|Enzyme: NotI (no.Lab:46)||  align="right" |1||align="right"|1
 |-
-| align="left" | '''Date''' ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010
+|H2O||  align="right" |15.3||align="right"|15.3
 |-
-| align="left" | '''given number''' ||align="left"| B14 ||align="left"| B15 ||align="left"| B16 ||align="left"| B17 ||align="left"| B18 ||align="left"| B19 ||align="left"| B20 ||align="left"| B21 ||align="left"| B22 ||align="left"| B23 ||align="left"| B24 ||align="left"| B25 ||align="left"| B26
+|'''Total volume'''||  align="right" |<b>26.4</b>||align="right"|<b>25.8</b>
 |}
-<br />
+<li> Incubation: 1 1/2 h at 37°C
-<u>Given Plasmid-Number</u>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7'''||align="left"| '''Clone 8''' ||align="left"| '''Clone 9''' ||align="left"| '''Clone 10'''||align="left"| '''Clone 11''' ||align="left"| '''Clone 12''' ||align="left"| '''Clone 13'''
-|-
-| align="left" | '''given number''' ||align="left"| P21 ||align="left"| P22 ||align="left"| P23 ||align="left"| P24 ||align="left"| P25 ||align="left"| P26 ||align="left"| P27 ||align="left"| P28 ||align="left"| P29 ||align="left"|  P30 ||align="left"| P31 ||align="left"| P32 ||align="left"| P33
-|-
-| align="left" | '''measured concentration''' ||align="left"|351,01 ||align="left"| 673,1 ||align="left"| 532,22 ||align="left"| 579,05 ||align="left"| 725,31 ||align="left"| 659,68||align="left"| 692,8 ||align="left"| 545,46 ||align="left"| 568,34 ||align="left"|  420,62 ||align="left"| 446,95 ||align="left"| 496,8 ||align="left"| 472,58
-|}
-<br />
 <br>
-'''Comments:'''
+'''note: too little water was added
-Many things went wrong today!
-* Glycerol stocks must be vortexted!
-* Check mini-prep buffers - especially buffer PE (needs to contain ethanol!)
-* Always check volumes - try to estimate if volume makes sense (check pipettes!)
-* Don't discard bacteria cultures until glycerol stocks and mini-preps are successfully done!!!
-<p style="font-size:20px; font-weight: bold; color: red;">'''Today's conclusion: Better ask 2 times than do something wrong without asking!!!'''</p>
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)</u></p>
 <br>
-'''Quickchange site directed mutagenesis:'''
+% Agarose gel
-PCR reaction:
-* 2.5 µL 10x Pfu Ultra II buffer
-* 0.5 µL template (therefore the a 1:20 dilution of the pAAV_iGEM-MCS (433 ng/µL) was prepared) = 10.825 ng
-* 0.56 µL primer 1 (of 1:10 dilution)
-* 0.56 µL primer 2 (of 1:10 dilution)
-* 1 µL DMSO (primers form very strong secondary structures)
-* 0.5 µL dNTP
-* 18.88 µL dH<sub>2</sup>O
-* 0.5 µL PfuUltra II fusion (1.25 U)
--> end volume: 25 µL
 <br>
-<br>
+<li>1% agarose gel was prepared, gel ran for 45 minutes(119 V)
-'''PCR program:'''
-<br>
-x : 2' 95°C (HotStart polymerase)
-x : 30 s 95°C -> 1' 55°C -> 5' 68°C
-x : 4°C (over night)
-<br>
-Experiment will be continued tomorrow.
 <br>
 <br>
+'''2nd try:'''
-====24. Labortag 08.06.2010: Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis====
+<li>buffer used:4 ; Restriction-enzymes used: Enzyme NotI (no. Lab:159)
+<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl
-Investigators: Kira, Jessy, Hanna, Achim <br>
-<br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Analysis of iGEM-MCS sequence (RFC25 without EcoRI and NotI):</u></p> <br>
-[[File:Freiburg10 iGEM-MCS.jpg|800x800px|]] <br>
-The alignment with the theoretical pAAV_iGEM-MCS delivered a "C-deletion" within the NgoMIV restriction site. Due to that the pAAV_iGEM-MCS lacks this site. We controlled the bill of delivery and noted that the deletion must be GATC's fault.
-All in all this doesn't matter, because parts which are in iGEM standard can be inserted and therefore they will deliver the lacking NgoMIV restriction site. Further on this could be an advantage because after digestion the fragment which is cut out can be better detected in the gel.
