Team:RMIT Australia/Notebook

From 2010.igem.org

(Difference between revisions)
 
(55 intermediate revisions not shown)
Line 405: Line 405:
</body>
</body>
</html>
</html>
 +
<html>
 +
<style>
 +
table.calendar          { margin: 0; padding: 10px; }
 +
table.calendar td      { margin: 0; padding: 2px; vertical-align: top; }
 +
table.month .heading td { padding:2px; background-color:#CCCCCC; color:#000000; text-align:center; font-size:120%; font-weight:bold; }
 +
table.month .dow td    { color:#3C1859; text-align:center; font-size:110%; }
 +
table.month td.today    { background-color:none; }
 +
table.month td {
 +
    border: none;
 +
    margin: 0;
 +
    padding: 1pt 1.5pt;
 +
    font-weight: bold;
 +
    font-size: 8pt;
 +
    text-align: right;
 +
    background-color: #eee;
 +
    }
 +
#bodyContent table.month a { background:none; padding:0 }
 +
.day-active { color:#FF0000 }
 +
.day-empty  { color:#000000 }
 +
</style>
 +
</html>
 +
__NOTOC__
 +
=='''Notebook'''==
 +
{| align="center"
 +
|-valign="top"
 +
|{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=06}}
 +
|{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=07}}
 +
|{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=08}}
 +
|{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=09}}
 +
|{{#calendar: title=Team:RMIT_Australia/Notebook# |year=2010 | month=10}}
 +
|}
 +
{|
 +
|-valign="top" border="0"
 +
|width="100%" style="padding: 0 20px 0 0;"|
-
== '''The Story So Far'''==
 
