|
|
| (One intermediate revision not shown) |
| Line 1: |
Line 1: |
| - | <html>
| |
| - | <style>
| |
| | | | |
| - | table.calendar { margin: 0; padding: 10px; }
| |
| - | table.calendar td { margin: 0; padding: 2px; vertical-align: top; }
| |
| - | table.month .heading td { padding:2px; background-color:#CCCCCC; color:#000000; text-align:center; font-size:120%; font-weight:bold; }
| |
| - | table.month .dow td { color:#3C1859; text-align:center; font-size:110%; }
| |
| - | table.month td.today { background-color:none; }
| |
| - | table.month td {
| |
| - | border: none;
| |
| - | margin: 0;
| |
| - | padding: 1pt 1.5pt;
| |
| - | font-weight: bold;
| |
| - | font-size: 8pt;
| |
| - | text-align: right;
| |
| - | background-color: #eee;
| |
| - | }
| |
| - | #bodyContent table.month a { background:none; padding:0 }
| |
| - | .day-active { color:#FF0000 }
| |
| - | .day-empty { color:#000000 }
| |
| - | </style>
| |
| | </html> | | </html> |
| | | | |
| - | __NOTOC__
| |
| - | =='''Notebook'''==
| |
| - | {| align="center"
| |
| - | |-valign="top"
| |
| - | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=05}}
| |
| - | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=06}}
| |
| - | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=07}}
| |
| - | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=08}}
| |
| - | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=09}}
| |
| - | |{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=10}}
| |
| - | |}
| |
| - | {|
| |
| - | |-valign="top" border="0"
| |
| - | |width="100%" style="padding: 0 20px 0 0;"|
| |
| - |
| |
| - |
| |
| - |
| |
| - | {|style="text-align:center"; width="100%"
| |
| - | |-
| |
| - | |-valign="top"
| |
| - | |width="50%" |<div id=" .2F1_May_2009">
| |
| - | <div id=" .2F2_May_2009">
| |
| - | <div id=" .2F3_May_2009">
| |
| - | <div id=" .2F4_May_2009">
| |
| - | <div id=" .2F5_May_2009">
| |
| - | <div id=" .2F6_May_2009">
| |
| - | <div id=" .2F7_May_2009">
| |
| - | <div id=" .2F8_May_2009">
| |
| - | <div id=" .2F9_May_2009">
| |
| - | <div id=" .2F10_May_2009">
| |
| - | <div id=" .2F11_May_2009">
| |
| - | <div id=" .2F12_May_2009">
| |
| - | <div id=" .2F13_May_2009">
| |
| - | <div id=" .2F14_May_2009">
| |
| - | ==14 May 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | - Team meeting in which we discussed ideas of how we are going to get the biological lighting system to work
| |
| - |
| |
| - | - Discussed potential sponsors and other fundraising ideas
| |
| - |
| |
| - |
| |
| - | <div id=" .2F15_May_2009">
| |
| - | <div id=" .2F16_May_2009">
| |
| - | <div id=" .2F17_May_2009">
| |
| - | <div id=" .2F18_May_2009">
| |
| - | <div id=" .2F19_May_2009">
| |
| - | <div id=" .2F20_May_2009">
| |
| - | <div id=" .2F21_May_2009">
| |
| - |
| |
| - | ==21 May 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div>
| |
| - | - Team meeting discussed fundraising ideas – a silent auction cocktail was an idea
| |
| - |
| |
| - | - Came up with two systems to light the biological lighting system:
| |
| - |
| |
| - | - Cell free systems
| |
| - |
| |
| - | - Blue tongue orbivirus system
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F22_May_2009">
| |
| - | <div id=" .2F23_May_2009">
| |
| - | <div id=" .2F24_May_2009">
| |
| - | <div id=" .2F25_May_2009">
| |
| - | <div id=" .2F26_May_2009">
| |
| - | <div id=" .2F27_May_2009">
| |
| - | <div id=" .2F28_May_2009">
| |
| - | ==28 May 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div>
| |
| - |
| |
| - | - Team meeting brainstormed ideas for the silent auction, made a list of people to invite and things to auction of.