-<br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Insertion of mVenus_YFP into pAAV_iGEM-MCS</u></p>
-<p style="font-size:15px; font-weight: bold; color: blue;">Digestion:</p>
-<li>plasmid: insert: pGA14mVenusGeneart; number: - origin:Sven
-<li>plasmid: vector: pAAV_iGEM-MCS; number: P32.2  production date:05.06.2010 origin: ____
-<li>new vector name: pAAV_iGEM-MCS_mVenus <br>
-<li>buffer used:4 ; Restriction-enzymes used: Enzyme AgeI (no. Lab:149); Enzyme XbaI (no. Lab: 63)
-<li>DNA concentration (vector):433,78ng/µl ; DNA concentration (insert): 530 ng/µl<br /><br />
 {| border="1"
-| components   || align="right" | V (pAAV_iGEM-MCS)/ µl ||align="right"| I(pGA14mVenus_Geneart) / µl
+| components   || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl
 |-
-| DNA  ||  align="right" | 2,3||align="right"|3,8
+| DNA  ||  align="right" | 4.2||align="right"|3.5
 |-
-| BSA (10x) ||  align="right" |2||align="right"|2
+| BSA (10x) ||  align="right" |3||align="right"|3
 |-
-| Buffer 3 (10x)||  align="right" |2||align="right"|2
+| Buffer 4 (10x)||  align="right" |3||align="right"|3
 |-
-|Enzyme: AgeI (no.Lab:149)||  align="right" |1,25||align="right"|1,25
+|Enzyme: NotI (no.Lab:159)||  align="right" |1,5||align="right"|1,5
 |-
-|Enzyme: XbaI (no.Lab:63)||  align="right" |0,75||align="right"|0,75
+|H2O||  align="right" |18,3||align="right"|19
 |-
-|H<sub>2</sup>O||  align="right" |11,7||align="right"|10,2
+|'''Total volume'''||  align="right" |<b>30</b>||align="right"|<b>30</b>
-|-
-|'''Total volume'''||  align="right" |<b>20</b>||align="right"|<b>20</b>
 |}
-<li> Incubation: 1 1/2 h at 37°C<br>
+<li> Incubation: 1 1/2 h at 37°C
-.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 115 Volt, running time:
+<br>
-<br />
+% Agarose gel
-<br />
+<br>
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)
-!Sample
+<br>
-!Sample/µl]
-!Loading dye (6x)/µl
-!Expected size 1 (Geneious)
-!Expected size 2 (Geneious)
-|--
-|P34.2
-|20 µl
-|4 µl
-|4617 bp
-|22 bp
-|--
+<font color=#FF00FF>Results: unexpected sizes of fragments (see protocol), try again next day with an ethidium bromid gel</font>
-|pGA14mVenus
-|20 µl
-|4 µl
-|2870 bp
-|774 bp
-|}
-<br /><br />
-<li>Gel loaded with vector and insert samples, 24 µl each & 8 µl marker
-<li>after 20 minutes, the insert band was cut out. Two overlapping bands were visible in the vector well, after 1 1/2 hours those bands were separated and both were cut out. <br /><br />
-{| border="1"
-| Sample|| align="right" | weight || align="right" | concentration
-|-
-| Vektor_Oben  ||  align="right" |0,32 g  ||  align="right" |29,8 ng/µl
-|-
-| Vektor_Unten ||  align="right" |0,14 g  ||  align="right" |12,8 ng/µl
-|-
-| Insert||  align="right" |0,3 g  ||  align="right" |12,9 ng/µl
-|}
-<br /><br />
-<li>the exact volume of insert and vector was calculated with LabTools:
-<li>Ligation I with Vektor_Oben:
-<ul>
-*Vector: 4,16 µl
-*Insert: 4,84 µl
-</ul>
-<li>Ligation II with Vektor_Unten:
-<ul>
-*Vector: 6 µl
-*Insert: 3 µl
-</ul>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>continuation of site-directed mutagenesis</u></p>
-<p style="font-size:15px; font-weight: bold; color: blue;">Digestion with DpnI:</p>
-<li>0.5 µl DpnI added
-<li>incubated for 1 hour at 37°C
-<p style="font-size:15px; font-weight: bold; color: blue;">Trafo:</p>
-<li>Cells used for transformation: XL1B
-<li>Centrifugation for 3 min at 8000 rpm instead of 6000 rpm (accidentaly)
-<li>Plated on agar plate: pAAV_IGEM-MCS Mutagenese PST1 8.6.2010 AM XL1B
-<li>incubated over night
 <br>
 <br>
-====25. Labortag 09.06.2010: pAAV_iGEM-MCS_mVenus-YFP, site-directed mutagenesis====
-investigators: Jessy, Achim, Sven, Toby, Hanna
 <br>
-<p style="font-size:15px; font-weight: bold; color: red;">'''No pAAV_iGEM-MCS_w/oPstI transformed bacteria (site-directed mutagensis) grew on the ampicillin agar plates over night! '''</p> Experiment is conducted again by Toby (Thanks a lot!!!).<br>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Production of chemical competent E.coli</b></p>====