-
===16th July===
 
-
The project outline has been put online.  
+
{|style="text-align:center"; width="100%"; "font-size:large"
-
Symon has begun outlining the human practices side of the project.
+
|-
 +
|-valign="top"
 +
|width="50%" |
 +
<div id=" .2F1_May_2010"></div>
 +
<div id=" .2F2_May_2010"></div>
 +
<div id=" .2F3_May_2010"></div>
 +
<div id=" .2F4_May_2010"></div>
 +
<div id=" .2F5_May_2010"></div>
 +
<div id=" .2F6_May_2010"></div>
 +
<div id=" .2F7_May_2010"></div>
 +
<div id=" .2F8_May_2010"></div>
 +
<div id=" .2F9_May_2010"></div>
 +
<div id=" .2F10_May_2010"></div>
 +
<div id=" .2F11_May_2010"></div>
 +
<div id=" .2F12_May_2010"></div>
 +
<div id=" .2F13_May_2010"></div>
 +
<div id=" .2F14_May_2010"></div>
 +
<div id=" .2F15_May_2010"></div>
 +
<div id=" .2F16_May_2010"></div>
 +
<div id=" .2F17_May_2010"></div>
 +
<div id=" .2F18_May_2010"></div>
 +
<div id=" .2F19_May_2010"></div>
 +
<div id=" .2F20_May_2010"></div>
 +
<div id=" .2F21_May_2010"></div>
-
===2nd July===
+
<div id=" .2F28_June_2010">
 +
===28 June===
-
Primers for Quikchange mutagenesis were designed to turn the -35 and -10 element into restriction sites.
+
Did OH&S training and PC2 training
-
'''-35'''
+
</div>
-
*F 5' tcattaggcaccccaggccttaagctttatgcttccggctcg 3'
+
-
*R 5' cgagccggaagcataaagcttaaggcctggggtgcctaatga 3'
+
-
'''-10'''
+
<div id=" .2F29_June_2010">
-
*F 5' gctttatgcttccggctcggatcctgtgtggaattgtgagcgg 3'
+
===29 June===
-
*R 5' ccgctcacaattccacacaggatccgagccggaagcataaagc 3'
+
-
===1st July===
+
Began research on what we were going to use to promote taq
 +
</div>
-
Designing the protein expression vector. The two characteristics that we are looking for are:
+
<div id=" .2F30_June_2010">
-
*Strong promoter
+
===30 June===
-
*Inducible
+
-
In order to achieve these two aims, we will use the biobrick '''BBa_R0010''' which is an (lac) inducible promoter and incorporate a T7 promoter to it. This process involves the removal of the -35 and -10 promoter sites and the incorporation of the T7 promoter sequence.
+
Looked at T7 with a Lac operon as a promotore of taq
 +
</div>
-
By mutagenesis we aim to turn the promoter elements into restriction sites (which are not found in the plamsid), thus being able to remove the promoter section and then introducing the T7 promoter sequence by ligation.
+
<div id=" .2F13_July_2010">
 +
===13 July===
-
<center> 5' ACCCCAGGC'''TTTACA'''CTTTATGCTTCCGGCTCG'''TATGT'''TGTGTGGAATT 3' </center>
+
Designed Primers for Taq into backbone
-
In bold are the -35 and -10 promoter sites (respectively). The -35 element can be mutated into the AflII restriction site (''c.ttaag''), while the -10 element will be mutated into the BamH1 restriction site (''g.gatcc'').
+
Researched about using an Asp/Pro between the peptide and the Taq
-
===30th June===
+
Began looking at ligation independent cloning for insertion of peptide
-
We found the ''T.aquaticus'' DNA polymerase sequence from the NCBI website. From this, we designed primers that contained restriction site "sticky ends" on the 5' and 3'. The restriction sites that are going to be used for introducing Taq into the vector are XbaI (5') and SpeI (3').
+
</div>
-
'''Forward primer:'''
+
<div id=" .2F14_July_2010">
 +
===14 July===
-
5' CTA GAA TGA GGG GGA TGC TGC CCC TCT TTG AG 3'
+
Looked at prices of Hotels in Boston
-
Length:     32 <br>
+
</div>
-
GC Content: 56.3 % <br>
+
<div id=" .2F19_July_2010">
-
Tm:  65.6 ºC
+
===19 July===
 +
began looking at the structure of taq, its thermostability
 +
began looking at different mutations that can be done to taq to increase its thermostability without changing its structure
-
'''Reverse Primer:'''
+
</div>
 +
<div id=" .2F21_July_2010">
 +
===21 July===
 +
sent in sequence of wild type taq to iTasser
-
5' GAT CAT CAC TCC TTG GCG GAG AGC CAG TCC 3'
+
</div>
-
Length:      30 <br>
+
<div id=" .2F23_July_2010">
-
GC Content:  60.0 % <br>
+
===23 July===
-
Tm:  66.2 ºC
+
 +
Checked thermostability of the mutations that will be done to Taq using Expasy
-
Due to the high GC content of the Taq gene, the Tm of the primer is very high. A two step PCR reaction might be needed.
+
Sent in sequence of taq with mutations at 485, 515 and 540 to iTasser
 +
 +
<div id=" .2F3_August_2010">
 +
===3 August===
-
===29th June===
+
Had iGEM team meeting
-
The team is starting to design the experiment.
+
-Discussed ANZAAS Proposal
-
We need to:
+
-
* Design primers to introduce Taq into psB1C3
+
-
* Create a good protein expression vector.
+
-
===22th June===
+
-Spoke about possibilities of using Geneart
-
Work has begun on creating primers to extract the protein we are working on from its wild-type plasmid into a plasmid which conforms to biobrick cloning standards.
+
-Discussed possible T-shirt designs
-
===19th June===
+
</div>
 +
<div id=" .2F5_August_2010">
 +
===5 August===
-
Jeremy Nagels, a student at Monash university, Ebony and Symon have begun discussing various project ideas. These include:
+
Meet up with Damian, discussed different strategies to use in modelling, began using YASARA to do our Modelling
-
Oscillators
+
</div>
-
The use of the Hydrogenase 3 complex to generate Hydrogen within E Coli as a form of biofuel.
+
<div id=" .2F10_August_2010">
 +
===10 August===
-
The possibility of biological prevention of tooth decay with biobricks.
+
Had iGEM team meeting
-
The application of biobricks to a mixed cell community.
+
-Took Team Photo
-
The development of cell free transcription/ translation within a cellular system, for example the phloem of a plant, (although the development of this level of symbiosis may be the stuff of future projects)
+
</div>
 +
<div id=" .2F11_August_2010">
 +
===11 August===
-
The attempt is being made to develop a project that in some ways reflects these interests and possibly taps a common thread underlying them.
+
PCR of Taq
 +
 