| |
| - |
| |
| - | - Discussed the advantages and disadvantages of the two systems
| |
| - |
| |
| - |
| |
| - | <div id=" .2F30_May_2009">
| |
| - | <div id=" .2F31_May_2009">
| |
| - | ==29 May 2009==
| |
| - | </div></div>
| |
| - | - Found protocols to put the fluorescent protein into the E.coli system
| |
| - |
| |
| - | - Began working on the Sponsorship template
| |
| - |
| |
| - |
| |
| - | <div id=" .2F1_June_2009">
| |
| - | <div id=" .2F2_June_2009">
| |
| - | <div id=" .2F3_June_2009">
| |
| - | <div id=" .2F4_June_2009">
| |
| - | ==4 June 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | - Team meeting came to a vote to use the cell free systems for our biological lighting system and discussed using E.coli strain from cell free chassis submitted to iGEM parts registry
| |
| - |
| |
| - | - Found GFP parts available through iGEM toolkit
| |
| - |
| |
| - | o BBa_E0030 – Yellow Fluorescent protein (A. Victoria)
| |
| - |
| |
| - | o BBa_E0020 – Cyan Fluorescent protein (A. Victoria)
| |
| - |
| |
| - | o BBa_E0010 – Red Fluorescent protein (D. Striata)
| |
| - |
| |
| - | o BBa_E0040 – Green Fluorescent protein (A. Victoria)
| |
| - |
| |
| - | - Contacted Airline companies in regards to sponsorship
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F5_June_2009">
| |
| - | <div id=" .2F6_June_2009">
| |
| - | <div id=" .2F7_June_2009">
| |
| - | ==5 June 2009==
| |
| - | </div></div>
| |
| - | </div>
| |
| - | - Contacted New England Biolabs in regards to E.coli strains
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F8_June_2009">
| |
| - | <div id=" .2F9_June_2009">
| |
| - | <div id=" .2F10_June_2009">
| |
| - | <div id=" .2F11_June_2009">
| |
| - | <div id=" .2F12_June_2009">
| |
| - | <div id=" .2F13_June_2009">
| |
| - | <div id=" .2F14_June_2009">
| |
| - | <div id=" .2F15_June_2009">
| |
| - | ==11 June 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | - Received an email from New England Biolabs in regards of the E.coli strains- as we decided to use the protein expression strains i.e. PR1031 or ER2508
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F16_June_2009">
| |
| - | <div id=" .2F17_June_2009">
| |
| - | <div id=" .2F18_June_2009">
| |
| - | <div id=" .2F19_June_2009">
| |
| - | <div id=" .2F20_June_2009">
| |
| - | <div id=" .2F21_June_2009">
| |
| - | <div id=" .2F22_June_2009">
| |
| - | <div id=" .2F23_June_2009">
| |
| - | <div id=" .2F24_June_2009">
| |
| - | <div id=" .2F25_June_2009">
| |
| - | ==25 June 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | - Two students along side our supervisor went to Japan for an iGEM workshop
| |
| - |
| |
| - |
| |
| - | <div id=" .2F26_June_2009">
| |
| - | <div id=" .2F27_June_2009">
| |
| - | <div id=" .2F28_June_2009">
| |
| - | <div id=" .2F29_June_2009">
| |
| - | ==29 June 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | - Team meeting – discussed logo, began thinking of t-shirt designs and team names
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F30_June_2009">
| |
| - | ==30 June 2009==
| |
| - | </div>
| |
| - |
| |
| - | - Found protocols regarding E.coli and wheat germ cell free systems
| |
| - | - Continued working and finalizing our sponsorship template
| |
| - |
| |
| - |
| |
| - | <div id=" .2F1_July_2009">
| |
| - | ==1 July 2009==
| |
| - | </div>
| |
| - |
| |
| - |
| |
| - | - A list of reagents and products was made from the protocols was items were found from the www.sigmaldrish.com catalogue
| |
| - |
| |
| - |
| |
| - | <div id=" .2F2_July_2009">
| |
| - | <div id=" .2F3_July_2009">
| |
| - | ==3 July 2009==
| |
| - | </div></div>
| |
| - |
| |
| - | - Had a team meeting Caroline Northwood to discuss our approach to sponsorship and our sponsorship template