+<p><b>Investigators: Patrick and Jessica</b></p>
+<br>
+competent E.coli XL-1-blue and competent E.coli BL21 produced according to the standard-protocoll [[Media:production of competent E.coli.pdf]]<br>
 <br>
-<p style="font-size:15px; font-weight: bold; color: red;">'''Further on the cloning of mVenus-YFP into pAAV_iGEM-MCS seemed to fail: '''</p> Only on the agar plate cotaining the bacteria transformed with the "vector_oben" ligation, which actually should be the "wrong" ligation (gelextraction of a band which contained fragments that were too large, see picture in lab journal), revealed colonies. Therefore this experiments is also conducted one more time by Sven (thanks also a lot!!!)<br>
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Insertion of mVenus_YFP into pAAV_iGEM-MCS</u></p>
-*experiment date: 9.6.2010
-*name of investigator: Sven
-*plasmid:
-**Vector: name: pAAV_iGEM-MCS number: 34.2 production date: 5.6.2010
-**Insert: name: pOG14_mVenus number: - production date: ____ origin: Sven :)
-*new vector name: pAAV_iGEM-MCS_mVenus-YFP
-*buffer used: NEB4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) XbaI
-*DNA concentration (vector): 433 ng/µL ; DNA concentration (insert): 530 ng/µL
-<br />
-<br />
-<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
-{| border="1"
-| components   || align="right" |volume of vector /µl || align="right" |volume of insert /µl
-|-
-| DNA  ||  align="right" |2.83  ||  align="right" | 2.77
-|-
-| BSA (100x) ||  align="right" | 0.5 ||  align="right" | 0.5
-|-
-| Buffer NEB4 (10x)||  align="right" | 3.0 ||  align="right" | 3.0
-|-
-|Enzyme 1 (AgeI)||  align="right" | 1.75 ||  align="right" | 1.75
-|-
-|Enzyme 2 (XbaI)||  align="right" | 1.25 ||  align="right" | 1.25
-|-
-|H<sub>2</sup>O||  align="right" |20.73 ||  align="right" | 20.67
-|-
-|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | 30 ||  align="right" | 30
-|}
-<br /><br />
-<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
-<br />
-.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED (3-6µl), at 115 Volt
-<br />
-<br />
-<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Design of MCS-Oligos</b></p>====
-<br />
+<p><b>Investigators: Bea, Adrian, Hanna, Sven</b></p>
-* insert (mVenus-YFP): 26 ng/µL
-* vector (pAAV_iGEM-MCS): 30 ng/µL
-<p style="font-size:15px; font-weight: bold; color: blue;">Ligation</p>
-<br />
-* vector: 5.85 µL
-* insert: 3.15 µL
-* ligase: 1 µL
-* buffer: 10 µL
 <br>
-<br />
+In order to replace the multiple cloning site of the pAAV_MCS vector from Stratagene by RFC25, two oligos were designed. After their hybridization the overhangs correspond to ClaI- and BglII restriction sites. A digestion with BglII and ClaI will be performed with pAAV-MCS and then will be ligated with the designed oligos.<br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Test digestion of pAAV_iGEM-MCS</u></p>
+The oligos (see link) were ordered at Sigma-Aldrich. Estimated shipment: 31.05.2010 .<br>
-p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
-*buffer used: 1 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) NgoMIV
-*Plasmid
-**Given Plasmid-Number: P34.2 ; DNA concentration: 433.78 ng/µL;
-**Given Plasmid-Number: P34.3 ; DNA concentration: 408.48 ng/µL;
-**Given Plasmid-Number: P34.4 ; DNA concentration: 409.8 ng/µL;
-<br />
-<br />
-{| border="1"
-| align="left" | '''Components''' ||align="left"| '''P34.2 [µL] ''' ||align="left"| '''P34.3 [µL] '''||align="left"| '''P34.4 [µL] '''
-|-
-| align="left" | DNA ||align="left"| 2.3 ||align="left"| 2.5 ||align="left"| 2.4
-|-
-| align="left" | BSA (10x) ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
-|-
-| align="left" | Buffer no. 1 (10x) ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
-|-
-| align="left" | Enzyme 1 (no. Lab: 113) ngoMIV ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
-|-
-|-
-| align="left" | H<sub>2</sup>O ||align="left"| 4.7 ||align="left"| 4.5 ||align="left"| 4.6
-|-
