Team:RMIT Australia/Safety

From 2010.igem.org

(Difference between revisions)

Latest revision as of 01:07, 28 October 2010

The Perceived Dangers Associated with Gene Technology and Creating Artificial Life

With the rapid advances and the high impact of molecular biology in our lives, it is extremely important to be aware of the consequences science has on society and our environment. Scientists do most of their work in enclosed laboratories and following strict guidelines governed by regulatory bodies (in Australia the Office of the Gene Technology Regulator - OGTR). Though regulations dictate the containment of all genetically modified organisms (GMOs), there have been several cases in which GMO's have been unintentionally released.

For these reasons we were interested in collaborating with Penn State who undertook a survey on the perceptions of Synthetic Biology in society and the acceptance of GMO's in our everyday lives. Societal perceptions will continue to change as biotechnology increasing is rolled forward to deliver greater outcomes to mankind and such surveys are important benchmarks to these changes in perceptions and practices.

The RMIT 2010 iGEM team is attempting to create a biological system that will produce therapeutic peptides at a low economic cost. A biological machine will be created that uses an inactivated thermostable polymerase as a carrier protein with an attached desired peptide - in our case a therapeutic peptide. There are several safety concerns when undergoing this project that we have addressed:

Our project involves working with polymerases, which are proteins found in all living organisms and are involved in the process of DNA replication. More specifically Taq polymerase (found in the Archeon Thermus aquaticus), being a revolutionary enzyme in the field of molecular biology due to its thermostability, was the focus of our work. The immediate danger is a bacterium containing a Taq plasmid part escaping into the environment and altering the genetic material of many organisms. RMIT team has reduced these dangers by creating mutations that will not allow this protein to bind to DNA or undertake polymerase activity.

The chosen peptides that are being ligated with the Taq polymerase are Losartan and arginine vasopressin. Losartan is a peptide that reduces blood pressure as an antagonist of the angiotensin system. This peptide is safe if not ingested intentionally for harmful purposes as recognised by drug and therapeutic agencies world wide.

The second peptide is arginine vasopressin (AVP), commonly known as antidiuretic hormone. It is associated with water, glucose and salt regulation in the human body and, unlike Losartan, it increases blood pressure.

The bacteria used are Escherichia coli XL-1-Blue and NEB Turbo (High Efficiency), which are commercially available E.coli strain derived from E.coli K12 and used for routine and widespread molecular biology studies. Derivatives of K12 are avirulent and may be considered to be ACDP biological agents hazard group 1 because they have an established record of safety in the laboratory with no adverse effects on human, animal or plant health or the environment. Furthermore E.coli XL-1-Blue is incapable of survival outside the laboratory.

Safety Issues

1. Would any of your project ideas raise safety issues in terms of:

researcher safety,
public safety, or
environmental safety?

No facet of our project would cause significant safety issues. All work is to be contained in PC2 labs. Processes carried out will be done so only after training is received and will be supervised by a skilled instructor to ensure the proper protocols are followed. Our labs will also diminish risks by avoiding the use of carcinogenic products like ethidium bromide, and instead use a more safe nucleic acid stain. This stain – GelStar - does not require UV light to be visualized but blue light, making it safer. The environment will be protected from contamination by waste products because any dangerous material will be disposed of in the correct container (e.g. biohazard containers for biological waste such as E. coli colonies), autoclaved and disposed of responsibly by the university. Team members will also be taught proper molecular biology skills and aseptic techniques. Public safety is ensured as no member of the public is permitted access within the PC2 labs unless approved by the university. Team members will follow proper PCR facility procedures like washing their hands with disinfectant before leaving the laboratory to avoid transmitting potentially harmful material to the public/environment.

2. Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes, o Did you document these issues in the Registry? o How did you manage to handle the safety issue? o How could other teams learn from your experience?

None of our newly engineered BioBrick parts raise safety issues. On the contrary, our system may actually help in reducing risk overall because if the platform works it will reduce the usage of chemicals associated with protein purification.

As previously stated as a safety measure the Taq polymerase part has been mutated in such a way that it will no longer bind to DNA. Through these mutations we eliminate its function and will just be a harmless globular protein in the cell. According to the MSDS, Taq polymerase does not produce any toxic compounds but may do so in the presence of strong oxidising agents/bases, degrade to form CO and CO2. In such an event, this side effect can be combated simply by ventilating the area.