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F4_July_2009">
| |
| - | <div id=" .2F5_July_2009">
| |
| - | <div id=" .2F6_July_2009">
| |
| - | <div id=" .2F7_July_2009">
| |
| - | <div id=" .2F8_July_2009">
| |
| - | <div id=" .2F9_July_2009">
| |
| - | <div id=" .210_July_2009">
| |
| - | <div id=" .2F11_July_2009">
| |
| - | <div id=" .2F12_July_2009">
| |
| - | <div id=" .2F13_July_2009">
| |
| - | <div id=" .2F14_July_2009">
| |
| - | <div id=" .2F15_July_2009">
| |
| - | <div id=" .2F16_July_2009">
| |
| - | <div id=" .2F17_July_2009">
| |
| - | <div id=" .2F18_July_2009">
| |
| - | <div id=" .2F19_July_2009">
| |
| - | <div id=" .2F20_July_2009">
| |
| - | <div id=" .2F21_July_2009">
| |
| - | ==6 July 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - |
| |
| - | - Reagent list to be ordered was given to Wade to be ordered
| |
| - |
| |
| - | - Sent out sponsorship template to all potential airline sponsors
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F22_July_2009">
| |
| - | <div id=" .2F23_July_2009">
| |
| - | <div id=" .2F24_July_2009">
| |
| - | <div id=" .2F25_July_2009">
| |
| - | <div id=" .2F26_July_2009">
| |
| - | <div id=" .2F27_July_2009">
| |
| - | <div id=" .228_July_2009">
| |
| - | <div id=" .2F29_July_2009">
| |
| - | <div id=" .2F30_July_2009">
| |
| - | <div id=" .2F31_July_2009">
| |
| - | <div id=" .2F1_August_2009">
| |
| - | <div id=" .2F2_August_2009">
| |
| - | <div id=" .2F3_August_2009">
| |
| - | <div id=" .2F4_August_2009">
| |
| - | ==24 July 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | - Team meeting – voted on team name, logo and mascot
| |
| - |
| |
| - | - Discussed our progress in individual research on the project
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F5_August_2009">
| |
| - | <div id=" .2F6_August_2009">
| |
| - | <div id=" .2F7_August_2009">
| |
| - | <div id=" .2F8_August_2009">
| |
| - | <div id=" .2F9_August_2009">
| |
| - | <div id=" .2F10_August_2009">
| |
| - | <div id=" .2F11_August_2009">
| |
| - | <div id=" .2F12_August_2009">
| |
| - | <div id=" .2F13_August_2009">
| |
| - | <div id=" .2F14_August_2009">
| |
| - | <div id=" .2F15_August_2009">
| |
| - | <div id=" .2F16_August_2009">
| |
| - | ==11 August 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | - Began working on the Funding proposal to the RMIT Vice Chancellor
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F17_August_2009">
| |
| - | <div id=" .2F18_August_2009">
| |
| - | <div id=" .2F19_August_2009">
| |
| - | <div id=" .2F20_August_2009">
| |
| - | ==20 August 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | - Meeting with the Vice Chancellor
| |
| - |
| |
| - | <div id=" .2F21_August_2009">
| |
| - | ==21 August 2009==
| |
| - | </div>
| |
| - |
| |
| - | - Began working in the Lab
| |
| - |
| |
| - | o LB- Media was made and autoclaved which went to make the LB-Agar plates
| |
| - |
| |
| - | o Ampicillin was made
| |
| - |
| |
| - | o SOC media was made and autoclaved
| |
| - |
| |
| - | o Magnesium Chloride solution and Sodium Chloride solution were also made and autoclaved
| |
| - |
| |
| - |
| |
| - | <div id=" .2F22_August_2009">
| |
| - | <div id=" .2F23_August_2009">
| |
| - | <div id=" .2F24_August_2009">
| |
| - | <div id=" .2F25_August_2009">
| |
| - | ==25 August 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | -We did the transformation of the GFP and the BFP; this was completed by Pre-incubating the LB-agar plates while thawing the component cells. Plasmid DNA was added to the tube followed by a heat shock. 800μl of SOC medium is added and incubated for 45 mins. The transformed cells were then spread thoroughly on the LB agar plates and were left to incubate overnight.