-| align="left" | '''Total volume''' ||align="left"| '''10''' ||align="left"| '''10''' ||align="left"| '''10'''
-|}
-*Incubation: 1 h, 37°C
-<br />
-<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
-<br />
-.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes + 20 minutes
-<br />
-<br />
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
-!Sample
-!Sample/µl]
-!Loading dye (6x)/µl
-!Expected size 1 (Geneious)
-!Expected size 2 (Geneious)
-|--
-|P34.2
-|10 µl
-|2 µl
-|3728 bp
-|903 bp
-|--
-|P34.3
-|10 µl
-|2 µl
-|3782 bp
-|903 bp
-|--
-|P34.4
-|10 µl
-|2 µl
-|3782 bp
-|903 bp
-|--
-|}
+[[File:Freiburg10 Oligos MCS RFC25 for pAAV.pdf]]
-{| align=right
-|}
-<br />
-*Marker: GeneRuler ladder mix
-{| border="1"
-|
-!Marker
-!Sample P34.2 /µl
-!Sample P34.3 /µl
-!Sample P34.4 /µl
-|-
-!Lane
-| 8 µL
-| 10 µL
-| 10 µL
-| 10 µL
-|-
-|}
-<br />
-'''Comments:''' Digestion of P34.2 delivered just one fragment size, revealing that - as expected after sequencing (C-deletion: no NgoMIV site in iGEM-MCS) - there was just one NgoMIV restriction site in the vector. In contrast to that the digestion of P34.3 and P34.4 delivered two bands - whereas the band of the smaller fragments looked like a smier. Because of this obscure and non-satisfying results (besides our assumption that there's something wrong with the marker :) )we decided to sequence the P34.3 vector:
-* c(P34.3): 408.48 ng/µL
-* Volume (plasmid): 5.14 µL
-* Volume (vector): 24.86 µL
-* Name of eppi: HW_34
-* Primer: GATC_std_pTeSp-1
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben</u></p>
+===15. Labortag 26.05.2010===
-*experiment date: 9.6.2010
-*name of investigator: Hanna, Achim
-*plasmid:
-**Vector: name: pAAV_iGEM-MCS_Vektor_oben
-**Insert: name: pOG14_mVenus
-*new vector name: pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben
-<br />
-The Clones were picked and incubated in 10 mL LB-Medium containing 10µL ampicillin over night at 37°C on a rotary shaker.
-===26. Labortag 10.06.2010:===
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Oligos (PstI + MCS)</b></p>====
-====Site-directed mutagenesis of PstI in ITRs====
-<p style="font-size:12px; font-weight: bold; color: blue;">1. Site directed mutagenisis</p><br>
-* Aim: deletion of PstI from both ITR's
+<p><b>Investigators: Bea, Hanna, Jessica</b></p>
-* 2 PCR tubes got prepared, one for the left ITR and one for the right. (The SDM was performed according to the standart protocol)
-* [[Media:Freiburg10_Site_directed_Mutagenesis_pAAV_MCS_deletion_PstI.pdf‎]]
-<br>
-====Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion====
-<p style="font-size:12px; font-weight: bold; color: blue;">2.1 Mini-Prep of pAAV_iGEM_mVenus_YFP</p><br>
-Title: '''pAAV_iGEM_mVenus_'''  <br>
+<ul>
-investigator: Jessy, Achim <br>
+<li>Repeat cloning of pAAV-MCS + pCMV_mVenus_YFP --> <b>Goal: pAAV_mVenus_YFP</b><br>
-<u>Glycerol Stocks</u>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2'''
-|-
-| align="left" | '''Bacteria strain''' ||align="left"| XL1 blue ||align="left"| XL1 blue
-|-
-| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM_mVenus||align="left"| pAAV_iGEM_mVenus
-|-
-| align="left" | '''Date''' ||align="left"| 10.06.2010 ||align="left"| 10.06.2010
-|-
-| align="left" | '''given number''' ||align="left"| B30 ||align="left"| B31
-|}
-<br />
-<u>Given Plasmid-Number</u>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2'''
-|-
-| align="left" | '''given number''' ||align="left"| P35 ||align="left"| P36
-|}
-<br />
-Title: '''pAAV_iGEM_mVenus_YFP''' (guided by Sven) <br>
+Cloning did not work (see lab day 25.05.2010) either with NotI or with NotI-HF. Gel did not show any proper band at the expected size. <br>
-investigator: Bea
+  There will be used EtBr instead of gelred in the agarose gel and the incubation time of digestion will be prolonged. Further details are followed. <br>
-<u>Glycerol Stocks</u>
+NOTE: There are three restriction sites of NotI in the pCMV-mVenus_YFP. If cloning with NotI, the polyA hGH signal will be deleted. therefore cloning with NotI is '''not''' possible .