If a biopart, for example the modified Taq polymerase, mutated back to bind to E. coli DNA it might kill the cell. This however is unlikely.

3. Is there a local biosafety group, committee, or review board at your institution?

Yes. Our supervisor, Dr. Leonard Pattenden is on the biosafety committee. There was an internal requirement to complete a project risk assessment to cover all areas of the project. Our project has been deemed low risk. Additionally, our project required registration and was granted an “exempt dealing” by the Biosafety Commitee due to it's low risk, acting under Australian regulations from the Office of the Gene Technology Regulator (OGTR).

4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?

Ideally, risk assessments should be conducted for each individual depending on their experience and expertise in handling the chemicals/organisms and carrying out the protocols. In addition, each student should write a risk assessment of the protocols employed to complete the project. This way all students will know and understand the risks of each experiment being done.

Knowledge is power: the more information known about a newly created part/device/system, the easier it is to identify and combat the associated risks. Greater recording of details and greater characterisation of parts in the registry would improve safety.

5. Could there be an unplanned event or series of events involving your project, resulting in either death, injury, occupational illness, death, damage to equipment or property, or damage to the environment?

Any time a person steps into a laboratory there is a risk of a serious emergency occurring. The likelihood of such an occurrence has been reduced due to the risk management techniques employed in the laboratory plus the oversight and training of students to comply with OHS best practice standards. Students are personally supervised at all times during iGEM work by an immediate project supervisor to reduce such events. It’s important to note however that risk assessments focus on the danger of the task as opposed to the skill level of the person carrying out the task (e.g. a postgraduate is less likely to injure themselves than an undergraduate). This means risk assessments on students need to be suitably adjusted. for our project a Project Risk assessment was completed for all students undertaking the work and students were educated in this practice and made to read MSDS and risk assessment documents before undertaking the work.

6. Does your project require the exposure or release of the engineered organism to people or the environment (e.g. as medicine, for bioremediation)?

This project involves the creation of new technology to produce peptides with high purity with a significantly lower cost. If the experiment is successful, the next step in this experiment would be testing the effect of these peptides in assays and perhaps in animal models. The bacterium itself would not be released or gene circuits, but the product created by it may and so would undergo standard FDA/other testing.