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F26_August_2009">
| |
| - | <div id=" .2F27_August_2009">
| |
| - | ==26 August 2009==
| |
| - | </div></div>
| |
| - |
| |
| - | - Went in to the lab to see the colonies that grew on the LB- Agar plate
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F28_August_2009">
| |
| - | <div id=" .2F29_August_2009">
| |
| - | <div id=" .2F30_August_2009">
| |
| - | <div id=" .2F31_August_2009">
| |
| - | ==31 August 2009==
| |
| - | </div></div>
| |
| - | </div></div>
| |
| - |
| |
| - | -We began the protein expression by using previously autoclaved LB media and placing 100ml into two conical flasks we then transferred a single colony from the transformed bacteria of the GFP and BFP into the flasks. We left these to incubate overnight.
| |
| - |
| |
| - |
| |
| - |
| |
| - | <div id=" .2F1_September_2009">
| |
| - | <div id=" .2F2_September_2009">
| |
| - | ==1 September 2009==
| |
| - | </div></div>
| |
| - |
| |
| - | -We continued with the protein expression by dividing the incubated GFP and BFP into two falcon tubes and centrifuging them. The supernatant was emptied and the pellet was resuspended. We then read the absorbance of the solution at 600nm.
| |
| | | | |
| - | o GFP=0.93A
| |
| | | | |
| - | o BFP=0.95A
| |
| | | | |
| - | -Two conical flasks were set up with SOC solution and Ampicillin with GFP and BFP in them. They were incubated for an hour then the absorbance of the solution was obtained:
| + | == '''The Story So Far'''== |
| | | | |
| - | o GFP= 0.7A
| |
| | | | |
| - | o BFP = 0.64 A
| + | {| border="0" cellpadding="10" | align="center" |
| | + | |{{#calendar: title=RMIT_Australia|year=2010 | month=06}} |
| | | | |
| - | - The proteins were then induced and centrifuged then stored at -80ºC (Phil Poronnik) .
| + | |{{#calendar: title=RMIT_Australia|year=2010 | month=07}} |
| | | | |
| | + | |{{#calendar: title=RMIT_Australia|year=2010 | month=08}} |
| | | | |
| - | <div id=" .2F3_September_2009">
| + | |{{#calendar: title=RMIT_Australia|year=2010 | month=09}} |
| - | <div id=" .2F4_September_2009">
| + | |
| - | ==4 September 2009== | + | |
| - | </div></div>
| + | |
| | | | |
| - | - Went into the lab to make reagents
| + | |{{#calendar: title=RMIT_Australia|year=2010 | month=10}} |
| | + | |} |
| | | | |
| - | o Lysis buffer
| |
| | | | |
| - | o Phosphate buffer
| |
| | | | |
| - | o Chaps
| |
| | | | |
| - | o 1M sucrose solution
| |
| | | | |
| - | o 1M imidazole solution
| + | ===16th July=== |
| | | | |
| - | o 6M Guanidine hydrochloride solution
| + | The project outline has been put online. |
| | + | Symon has begun outlining the human practices side of the project. |
| | | | |
| - | o Tris Buffer solution (pH 7.8)
| + | ===2nd July=== |
| | | | |
| | + | Primers for Quikchange mutagenesis were designed to turn the -35 and -10 element into restriction sites. |
| | | | |
| - | |width="50%" |<div id=" .2F3_September_2009">
| + | '''-35''' |
| - | <div id=" .2F6_September_2009">
| + | *F 5' tcattaggcaccccaggccttaagctttatgcttccggctcg 3' |
| - | <div id=" .2F7_September_2009">
| + | *R 5' cgagccggaagcataaagcttaaggcctggggtgcctaatga 3' |