 +
Taq with a DNA concentration of 40ng/µL was diluted to 1µM by addition of 24µL of MilliQ water to 1µL of the Taq plasmid. Primers were diluted to 100µM by adding 354µL to the forward primer with a concentration of 35.4 nmol and 405µL to the reverser primer with a concentration of 40.5nmol. The primers were further diluted to 0.2µM by adding 10µL of the primer to 490µL of milliQ water. The PCR reaction was then made by adding 25µL of Master Mix, 2.5µL of each primer, 5µL of Rnase free water and 15µL of 0.2µM Taq Plasmid.
 +
 
 +
The PCR
 +
 
 +
98º 60 Sec 1 cycle
 +
 
 +
98º 15 Sec then 72º 90 Sec 25 cycle
 +
 
 +
72º 5 min 1 cycle
 +
</div>
 +
 
 +
<div id=" .2F16_August_2010">
 +
 
 +
===16 August===
 +
 
 +
Collaborated with the Sheffield team by participating in an over the phone survery about Human Practices
 +
 
 +
</div>
 +
<div id=" .2F17_August_2010">
 +
===17 August===
 +
 
 +
 
 +
had team meeting
 +
 
 +
- discussed how we can get more sponsors
 +
 
 +
- talked about placing our order to gene art
 +
 +
- began filling out the form to send Pennstates survey to the ethics committee
 +
 
 +
- discussed results for modelling
 +
 
 +
- decided to fix optimise our previous PCR
 +
</div>
 +
 
 +
<div id=" .2F18_August_2010">
 +
===18 August===
 +
 
 +
called few companies seeking sponsorship
 +
enquired for booking flights and accomadation
 +
 
 +
</div id=" .2F19_August_2010">
 +
===19 August===
 +
 
 +
Working on comparing TAQ wild structure to the TAQ Mutated structure to see that there are no major differences, which will mean that TAQ is inactive but will retain it's thermostability at high temperatures.
 +
 
 +
Wrote an email to ABC TV, wanting to know if they will do piece on our project for there The New Inventors Program.
 +
 
 +
Waiting for results from I-Tasser on the mutated TAQ sequence.
 +
Went into the lab and made SOC media and LB- agar plates
 +
|}
 +
 
 +
<div id=" .2F20_August_2010">
 +
===20 August===
 +
 
 +
Did two PCR reaction and a transformation
 +
The first PCR we ran was a touch down PCR. Temperatures ranged from 69 to 64.
 +
The second PCR was a two step PCR.
 +
 
 +
<div id=" .2F30_August_2010">
 +
===30 August===
 +
 
 +
Ordered the TAQ polymerase from Mr. Gene. Should have it in 15 days.
 +
Meeting today at 10am to discuss project budget and costings.
 +
After the meeting we all are sitting together for a writing session.
 +
 
 +
<div id=" .2F31_August_2010">
 +
===31 August===
 +
 
 +
Spent the morning organising our flights
 +
In the afternoon we all sat together for a writing session
 +
 
 +
<div id=" .2F1_September_2010">
 +
===1 September===
 +
 
 +
We all sat together for another writing session.
 +
 
 +
<div id=" .2F7_September_2010">
 +
===7 September===
 +
 
 +
Had a team meeting
 +
 
 +
<div id=" .2F14_September_2010">
 +
===14 September===
 +
 
 +
Had a team meeting and made a lab time table, we also set out tasks which need to be done by the next meeting
 +
*Update the wiki
 +
 
 +
* Finalise the form for the ethics committee for pennstate
 +
 
 +
* Call up possible sponsors
 +
 
 +
* Collect Tshirts
 +
 
 +
* Work on abstract and team Roster
 +
 
 +
* research heat liable bonds
 +
 
 +
* order peptides
 +
 
 +
* chat with emilio about possible bio assays
 +
 
 +
* work on making the promotor part
 +
 
 +
<div id=" .2F15_September_2010">
 +
===15 September===
 +
 
 +
'''Mutagenesis Quikchange XL kit'''
 +
 
 +
[https://2010.igem.org/Team:RMIT_Australia/Notebook/Mutagenesis Click Here for Mutagenesis Protocol]
 +
 