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''
-|-
-| align="left" | '''Bacteria strain''' ||align="left"| BL-21 ||align="left"| BL-21 ||align="left"| BL-21 ||align="left"| BL-21
-|-
-| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP
-|-
-| align="left" | '''Date''' ||align="left"| 10.06.2010 ||align="left"| 10.06.2010 ||align="left"| 10.06.2010 ||align="left"| 10.06.2010
-|-
-| align="left" | '''given number''' ||align="left"| B32 ||align="left"| B33 ||align="left"| B34 ||align="left"| B35
-|}
-<br />
-<u>Given Plasmid-Number</u>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''
-|-
-| align="left" | '''given number''' ||align="left"| P37 ||align="left"| P38 ||align="left"| P39 ||align="left"| P40
-|}
-<br />
-<p style="font-size:12px; font-weight: bold; color: blue;">2.2 Test digestion</p>
-*buffer used: 4 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme AgeI (no.Lab:___) ____
-*Plasmid
-**Given Plasmid-Number: P37; DNA concentration: 114,8 ng/µL ;
-**Given Plasmid-Number: P38 ; DNA concentration: 179,8 ng/µL;
-**Given Plasmid-Number: P39 ; DNA concentration: 180,8ng/µL ;
-**Given Plasmid-Number: P40; DNA concentration: 189,2 ng/µL;
-<br />
-'''Comments:''' Clones were picked from trafo-plate in the morning and mini-prep was performed in the late afternoon. Due to this and the fact that bacterial strain was BL-21, DNA-concentrations are quite low.
 <br>
 <br>
-Investigators: Bea, Chris W. <br>
+<li>Test digestion of pCMV-mVenusYFP with PstI and MluI <br>
+<b>Digestion</b>
+<br>
+<ul>
+<li>experiment date: 26.05.2010 </li>
+<li>plasmid: pCMV_mVenus_YFP; number: P5; production date: 21.05.2010/ pCMV-MSC; number: P2; production date:  </li>
+<li>buffer used: 3/4; Restriction-enzymes used: Enzyme PstI (no. Lab:48) and Enyzme MluI (no. Lab:40) / NotI HF (no. Lab:159) </li>
+<li>DNA concentration plasmid: P5 477,3 ng/µl / P2 550ng/µl </li>
 {| border="1"
-| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix''' ||align="left"| '''Sample: P37''' ||align="left"| '''Sample: P38''' ||align="left"| '''Sample: P39''' ||align="left"| '''Sample: P40'''
+| components   || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl
 |-
-| align="left" | DNA ||align="left"| 800 ng ||align="left"| - ||align="left"|7,0 µL||align="left"|4,5 µL||align="left"|4,4 µL||align="left"| 4,2 µL
+| DNA  ||  align="right" | 4,2||align="right"|3,6
 |-
-| align="left" | BSA (10x) yes ||align="left"| 1,5 µL ||align="left"| 7,5 µL ||align="left"|MM 4,5 µL||align="left"|MM 4,5 µL||align="left"|MM 4,5 µL||align="left"| MM 4,5 µL
+| BSA (10x) ||  align="right" |2||align="right"|2
 |-
-| align="left" | Buffer no. 4 (10x) ||align="left"| 1.5 µL||align="left"| 7,5 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
+| Buffer 3 (10x)||  align="right" |2||align="right"|2
 |-
-| align="left" | Enzyme 1 (no. Lab:    ) AgeI ||align="left"| 0.75 µL ||align="left"| 3,75 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
+|Enzyme: PstI/NotI HF (no.Lab:48/159)||  align="right" |1||align="right"|2
 |-
-| align="left" | Enzyme 2 (no. Lab:    ) XbaI ||align="left"| 0.5 µL||align="left"| 2,5 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
+|Enzyme: MluI (no.Lab:40)||  align="right" |1||align="right"|-
 |-
-| align="left" | H<sub>2</sup>O ||align="left"| variable ||align="left"| - ||align="left"|3,75 µL||align="left"|0,25 µL||align="left"|6,35 µL||align="left"| 6,55 µL
+|H2O||  align="right" |9,8||align="right"|10,4
 |-
-| align="left" | '''Total volume''' ||align="left"| '''15 µL''' ||align="left"| - ||align="left"|15 µL||align="left"|15 µL||align="left"|15 µL||align="left"| 15 µL
+|'''Total volume'''||  align="right" |<b>20</b>||align="right"|<b>20</b>
 |}
-<br />
-*Incubation: 45 min, 37°C
-<br />
-===27. Labortag 11.06.2010:===
-in additon to<p style="font-size:12px; font-weight: bold; color: blue;">Site directed mutagenisis</p> on 10.06.10
-'''transformation'''<br>
-transformation was performed according to the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]]<br>
-Cells were plated on agar plates (2x 1:100; 2x pellet)containing ampicillin and stored over night at 37°C.