@@ Line 407: / Line 407: @@
-== '''The Story So Far'''==
+==The Perceived Dangers Associated with Gene Technology and Creating Artificial Life==
-===16th July===
-The project outline has been put online.
+With the rapid advances and the high impact of molecular biology in our lives, it is extremely important to be aware of the consequences science has on society and our environment. Scientists do most of their work in enclosed laboratories and following strict guidelines governed by regulatory bodies (in Australia the Office of the Gene Technology Regulator - OGTR). Though regulations dictate the containment of all genetically modified organisms (GMOs), there have been several cases in which GMO's have been unintentionally released.
-Symon has begun outlining the human practices side of the project.
+<p></p>
+For these reasons we were interested in collaborating with Penn State who undertook a survey on the perceptions of Synthetic Biology in society and the acceptance of GMO's in our everyday lives. Societal perceptions will continue to change as biotechnology increasing is rolled forward to deliver greater outcomes to mankind and such surveys are important benchmarks to these changes in perceptions and practices.
+<p></p>
+<p></p>
+The RMIT 2010 iGEM team is attempting to create a biological system that will produce therapeutic peptides at a low economic cost. A biological machine will be created that uses an inactivated thermostable polymerase as a carrier protein with an attached desired peptide - in our case a therapeutic peptide. There are several safety concerns when undergoing this project that we have addressed:
+<p></p>
+<p></p>
+Our project involves working with polymerases, which are proteins found in all living organisms and are involved in the process of DNA replication. More specifically Taq polymerase (found in the Archeon Thermus aquaticus), being a revolutionary enzyme in the field of molecular biology due to its thermostability, was the focus of our work. The immediate danger is a bacterium containing a Taq plasmid part escaping into the environment and altering the genetic material of many organisms. RMIT team has reduced these dangers by creating mutations that will not allow this protein to bind to DNA or undertake polymerase activity.
+<p></p>
+<p></p>
-===2nd July===
+The chosen peptides that are being ligated with the Taq polymerase are Losartan and arginine vasopressin. Losartan is a peptide that reduces blood pressure as an antagonist of the angiotensin system. This peptide is safe if not ingested intentionally for harmful purposes as recognised by drug and therapeutic agencies world wide.
+<p></p>
+<p></p>
-Primers for Quikchange mutagenesis were designed to turn the -35 and -10 element into restriction sites.
+The second peptide is arginine vasopressin (AVP), commonly known as antidiuretic hormone. It is associated with water, glucose and salt regulation in the human body and, unlike Losartan, it increases blood pressure.
+<p></p>
+<p></p>
-'''-35'''
+<p></p>
-*F 5' tcattaggcaccccaggccttaagctttatgcttccggctcg 3'
+<p></p>
-*R 5' cgagccggaagcataaagcttaaggcctggggtgcctaatga 3'
+The bacteria used are Escherichia coli XL-1-Blue and NEB Turbo (High Efficiency), which are commercially available E.coli strain derived from E.coli K12 and used for routine and widespread molecular biology studies. Derivatives of K12 are avirulent and may be considered to be ACDP biological agents hazard group 1 because they have an established record of safety in the laboratory with no adverse effects on human, animal or plant health or the environment. Furthermore E.coli XL-1-Blue is incapable of survival outside the laboratory.
-'''-10'''
+==Safety Issues==
-*F 5' gctttatgcttccggctcggatcctgtgtggaattgtgagcgg 3'
+<p></p>
-*R 5' ccgctcacaattccacacaggatccgagccggaagcataaagc 3'
+<p></p>
+'''1. Would any of your project ideas raise safety issues in terms of: '''
+*	'''researcher safety, '''
+*	'''public safety, or '''
+*	'''environmental safety? '''
+<p></p>
+<p></p>
-===1st July===
+No facet of our project would cause significant safety issues. All work is to be contained in PC2 labs. Processes carried out will be done so only after training is received and will be supervised by a skilled instructor to ensure the proper protocols are followed. Our labs will also diminish risks by avoiding the use of carcinogenic products like ethidium bromide, and instead use a more safe nucleic acid stain. This stain – GelStar - does not require UV light to be visualized but blue light, making it safer.
+The environment will be protected from contamination by waste products because any dangerous material will be disposed of in the correct container (e.g. biohazard containers for biological waste such as E. coli colonies), autoclaved and disposed of responsibly by the university. Team members will also be taught proper molecular biology skills and aseptic techniques.
+Public safety is ensured as no member of the public is permitted access within the PC2 labs unless approved by the university. Team members will follow proper PCR facility procedures like washing their hands with disinfectant before leaving the laboratory to avoid transmitting potentially harmful material to the public/environment.
+<p></p>
+<p></p>
-Designing the protein expression vector. The two characteristics that we are looking for are:
+'''2.	Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,
-*Strong promoter
+o	Did you document these issues in the Registry?
-*Inducible
+o	How did you manage to handle the safety issue?
+o	How could other teams learn from your experience? '''
+<p></p>
+<p></p>
-In order to achieve these two aims, we will use the biobrick '''BBa_R0010''' which is an (lac) inducible promoter and incorporate a T7 promoter to it. This process involves the removal of the -35 and -10 promoter sites and the incorporation of the T7 promoter sequence.
+None of our newly engineered BioBrick parts raise safety issues. On the contrary, our system may actually help in reducing risk overall because if the platform works it will reduce the usage of chemicals associated with protein purification.