 +
*Template Concentration = 8ng/µl
 +
 
 +
*Fwd 77ng/µl (low 260/280)
 +
*Rev 86.5 ng/µl (low 260/280)
 +
We optimised for low 260/280
 +
 
 +
'''Reaction Mixture'''
 +
*5 µl buffer
 +
*1.9 µl template
 +
*1.7 µl Fwd
 +
*1.62 µl Rev
 +
*1 µl dNTP
 +
*38.78 µl H2O --> reaction volume 50 µl
 +
*1 µl Pfu
 +
 
 +
First mutagenesis was to turn the -35 site in the promoter region into an Afi II restriction site.
 +
Dpn1 digest (2 µl) for 2hrs
 +
 
 +
<div id=" .2F16_September_2010">
 +
===16 September===
 +
 
 +
[https://2010.igem.org/Team:RMIT_Australia/Notebook/Mutagenesis Click Here for Mutagenesis Protocol]
 +
 
 +
2 µl of the mutagenesis product into 100 µl of competent cells
 +
Plate 50 µl, 100 µl and 150 µl samples.
 +
 
 +
<div id=" .2F17_September_2010">
 +
 
 +
===17 September===
 +
 
 +
- finalized project abstract
 +
 
 +
<div id=" .2F19_September_2010">
 +
===19 September===
 +
 
 +
 
 +
- Sent off project abstract to HQ
 +
</div>
 +
 
 +
<div id=" .2F20_September_2010">
 +
===20 September===
 +
 
 +
Two colonies were picked from the plates and were grown in 5mL of Media
 +
 
 +
</div>
 +
 
 +
<div id=" .2F21_September_2010">
 +
===21 September===
 +
 
 +
A miniprep was performed on 1.5ul of the overnight culture.
 +
10ng/ul DNA were obtained from both samples with a O.D higher than 1.85. These samples were then used to perform a restriction digest using EcoR1 H.F and AflII. The restriction digest was done according to the iGEM protocols [http://ginkgobioworks.com/support/BioBrick_Assembly_Manual.pdf CLICK HERE].
 +
 
 +
'''Results'''
 +
The restriction digest did not work. We expected a band at 160bp and one at ~3000bp
 +
</div>
 +
 
 +
<div id=" .2F22_September_2010">
 +
===22 September===
 +
 
 +
>>>> TABLE <<<<
 +
 
 +
 
 +
'''Results'''
 +
The restriction worked. Gel Image below
 +
</div>
 +
 
 +
<div id=" .2F23_September_2010">
 +
===23 September===
 +
Second mutagenesis. This involves changing the -10 promoter region into a ClaI restriction site. AflII (11) miniprep sample was used as template
 +
 
 +
[https://2010.igem.org/Team:RMIT_Australia/Notebook/Mutagenesis Click Here for Mutagenesis Protocol]
 +
 
 +
After the Dpn1 digest, 2ul of product was transformed into E.coli Xl1 blue cells.
 +
</div>
 +
<div id=" .2F24_September_2010">
 +
===24 September===
 +
Colonies grew on the plate. This was stores in the fridge (4 degrees) until Monday for colonies to be picked.
 +
</div>
 +
 
 +
<div id=" .2F27_September_2010">
 +
===27 September===
 +
Two colonies were picked from the plate and grown overnight at 37 degrees in the shaking incubator.
 +
</div>
 +
 
 +
<div id=" .2F28_September_2010">
 +
===28 September===
 +
Preparation of plasmid DNA using Invitrogen Miniprep Kit. Obtained ---ng/ul (260/280 = ---)
 +
 
 +
Restriction digest using EcoRI and ClaI, then gel electrophoresis. Strange gel picture. Two bands of similar size ~ 1.3 kb and 1.6 kb appear on the gel.
 +
</div>
 +
 