-<p style="font-size:12px; font-weight: bold; color: blue;">Sequenzing</p>
-p39 was send to GATC for sequenzing
-* p39: 180,83 ng*µl^-1
-* volume plasmid: 8,3 µl
-* volume water: 21,7 µl
-* primer: GATC_std_pTeSp-1
-===28. Labortag 12.06.2010:===
-Kira <br>
-The plates were stored in the iGEM shelf @ 4 °C. Even if the transformation was not very successfull, some colonies can be picked and inoculated either tomorrow or on Monday.
-'''Note: Site-directed mutagenesis does not generate lots of intact plasmids, so few colonies are normal!! (Tobias)'''
 <br>
+<li> Incubation: 1 h at 37°C
-===29. Labortag 13.06.2010:===
-Jessy, Patrick, Hanna <br>
-We weren't able to detect any colonies on the plates - just a few air bubbles :) To be entirely sure, we put them back into the 37°C room over night.
 <br>
+% Agarose gel
-===30. Labortag 14.06.2010:===
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-mVenus-YFP:</u></p>
-The sequencing data of pAAV_iGEM_mVenus-YFP was analyzed. The alignment with the "theoretical" pAAV_iGEM_mVenus-YFP showed that we successfully inserted mVenus-YFP into pAAV_iGEM-MCS.
-[[File:Freiburg10 mVenus-Alignment.jpg|800x800px|]]
 <br>
+<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Site-directed mutagenesis:</u></p>
-Also today no colonies were detectable on any plates!
 <br>
+Results: Test digestion of pCMV_MCS with NotI delivered plausibel results (expected fragment size: ~ 27 kbp and 17 kbp).
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>TK-GMK-Plasmid</u></p>
+Unfortunately the digestion of pCMV_mVenus_YFP with PstI and MluI resulted in one 2.9 kbp and one 1.2 kbp fragment, which didn't correspond to the expected fragment sizes of 19 kbp and 33 kbp - but to fragment sizes of pCMV_MCS without mVenus_YFP!
-Adrian, Hanna <br>
-puB6_V5_His6_clone1 + TK/GMK (P15) will be sequenced again: <br>
-* name: AF 1
-* primer: GATC_std_BGH-reverse
-* volume(plasmid) = 4.25 µL
-* volume (H<sub>2</sup>O) = 25.75 µL
-Results (15.06.): Unfortunately just ~ 300 bp were sequenced. <br>
-<p style="font-size:13px; font-weight: bold; color: purple;">To do: Therefore more primers have to be designed in order to sequence the whole ~2000 bp TK-GMK fusion construct! </p>
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Zellkultur</u></p>
-AAV 293 and HT1080 Cells have been splitted and plated out on 10 cm dishes for transfektion.
-The Cells were accounted by using the Neubauer-Meteringchamber.
-After harvesting by following the standard protocol the pallet have been resuspendiated in 15ml of DTT medium.
-,5µl of this cell suspension have been mixed with 47.5µl of trypan blue.
-We counted 12,5x 10^6 cells/ml for the T293 AAV cell line and 10x10^6 cells /ml for the HT1080 cell line.
-The AAV 293 cells have been plated out on four dishes with 250µl of the cell suspension, on one plated with 1ml and on another dish
-with 1.5ml.