| - | <div id=" .2F8_September_2009">
| + | |
| - | ==7 September 2009==
| + | |
| - | </div></div>
| + | |
| - | </div></div>
| + | |
| | | | |
| - | -We began the purification of the GFP and BFP by taking the pallets from the -80ºC (Phil Poronnik) freezing and resuspending them with Lysis buffer. These cells were then sonicated for 3 cycles and then centrifuged. The supernatant was then transferred to eppendorf tubes and resin was added then tubes placed on suspension mixer. Phosphate buffer was then added to the pellet and centrifuged. The resulting pellet was then resuspended with the elution buffer and centrifuged again and the supernatant formed contained the GFP and BFP. | + | '''-10''' |
| | + | *F 5' gctttatgcttccggctcggatcctgtgtggaattgtgagcgg 3' |
| | + | *R 5' ccgctcacaattccacacaggatccgagccggaagcataaagc 3' |
| | | | |
| | + | ===1st July=== |
| | | | |
| - | <div id=" .2F9_September_2009">
| + | Designing the protein expression vector. The two characteristics that we are looking for are: |
| - | <div id=" .2F10_September_2009">
| + | *Strong promoter |
| - | <div id=" .2F11_September_2009">
| + | *Inducible |
| - | <div id=" .2F12_September_2009">
| + | |
| - | ==10 September 2009==
| + | |
| - | </div></div>
| + | |
| - | </div></div>
| + | |
| | | | |
| - | -Team meeting – discussed what part we were going to add to the iGEM Biobrick and decided to modify an existing fluorescing protein to allow it to fluoresce blue.
| + | In order to achieve these two aims, we will use the biobrick '''BBa_R0010''' which is an (lac) inducible promoter and incorporate a T7 promoter to it. This process involves the removal of the -35 and -10 promoter sites and the incorporation of the T7 promoter sequence. |
| | | | |
| | + | By mutagenesis we aim to turn the promoter elements into restriction sites (which are not found in the plamsid), thus being able to remove the promoter section and then introducing the T7 promoter sequence by ligation. |
| | | | |
| - | <div id=" .2F13_September_2009"> | + | <center> 5' ACCCCAGGC'''TTTACA'''CTTTATGCTTCCGGCTCG'''TATGT'''TGTGTGGAATT 3' </center> |
| - | <div id=" .2F14_September_2009">
| + | |
| - | ==14 September 2009==
| + | |
| - | </div></div>
| + | |
| - | -We did the transformation of the Vic GFP, YFP AZ, blueberry cherry and the BFP; this was completed by Pre-incubating the LB-agar plates while thawing the component cells. Plasmid DNA was added to the tube followed by a heat shock. 800μl of SOC medium is added and incubated for 45 mins. The transformed cells were then spread thoroughly on the LB agar plates and were left to incubate overnight.
| + | |
| | | | |
| | + | In bold are the -35 and -10 promoter sites (respectively). The -35 element can be mutated into the AflII restriction site (''c.ttaag''), while the -10 element will be mutated into the BamH1 restriction site (''g.gatcc''). |
| | | | |
| - | <div id=" .2F15_September_2009">
| + | ===30th June=== |
| - | <div id=" .2F16_September_2009">
| + | |
| - | ==15 September 2009== | + | |
| - | </div></div>
| + | |
| | | | |
| - | -Went into the lab to see which LB agar plates we had colony growth on.