 +
<div id=" .2F29_September_2010">
 +
===29 September===
 +
Two more colonies (different) were picked and grown overnight at 37 degrees.
 +
 
 +
Transformation of RFP in Ampicillin, Kanamycin and Chloroamphenicol backbones. They will act as spare backbones.
 +
</div>
 +
 
 +
<div id=" .2F30_September_2010">
 +
 
 +
===30 September===
 +
A second preparation of plasmid DNA using Invitrogen Miniprep Kit. Obtained ---ng/ul (260/280 = ---)
 +
 
 +
Restriction digest using EcoRI and ClaI, then gel electrophoresis. Strange gel picture again. Two bands of similar size ~ 1.3 kb and 1.6 kb appear on the gel. There is a problem with the backbone or the miniprep. Must investigate.
 +
</div>
 +
 
 +
<div id=" .2F4_October_2010">
 +
===4 October===
 +
 
 +
Got it!
 +
The problem was the plasmid backbone. It was thought that it was pSB1A3, but in fact it was pSB1AK3. Kanamycin has a ClaI site.
 +
 
 +
A restriction digest was performed using EcoRI and PstI. The RFP plasmid was also digested with EcoRI and PstI. A ligation reaction was performed in order for the promoter part to switch backbones (from pSB1AK3 to pSB1C3).
 +
RFP is also a form of control mechanism to see if the plasmid has the correct insert. Red colonies have RFP, while White colonies have our insert. Overnight ligation at 16 degrees.
 +
 
 +
[[Image:RedWhite.JPG| 350px]]
 +
 
 +
</div>
 +
 
 +
<div id=" .2F5_October_2010">
 +
 
 +
===5 October===
 +
 
 +
The ligation product was transformed (5ul) into E.coli XL1 Blue competent cells.
 +
 
 +
</div>
 +
 
 +
<div id=" .2F6_October_2010">
 +
===6 October===
 +
 
 +
Colonies grew. Two white colonies were picked and grown overnight in the shaking incubator at 37 degrees.
 +
</div>
 +
 
 +
<div id=" .2F7_October_2010">
 +
===7 October===
 +
 
 +
Slow growth on Chloroamphenicol. Cultures were left on the shaking incubator for an extra night.
 +
</div>
 +
 
 +
<div id=" .2F8_October_2010">
 +
===8 October===
 +
 
 +
Miniprep of the colonies. One successfully grew, while the other did not.
 +
Miniprep results gave a concentration of 114ng/ul with a 260/280 of 1.98.  Woohoo.
 +
 
 +
Double digest (diagnostic) with NcoI and AflII/ClaI --> to check the success of mutagenesis. Gel result gave strange band pattern.
 +
</div>
 +
 
 +
<div id=" .2F11_October_2010">
 +
===11 October===
 +
 
 +
Single restriction digest (AflII/ClaI) verified the size of the plasmid. Will re-do double digest tomorrow.
 +
 
 +
working on presentation and wiki
 +
 
 +
</div>
 +
 
 +
<div id=" .2F13_October_2010">
 +
===13 October===
 +
Making 80% glycerol stock
 +
Miniprep of mr.gene TAQ
 +
clone 1 = 26.7 ng/ul (100ul)
 +
clone 2 = 21.1ng/ul (100ul)
 +
Restriction Enzyme digest of mr.gene taq with EcoRi and Pst
 +
Diagnostic Gel worked YAY
 +
Ligation of Mr.gene taq into psb1c3 left over night at 16 degrees
 +
 
 +
 
 +
</div>
 +
 
 +
<div id=" .2F14_October_2010">
 +
===14 October===
 +
Heat inactivated T4 ligase
 +
Transformation of Mr.gene taq in psb1c3
 +
</div>