-note that that the date is wrong on the plates and the flasks! Cells have been already plated out on the 14th. of June.
-We also seated two flasks one for each cell line. Therefor we used 1ml of the HT1080 cell suspension and two ml of the the AAV293 cells.
 <br>
 <br>
+<li>'''Ordering oligos:'''(Sigma-Aldrich) <br>
+(Bea)<br>
+Oligos have been ordered for modifying the ITRs. Deletion of PstI restriction site in ITR. <br>
-===31. Labortag 15.06.2010:===
+<br>
-Adrian, Achim, Chris W., Hanna
+'''right ITR of pAAV_MCS''' <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Solutions for transfection were prepared:</u></p>
+oligos ordered:<br>
-* 1 x TE-Buffer: 1.2114 g TRIS, 0.2 mL EDTA, 81 mL milipore-H<sub>2</sup>O were mixed. pH was adjusted with HCl (1M and 5M) to 7.50. Volume was adjusted to 100 mL with milipore-H<sub>2</sup>O. Solution was autoclaved (sterilization by filtration is also possible). <br>
-* 1 M CaCl2: 147.02 g CaCl2 x 2H<sub>2</sup>O (M = 147.02 g/mol) was solved in 1 Liter H<sub>2</sup>O and sterilized by filtration.<br>
+fwd:	5´- gcgcagctgcctgcaCGGGCGCCTGATGCGG -3´ 77 °C, 31 bp <br>
-* 2 x HBS: 0.027 g Na2HPO4, 1.636 g NaCl, 1.19155 g HEPES were dissolved in ~ 30 mL milipore-H<sub>2</sup>O. pH was adjusted to 7.10. Volume was adjusted to 100 mL and sterilized by filtration.<br>
+rev:    5´- CCGCATCAGGCGCCCGTGCAGGCAGCTGCGC -3´ <br>
 <br>
-===32. Labortag 16.06.2010:===
+'''leftITR of pAAV_MCS'''<br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sponsoring:</u></p>
+oligos ordered:<br>
-Anna, Kerstin, Anissa<br>
-Sponsoring letters were examined and modified one more time. <br>
+fwd:	5´- CCTTTTGCTCACATGTCGTGCAGGCAGCTGCGCG -3´ 74 °C, 34 bp <br>
-<br>
+rev:	5´- CGCGCAGCTGCCTGCACGACATGTGAGCAAAAGG -3´<br>
+<br>
+For further details see link <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of TK-GMK:</u></p>
+http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/4/44/Freiburg10_Oligos_ITR_mutagenesis_for_pAAV_delete_PstI.pdf
-Hanna<br>
+</li>
-Two primers were designed and ordered from Sigma-Aldrich. Probably we will receive them on Friday.<br>
 <br>
-<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Mega primer PCR:</u></p>
+'''Test-Trafo of chemical competent E.coli cells''' <br>
-Bea, Hanna <br>
+(Hanna)
 <br>
-[[File:Freiburg10 ITRprimer.jpg]]
+The competent E.coli XL-1-blue and competent E.coli BL21 which were prepared the day before were test-transformed with pUC18 - following the standard protocol. Cells were plated on agar plates containing ampicillin and stored over night at 37°C.
+Further on two control plates containing ampicillin or kanamycin were prepared. Non-transformed cells were plated on them and also stored over night at 37°C.
+<br>
+<br>
+</ul>
+</ul>
+===16. Labortag 27.05.2010===
-===33. Labortag 17.06.2010:===
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Cell counting</b></p>====
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Primer designing: VP1 primer for pKEX forward/reverse </u></p>
+<p><b>Investigator: Patrick, Adrian, Chris W. Christian L.</b></p>
-Investigator: Volker<br>
-The construnts that we receieved from PD Dr. Kleinschmidt (DKFZ) are mainly in the pKEX backbone. The sequences of the backbone and the inserts are not availible, for this reason we decided to sequence the constructs. The first step is to sequence from one construct into the backbone. In the second step we will designe primers that bind in the backbone and point into the direction of the insert.
-These primers will then be used to sequence the inserts of all the constructs.<br>
-'''Forward primer pKEX in VP1 from bp 4124 to 414'''
+* Meeting
-*VP1 primer for pKEX forward: 5' - CAACAAGTCTGTTAATGTGGAC - 3' 22bp; 		TM: 50°C; 	CG% 41%
-'''Reverse primer pKEX in VP1 from bp 2081 to 2100'''
+cell counting:
-*VP1 primer for pKEX reverse: 5' - GTGGGCCAGGTTTGAGCTTC - 3' 20bp;		TM: 54°C	CG%: 60%
+<br>
+* BL21 + PUC18 Trafo 54*4 = 216
-The amplicon that should  be produced by the primers is 199 bp long.