| + | We found the ''T.aquaticus'' DNA polymerase sequence from the NCBI website. From this, we designed primers that contained restriction site "sticky ends" on the 5' and 3'. The restriction sites that are going to be used for introducing Taq into the vector are XbaI (5') and SpeI (3'). |
| | | | |
| | + | '''Forward primer:''' |
| | | | |
| - | <div id=" .2F17_September_2009">
| + | 5' CTA GAA TGA GGG GGA TGC TGC CCC TCT TTG AG 3' |
| - | <div id=" .2F18_September_2009">
| + | |
| - | <div id=" .2F19_September_2009">
| + | |
| - | <div id=" .2F20_September_2009">
| + | |
| - | ==18 September 2009==
| + | |
| - | </div></div>
| + | |
| - | </div></div>
| + | |
| | | | |
| - | - Team meeting- discussed what had been done on the wiki, and what else needed to be added
| + | Length: 32 <br> |
| | + | GC Content: 56.3 % <br> |
| | + | Tm: 65.6 ºC |
| | | | |
| - | - Discussed with team members what was being done in the lab
| |
| | | | |
| - | - Discussed which fluorescing protein would be best to modify to made our BFP for the Biobrick
| + | '''Reverse Primer:''' |
| | | | |
| | + | 5' GAT CAT CAC TCC TTG GCG GAG AGC CAG TCC 3' |
| | | | |
| - | <div id=" .2F21_September_2009"> | + | Length: 30 <br> |
| - | ==21 September 2009==
| + | GC Content: 60.0 % <br> |
| - | </div> | + | Tm: 66.2 ºC |
| | | | |
| - | - Celebrated our team members 21st Birthday
| |
| | | | |
| - | - Began the preparation of the yellow plasmid this was done by placing LB medium in a falcon tube with the E.Coli bacteria allowing it to incubate overnight.
| + | Due to the high GC content of the Taq gene, the Tm of the primer is very high. A two step PCR reaction might be needed. |
| | | | |
| | + | ===29th June=== |
| | | | |
| - | <div id=" .2F22_September_2009">
| + | The team is starting to design the experiment. |
| - | ==22 September 2009==
| + | We need to: |
| - | </div>
| + | * Design primers to introduce Taq into psB1C3 |
| | + | * Create a good protein expression vector. |
| | | | |
| - | -Continued the preparation of the yellow plasmid. By adding 1ml of incubated bacteria to conical flask containing 2YT solution. This was then incubated and centrifuged and the pellet was frozen at -80ºC (Phil Poronnik)
| + | ===22th June=== |
| | | | |
| - | <div id=" .2F23_September_2009">
| + | Work has begun on creating primers to extract the protein we are working on from its wild-type plasmid into a plasmid which conforms to biobrick cloning standards. |
| - | ==23 September 2009==
| + | |
| - | </div>
| + | |
| | | | |
| - | -Continued the preparation of the yellow plasmid this was done by adding LB media to the falcon with ampicillin and a stab of the yellow fluorescent protein which was then incubated overnight.
| + | ===19th June=== |
| | | | |
| | + | Jeremy Nagels, a student at Monash university, Ebony and Symon have begun discussing various project ideas. These include: |
| | | | |
| | + | Oscillators |
| | | | |
| - | <div id=" .2F24_September_2009">
| + | The use of the Hydrogenase 3 complex to generate Hydrogen within E Coli as a form of biofuel. |
| - | <div id=" .2F25_September_2009">
| + | |
| - | <div id=" .2F26_September_2009">
| + | |
| - | <div id=" .2F27_September_2009">
| + | |
| - | ==24 September 2009==
| + | |
| - | </div></div>
| + | |
| - | </div></div>
| + | |
| | | | |
| | + | The possibility of biological prevention of tooth decay with biobricks. |
| | | | |
| - | -Began the purification of the yellow fluorescent plasmid, this was done by centrifuging the incubated plasmid from the night before and followed the Aurum plasmid spin format protocol.