Latest revision as of 05:06, 14 October 2010


Notebook

June
MTWTFSS
  [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F1_June_2010 1] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F2_June_2010 2] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F3_June_2010 3] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F4_June_2010 4] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F5_June_2010 5] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F6_June_2010 6]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F7_June_2010 7] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F8_June_2010 8] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F9_June_2010 9] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F10_June_2010 10] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F11_June_2010 11] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F12_June_2010 12] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F13_June_2010 13]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F14_June_2010 14] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F15_June_2010 15] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F16_June_2010 16] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F17_June_2010 17] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F18_June_2010 18] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F19_June_2010 19] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F20_June_2010 20]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F21_June_2010 21] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F22_June_2010 22] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F23_June_2010 23] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F24_June_2010 24] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F25_June_2010 25] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F26_June_2010 26] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F27_June_2010 27]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F28_June_2010 28] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F29_June_2010 29] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F30_June_2010 30]
July
MTWTFSS
      [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F1_July_2010 1] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F2_July_2010 2] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F3_July_2010 3] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F4_July_2010 4]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F5_July_2010 5] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F6_July_2010 6] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F7_July_2010 7] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F8_July_2010 8] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F9_July_2010 9] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F10_July_2010 10] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F11_July_2010 11]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F12_July_2010 12] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F13_July_2010 13] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F14_July_2010 14] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F15_July_2010 15] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F16_July_2010 16] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F17_July_2010 17] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F18_July_2010 18]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F19_July_2010 19] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F20_July_2010 20] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F21_July_2010 21] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F22_July_2010 22] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F23_July_2010 23] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F24_July_2010 24] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F25_July_2010 25]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F26_July_2010 26] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F27_July_2010 27] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F28_July_2010 28] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F29_July_2010 29] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F30_July_2010 30] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F31_July_2010 31]
August
MTWTFSS
            [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F1_August_2010 1]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F2_August_2010 2] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F3_August_2010 3] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F4_August_2010 4] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F5_August_2010 5] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F6_August_2010 6] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F7_August_2010 7] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F8_August_2010 8]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F9_August_2010 9] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F10_August_2010 10] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F11_August_2010 11] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F12_August_2010 12] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F13_August_2010 13] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F14_August_2010 14] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F15_August_2010 15]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F16_August_2010 16] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F17_August_2010 17] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F18_August_2010 18] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F19_August_2010 19] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F20_August_2010 20] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F21_August_2010 21] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F22_August_2010 22]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F23_August_2010 23] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F24_August_2010 24] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F25_August_2010 25] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F26_August_2010 26] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F27_August_2010 27] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F28_August_2010 28] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F29_August_2010 29]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F30_August_2010 30] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F31_August_2010 31]
September
MTWTFSS
    [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F1_September_2010 1] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F2_September_2010 2] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F3_September_2010 3] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F4_September_2010 4] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F5_September_2010 5]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F6_September_2010 6] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F7_September_2010 7] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F8_September_2010 8] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F9_September_2010 9] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F10_September_2010 10] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F11_September_2010 11] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F12_September_2010 12]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F13_September_2010 13] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F14_September_2010 14] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F15_September_2010 15] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F16_September_2010 16] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F17_September_2010 17] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F18_September_2010 18] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F19_September_2010 19]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F20_September_2010 20] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F21_September_2010 21] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F22_September_2010 22] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F23_September_2010 23] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F24_September_2010 24] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F25_September_2010 25] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F26_September_2010 26]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F27_September_2010 27] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F28_September_2010 28] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F29_September_2010 29] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F30_September_2010 30]
October
MTWTFSS
        [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F1_October_2010 1] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F2_October_2010 2] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F3_October_2010 3]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F4_October_2010 4] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F5_October_2010 5] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F6_October_2010 6] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F7_October_2010 7] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F8_October_2010 8] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F9_October_2010 9] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F10_October_2010 10]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F11_October_2010 11] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F12_October_2010 12] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F13_October_2010 13] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F14_October_2010 14] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F15_October_2010 15] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F16_October_2010 16] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F17_October_2010 17]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F18_October_2010 18] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F19_October_2010 19] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F20_October_2010 20] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F21_October_2010 21] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F22_October_2010 22] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F23_October_2010 23] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F24_October_2010 24]
[http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F25_October_2010 25] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F26_October_2010 26] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F27_October_2010 27] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F28_October_2010 28] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F29_October_2010 29] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F30_October_2010 30] [http://2010.igem.org/Team:RMIT_Australia/Notebook#.2F31_October_2010 31]