+* XL1B + PUC18 Trafo 30*4 = 120
+digitalization of recipe-cards (Christian L.)
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Primer designing: CMV_forward/reverse_qPCR </u></p>
-Investigator: Volker<br>
-Primers for the titering of the CMV region from the literature [Rohr et al., 2002] and [Rohr et al., 2005] were compared and analysed.
-The sequences from 2002 showed a differce in one nucleotide compared to the other primer and to our sequence. For this reason the second set [Rohr et al., 2005] was ordered.<br>
-*CMV_forward_qPCR: 5' - GGGACTTTCCTACTTGGCA - 3'
-*CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'
-[[File:Freiburg10_Binding of the CMV_qPCR primer in the vector plasmid.jpg|900px|left|thumb|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]<br>
-<p style="clear:both;">These primers will be used in a quantitative PCR assay with Sybr-green to measure the genomic titer and the infectious titer of the viral particles we will produce in the future.</p>
-<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Ordering of required reagents: </u></p>
-Investigator: Volker<br>
-*Nuclease S1 was ordered from Promega (10000Units for 36,00€)
-*Proteinase K was ordered from Sigma  (5mg for 31,30€; BioUltra, ≥30 units/mg protein, lyophilized powder)
-These reagents are required for the procedure to determine the genomic and the infectious titer.<br><br>
-===34. Labortag 18.06.2010: Transfection===
-====Transfection====
-Transfection via calcium phosphat with the prepared solutions (31. Labortag 15.06.2010)
 <br>
-'''investigators:''' Chris W., Hanna, Patrick, Adrian, Volker<br>
+===17. Labortag 31.05.2010===
-Transfections with the following plasmids:
-)
+====<p style="font-size:15px; background-color:#66bbFF;"><b>pAAV_RC R585A and R588A transistions</b></p>====
-* pAAV_iGEM_mVenus_YFP (glycerol stock B34, P39) P39 has the correct sequence (confirmed)
-* pHelper
-* pAAV_RC
-)
-* pAAV_iGEM_mVenus_YFP (glycerol stock B33, P38) P38 (we dont know if P39 has the correct sequence!)was used because the amount of P39 ''[[was not sufficient enough]]'' for four Transfections!
-* pHelper
-* pAAV_RC
-Plasmid concentrations: <br>
-pAAV_RC: 1 µg/µl <br>
-pHelper: 280 ng/µl <br>
-pAAV_iGEM_mVenus_YFP, P39: 180,83 ng/µl <br>
-pAAV_iGEM_mVenus_YFP, P38: 179,75 ng/µl <br>
-Cellculture clone 1 and 2 were transfected with P39. Cellculture clone 3 and 4 were transfected with P38. <br>
-Deviations from the standard protocol (currently incomplete):
-We could only pipet 3,3 µg (instead of 10 µg) from each of the 3 plasmids into the 15 ml falcons due to insufficient amount of plasmid.
-Adrian tried to examine the precipation of the CaCl2+ DNA Clusters. We have to optimize the pH of our 2xHBS at the moment it is 11.12
-<br>
-====Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick====
-'''investigator''': Bea <br />
-'''idea:'''
-<ul>
-<li>Digest vector in order to obtain two fragments which contain the left and the right ITR respectively. </li>
-<li>Separation (Agarose-gel) and gel extraction of fragments</li>
-<li>Perform PCR with iGEM-Primers (forward primer contains EcoRI and Xbai; reverse primer contains SpeI and PstI)</li>
-<li>to do:</li>
-* design primers
-* digestion of pAAV_MCS etc.
-</ul>
-'''Theoretical:''' Digestion of pAAV_MCS with AlwNI produces two fragments which can be separated by agaorse gel.
-<br>
-[[File:Freiburg10 pAAV MCS fragments cut with AlwNI preparation for PCR.jpg|900px|thumb|left|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
-<br>
+In order to alter the tropism of AAV2 several modifications have to be performed.
+First of all the binding to Heparan Sulfate Proteoglycan has to be disrupted. This can be done by R585A and R588A transistions:
+[[File:Freiburg10 R585A R588A.jpg|800px|]]
 <html>
 </div>
 </html>