| + | The application of biobricks to a mixed cell community. |
| | | | |
| | + | The development of cell free transcription/ translation within a cellular system, for example the phloem of a plant, (although the development of this level of symbiosis may be the stuff of future projects) |
| | | | |
| - | <div id=" .2F28_September_2009">
| + | The attempt is being made to develop a project that in some ways reflects these interests and possibly taps a common thread underlying them. |
| - | <div id=" .2F29_September_2009">
| + | |
| - | <div id=" .2F30_September_2009">
| + | |
| - | <div id=" .2F1_October_2009">
| + | |
| - | ==1 October 2009==
| + | |
| - | </div></div>
| + | |
| - | </div></div>
| + | |
| - | | + | |
| - | -Team meeting- began researching the active site of the YFP in the iGEM Biobrick and looked into designing of the primers that we are going to use.
| + | |
| - | | + | |
| - | | + | |
| - | <div id=" .2F2_October_2009">
| + | |
| - | <div id=" .2F3_October_2009">
| + | |
| - | <div id=" .2F4_October_2009">
| + | |
| - | <div id=" .2F5_October_2009">
| + | |
| - | ==5 October 2009==
| + | |
| - | </div></div>
| + | |
| - | </div></div>
| + | |
| - | | + | |
| - | - Made the S30 buffer(A and B) however did not add the 2 mercaptoethanol
| + | |
| - | | + | |
| - | - Continued to do research on primer design and sequencing of the YFP
| + | |
| - | | + | |
| - | | + | |
| - | <div id=" .2F6_October_2009">
| + | |
| - | ==6 October 2009==
| + | |
| - | </div>
| + | |
| - | | + | |
| - | | + | |
| - | -Added 2 mercaptoethanol to S30 A buffer.
| + | |
| - | | + | |
| - | -Began the preparing the E. coli Cell free system. This was done by thawing the bacteria cells on ice and resuspending them with the S30 A buffer. These were then centrifuged and the pellet was resuspended with s30A buffer, this was done a total of 3 times. Then the pellet was resuspended with the S30 B buffer and sonicated. The samples were then divided and centrifuged and the supernatant was transferred and centrifuged again. The supernatant is removed and serves as the cell lysate in the E. coli cell free system.
| + | |
| - | | + | |
| - | | + | |
| - | | + | |
| - | <div id=" .2F7_October_2009">
| + | |
| - | ==7 October 2009==
| + | |
| - | </div>
| + | |
| - | | + | |
| - | -Searching for flights and accommodation for the Jamboree, sending Exam deferral letters and finalising Per Diem’s
| + | |
| - | | + | |
| - | -Made TAE buffer and began protein expression by setting up an overnight culture of GFP and YFP
| + | |
| - | | + | |
| - | | + | |
| - | | + | |
| - | | + | |
| - | <div id=" .2F8_October_2009">
| + | |
| - | <div id=" .2F9_October_2009">
| + | |
| - | <div id=" .2F10_October_2009">
| + | |
| - | <div id=" .2F11_October_2009">
| + | |
| - | ==8 October 2009==
| + | |
| - | </div></div>
| + | |
| - | </div></div>
| + | |
| - | | + | |
| - | | + | |
| - | -We continued with the protein expression by dividing the incubated GFP and YFP into two falcon tubes and centrifuging them. The supernatant was emptied and the pellet was resuspended. Spectrophotometeric analysis of the GFP and YFP was done in the nanodrop 2000.
| + | |
| - | | + | |
| - | -We then read the absorbance of the solution at 600nm.
| + | |
| - | | + | |
| - | oGFP=1.4A
| + | |
| - | | + | |
| - | oYFP=0.8A
| + | |
| - | | + | |
| - | -The proteins were then induced centrifuged and then stored at -80ºC (Phil Poronnik)
| + | |
| - | | + | |
| - | | + | |
| - | | + | |
| - | | + | |
| - | <div id=" .2F12_October_2009">
| + | |
| - | <div id=" .2F13_October_2009">
| + | |
| - | <div id=" .2F14_October_2009">
| + | |
| - | <div id=" .2F15_October_2009">
| + | |
| - | ==13 October 2009==
| + | |
| - | </div></div>
| + | |
| - | </div></div>
| + | |
| - | | + | |
| - | | + | |
| - | -Began preparing for the Electrophoresis of YFP. This was done by initially preparing the reagents we needed.