28 June

Did OH&S training and PC2 training

29 June

Began research on what we were going to use to promote taq

30 June

Looked at T7 with a Lac operon as a promotore of taq

13 July

Designed Primers for Taq into backbone

Researched about using an Asp/Pro between the peptide and the Taq

Began looking at ligation independent cloning for insertion of peptide

14 July

Looked at prices of Hotels in Boston

19 July

began looking at the structure of taq, its thermostability began looking at different mutations that can be done to taq to increase its thermostability without changing its structure

21 July

sent in sequence of wild type taq to iTasser

23 July

Checked thermostability of the mutations that will be done to Taq using Expasy

Sent in sequence of taq with mutations at 485, 515 and 540 to iTasser

3 August

Had iGEM team meeting

-Discussed ANZAAS Proposal

-Spoke about possibilities of using Geneart

-Discussed possible T-shirt designs

5 August

Meet up with Damian, discussed different strategies to use in modelling, began using YASARA to do our Modelling

10 August

Had iGEM team meeting

-Took Team Photo

11 August

PCR of Taq

Taq with a DNA concentration of 40ng/µL was diluted to 1µM by addition of 24µL of MilliQ water to 1µL of the Taq plasmid. Primers were diluted to 100µM by adding 354µL to the forward primer with a concentration of 35.4 nmol and 405µL to the reverser primer with a concentration of 40.5nmol. The primers were further diluted to 0.2µM by adding 10µL of the primer to 490µL of milliQ water. The PCR reaction was then made by adding 25µL of Master Mix, 2.5µL of each primer, 5µL of Rnase free water and 15µL of 0.2µM Taq Plasmid.

The PCR

98º 60 Sec 1 cycle

98º 15 Sec then 72º 90 Sec 25 cycle

72º 5 min 1 cycle

16 August

Collaborated with the Sheffield team by participating in an over the phone survery about Human Practices

17 August

had team meeting

- discussed how we can get more sponsors

- talked about placing our order to gene art

- began filling out the form to send Pennstates survey to the ethics committee

- discussed results for modelling

- decided to fix optimise our previous PCR

18 August

called few companies seeking sponsorship enquired for booking flights and accomadation

19 August

Working on comparing TAQ wild structure to the TAQ Mutated structure to see that there are no major differences, which will mean that TAQ is inactive but will retain it's thermostability at high temperatures.

Wrote an email to ABC TV, wanting to know if they will do piece on our project for there The New Inventors Program.

Waiting for results from I-Tasser on the mutated TAQ sequence. Went into the lab and made SOC media and LB- agar plates

20 August

Did two PCR reaction and a transformation The first PCR we ran was a touch down PCR. Temperatures ranged from 69 to 64. The second PCR was a two step PCR.

30 August

Ordered the TAQ polymerase from Mr. Gene. Should have it in 15 days. Meeting today at 10am to discuss project budget and costings. After the meeting we all are sitting together for a writing session.

31 August

Spent the morning organising our flights In the afternoon we all sat together for a writing session

1 September

We all sat together for another writing session.

7 September

Had a team meeting

14 September

Had a team meeting and made a lab time table, we also set out tasks which need to be done by the next meeting

  • Update the wiki
  • Finalise the form for the ethics committee for pennstate
  • Call up possible sponsors
  • Collect Tshirts
  • Work on abstract and team Roster
  • research heat liable bonds
  • order peptides
  • chat with emilio about possible bio assays
  • work on making the promotor part

15 September

Mutagenesis Quikchange XL kit

Click Here for Mutagenesis Protocol

  • Template Concentration = 8ng/µl
  • Fwd 77ng/µl (low 260/280)
  • Rev 86.5 ng/µl (low 260/280)

We optimised for low 260/280

Reaction Mixture

  • 5 µl buffer
  • 1.9 µl template
  • 1.7 µl Fwd
  • 1.62 µl Rev
  • 1 µl dNTP
  • 38.78 µl H2O --> reaction volume 50 µl
  • 1 µl Pfu

First mutagenesis was to turn the -35 site in the promoter region into an Afi II restriction site. Dpn1 digest (2 µl) for 2hrs

16 September

Click Here for Mutagenesis Protocol

2 µl of the mutagenesis product into 100 µl of competent cells Plate 50 µl, 100 µl and 150 µl samples.