+<p></p>
+<p></p>
-By mutagenesis we aim to turn the promoter elements into restriction sites (which are not found in the plamsid), thus being able to remove the promoter section and then introducing the T7 promoter sequence by ligation.
+As previously stated as a safety measure the Taq polymerase part has been mutated in such a way that it will no longer bind to DNA. Through these mutations we eliminate its function and will just be a harmless globular protein in the cell. According to the MSDS, Taq polymerase does not produce any toxic compounds but may do so in the presence of strong oxidising agents/bases, degrade to form CO and CO2. In such an event, this side effect can be combated simply by ventilating the area.
+<p></p>
+<p></p>
-<center> 5' ACCCCAGGC'''TTTACA'''CTTTATGCTTCCGGCTCG'''TATGT'''TGTGTGGAATT 3' </center>
+If a biopart, for example the modified Taq polymerase, mutated back to bind to E. coli DNA it might kill the cell. This however is unlikely.
+<p></p>
+<p></p>
-In bold are the -35 and -10 promoter sites (respectively). The -35 element can be mutated into the AflII restriction site (''c.ttaag''), while the -10 element will be mutated into the BamH1 restriction site (''g.gatcc'').
+'''3.	Is there a local biosafety group, committee, or review board at your institution? '''
+<p></p>
+<p></p>
-===30th June===
+Yes. Our supervisor, Dr. Leonard Pattenden is on the biosafety committee. There was an internal requirement to complete a project risk assessment to cover all areas of the project. Our project has been deemed low risk. Additionally, our project required registration and was granted an “exempt dealing” by the Biosafety Commitee due to it's low risk, acting under Australian regulations from the Office of the Gene Technology Regulator (OGTR).
+<p></p>
+<p></p>
-We found the ''T.aquaticus'' DNA polymerase sequence from the NCBI website. From this, we designed primers that contained restriction site "sticky ends" on the 5' and 3'. The restriction sites that are going to be used for introducing Taq into the vector are XbaI (5') and SpeI (3').
+'''4.	Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering? '''
+<p></p>
+<p></p>
-'''Forward primer:'''
+Ideally, risk assessments should be conducted for each individual depending on their experience and expertise in handling the chemicals/organisms and carrying out the protocols. In addition, each student should write a risk assessment of the protocols employed to complete the project. This way all students will know and understand the risks of each experiment being done.
+<p></p>
+<p></p>
-' CTA GAA TGA GGG GGA TGC TGC CCC TCT TTG AG 3'
+Knowledge is power: the more information known about a newly created part/device/system, the easier it is to identify and combat the associated risks. Greater recording of details and greater characterisation of parts in the registry would improve safety.
+<p></p>
+<p></p>
+'''5.	Could there be an unplanned event or series of events involving your project, resulting in either death, injury, occupational illness, death, damage to equipment or property, or damage to the environment?'''
+<p></p>
+<p></p>
+Any time a person steps into a laboratory there is a risk of a serious emergency occurring. The likelihood of such an occurrence has been reduced due to the risk management techniques employed in the laboratory plus the oversight and training of students to comply with OHS best practice standards. Students are personally supervised at all times during iGEM work by an immediate project supervisor to reduce such events. It’s important to note however that risk assessments focus on the danger of the task as opposed to the skill level of the person carrying out the task (e.g. a postgraduate is less likely to injure themselves than an undergraduate). This means risk assessments on students need to be suitably adjusted. for our project a Project Risk assessment was completed for all students undertaking the work and students were educated in this practice and made to read MSDS and risk assessment documents before undertaking the work.
+<p></p>
+<p></p>
+'''6.	Does your project require the exposure or release of the engineered organism to people or the environment (e.g. as medicine, for bioremediation)? '''
+<p></p>
+<p></p>
-Length:	    32 <br>
+This project involves the creation of new technology to produce peptides with high purity with a significantly lower cost. If the experiment is successful, the next step in this experiment would be testing the effect of these peptides in assays and perhaps in animal models. The bacterium itself would not be released or gene circuits, but the product created by it may and so would undergo standard FDA/other testing.
-GC Content: 56.3 % <br>
-Tm:  65.6 ºC
-'''Reverse Primer:'''
-' GAT CAT CAC TCC TTG GCG GAG AGC CAG TCC 3'
-Length:      30 <br>
-GC Content:  60.0 % <br>
-Tm:   66.2 ºC
-Due to the high GC content of the Taq gene, the Tm of the primer is very high. A two step PCR reaction might be needed.
-===29th June===
-The team is starting to design the experiment.
-We need to:
-* Design primers to introduce Taq into psB1C3
-* Create a good protein expression vector.
-===22th June===
-Work has begun on creating primers to extract the protein we are working on from its wild-type plasmid into a plasmid which conforms to biobrick cloning standards.
-===19th June===
-Jeremy Nagels, a student at Monash university, Ebony and Symon have begun discussing various project ideas. These include:
-Oscillators
-The use of the Hydrogenase 3 complex to generate Hydrogen within E Coli as a form of biofuel.
-The possibility of biological prevention of tooth decay with biobricks.
-The application of biobricks to a mixed cell community.
-The development of cell free transcription/ translation within a cellular system, for example the phloem of a plant, (although the development of this level of symbiosis may be the stuff of future projects)
-The attempt is being made to develop a project that in some ways reflects these interests and possibly taps a common thread underlying them.