| + | |
| - | | + | |
| - | o6 X DNA loading dye
| + | |
| - | | + | |
| - | oAgarose gel
| + | |
| - | | + | |
| - | -Agarose was then poured into the plate and cooled. The samples for the loading gel weer prepared by adding the YFP sample, 6X DNA loading dye, this was then loaded into the gel and electrophoreses for 30mins
| + | |
| - | | + | |
| - | | + | |
| - | | + | |
| - | <div id=" .2F16_October_2009">
| + | |
| - | <div id=" .2F17_October_2009">
| + | |
| - | <div id=" .2F18_October_2009">
| + | |
| - | ==16 October 2009==
| + | |
| - | </div></div>
| + | |
| - | </div>
| + | |
| - | | + | |
| - | | + | |
| - | -We began the mutagenesis of the YFP; this was done by a polymerase chain reaction. To do this the YFP plasmid and both the primers were diluted. 10X reaction buffer, YFP plasmid, primers, dNTP mix, quick solution, DNA polymerase and Milli Q water were all added to make a total volume of 50µL. the reaction was then completed using 18 cycles.
| + | |
| - | | + | |
| - | | + | |
| - | <div id=" .2F19_October_2009">
| + | |
| - | ==19 October 2009==
| + | |
| - | </div>
| + | |
| - | | + | |
| - | | + | |
| - | -Completed the Dpn I digest, this was done by adding Dpn I restriction enzyme to the amplification reaction and gently resuspending the solution, the reaction was then centrifuged and incubated for 7 hours
| + | |
| - | | + | |
| - | -In the evening we began the transformation of the ultracompetent cells. This was completed by pre-incubating the LB-agar plates while thawing the cells. Beta Mercaptoethanol and Dpn I treated DNA was added to the ultracompetent cells and mixed gently, and incubated for 30 mins. After incubation the cells were heat shocked. 800μl of SOC medium is added and incubated for 45 mins. The transformed cells were then spread thoroughly on the LB agar plates and were left to incubate overnight.
| + | |
| - | | + | |
| - | | + | |
| - | <div id=" .2F20_October_2009">
| + | |
| - | ==20 October 2009==
| + | |
| - | </div>
| + | |
| - | | + | |
| - | -Went in to the lab to see if there was any colony growth on the agar plates.
| + | |
| - | | + | |
| - | |}
| + | |
The project outline has been put online.
Symon has begun outlining the human practices side of the project.
Primers for Quikchange mutagenesis were designed to turn the -35 and -10 element into restriction sites.
Designing the protein expression vector. The two characteristics that we are looking for are:
By mutagenesis we aim to turn the promoter elements into restriction sites (which are not found in the plamsid), thus being able to remove the promoter section and then introducing the T7 promoter sequence by ligation.
In bold are the -35 and -10 promoter sites (respectively). The -35 element can be mutated into the AflII restriction site (c.ttaag), while the -10 element will be mutated into the BamH1 restriction site (g.gatcc).
Work has begun on creating primers to extract the protein we are working on from its wild-type plasmid into a plasmid which conforms to biobrick cloning standards.
Jeremy Nagels, a student at Monash university, Ebony and Symon have begun discussing various project ideas. These include:
The use of the Hydrogenase 3 complex to generate Hydrogen within E Coli as a form of biofuel.
The application of biobricks to a mixed cell community.
The development of cell free transcription/ translation within a cellular system, for example the phloem of a plant, (although the development of this level of symbiosis may be the stuff of future projects)
The attempt is being made to develop a project that in some ways reflects these interests and possibly taps a common thread underlying them.
"