17 September

- finalized project abstract

19 September

- Sent off project abstract to HQ

20 September

Two colonies were picked from the plates and were grown in 5mL of Media

21 September

A miniprep was performed on 1.5ul of the overnight culture. 10ng/ul DNA were obtained from both samples with a O.D higher than 1.85. These samples were then used to perform a restriction digest using EcoR1 H.F and AflII. The restriction digest was done according to the iGEM protocols [http://ginkgobioworks.com/support/BioBrick_Assembly_Manual.pdf CLICK HERE].

Results The restriction digest did not work. We expected a band at 160bp and one at ~3000bp

22 September

>>>> TABLE <<<<


Results The restriction worked. Gel Image below

23 September

Second mutagenesis. This involves changing the -10 promoter region into a ClaI restriction site. AflII (11) miniprep sample was used as template

Click Here for Mutagenesis Protocol

After the Dpn1 digest, 2ul of product was transformed into E.coli Xl1 blue cells.

24 September

Colonies grew on the plate. This was stores in the fridge (4 degrees) until Monday for colonies to be picked.

27 September

Two colonies were picked from the plate and grown overnight at 37 degrees in the shaking incubator.

28 September

Preparation of plasmid DNA using Invitrogen Miniprep Kit. Obtained ---ng/ul (260/280 = ---)

Restriction digest using EcoRI and ClaI, then gel electrophoresis. Strange gel picture. Two bands of similar size ~ 1.3 kb and 1.6 kb appear on the gel.

29 September

Two more colonies (different) were picked and grown overnight at 37 degrees.

Transformation of RFP in Ampicillin, Kanamycin and Chloroamphenicol backbones. They will act as spare backbones.

30 September

A second preparation of plasmid DNA using Invitrogen Miniprep Kit. Obtained ---ng/ul (260/280 = ---)

Restriction digest using EcoRI and ClaI, then gel electrophoresis. Strange gel picture again. Two bands of similar size ~ 1.3 kb and 1.6 kb appear on the gel. There is a problem with the backbone or the miniprep. Must investigate.

4 October

Got it! The problem was the plasmid backbone. It was thought that it was pSB1A3, but in fact it was pSB1AK3. Kanamycin has a ClaI site.

A restriction digest was performed using EcoRI and PstI. The RFP plasmid was also digested with EcoRI and PstI. A ligation reaction was performed in order for the promoter part to switch backbones (from pSB1AK3 to pSB1C3). RFP is also a form of control mechanism to see if the plasmid has the correct insert. Red colonies have RFP, while White colonies have our insert. Overnight ligation at 16 degrees.

RedWhite.JPG

5 October

The ligation product was transformed (5ul) into E.coli XL1 Blue competent cells.

6 October

Colonies grew. Two white colonies were picked and grown overnight in the shaking incubator at 37 degrees.

7 October

Slow growth on Chloroamphenicol. Cultures were left on the shaking incubator for an extra night.

8 October

Miniprep of the colonies. One successfully grew, while the other did not. Miniprep results gave a concentration of 114ng/ul with a 260/280 of 1.98. Woohoo.

Double digest (diagnostic) with NcoI and AflII/ClaI --> to check the success of mutagenesis. Gel result gave strange band pattern.

11 October

Single restriction digest (AflII/ClaI) verified the size of the plasmid. Will re-do double digest tomorrow.

working on presentation and wiki

13 October

Making 80% glycerol stock Miniprep of mr.gene TAQ clone 1 = 26.7 ng/ul (100ul) clone 2 = 21.1ng/ul (100ul) Restriction Enzyme digest of mr.gene taq with EcoRi and Pst Diagnostic Gel worked YAY Ligation of Mr.gene taq into psb1c3 left over night at 16 degrees


14 October

Heat inactivated T4 ligase Transformation of Mr.gene taq in psb1c3

Retrieved from "http://2010.igem.org/Team:RMIT_Australia/Notebook"