Team:Cambridge/Quiescence Notes

From 2010.igem.org

(Difference between revisions)
(Sequences)
 
(18 intermediate revisions not shown)
Line 1: Line 1:
 +
{{:Team:Cambridge/Templates/headerMinimal}}
 +
{{:Team:Cambridge/Templates/headerbar|colour=#96d446|title=Rough notes: Quiescence}}
*[http://mic.sgmjournals.org/cgi/reprint/155/8/2676.pdf The role of FIS in the Rcd checkpoint and stable maintenance of plasmid ColE1] ie good as the toggle control thingy
*[http://mic.sgmjournals.org/cgi/reprint/155/8/2676.pdf The role of FIS in the Rcd checkpoint and stable maintenance of plasmid ColE1] ie good as the toggle control thingy
*[http://www3.interscience.wiley.com/cgi-bin/fulltext/119127730/PDFSTART Timing, self-control and a sense of direction are the secrets of multicopy plasmid stability]
*[http://www3.interscience.wiley.com/cgi-bin/fulltext/119127730/PDFSTART Timing, self-control and a sense of direction are the secrets of multicopy plasmid stability]
Line 23: Line 25:
A new approach to making a quiescence switch would be to control the functionality of the folded RNA instead of its transcription, which proved to be problematic. Some data on the structure of different Rcd can be found here:
A new approach to making a quiescence switch would be to control the functionality of the folded RNA instead of its transcription, which proved to be problematic. Some data on the structure of different Rcd can be found here:
-
 
*[http://mic.sgmjournals.org/cgi/reprint/145/8/2135 1999 article by Sharpe et al. Summers being one of the al]
*[http://mic.sgmjournals.org/cgi/reprint/145/8/2135 1999 article by Sharpe et al. Summers being one of the al]
Line 29: Line 30:
The project would involve synthesising lots of different constructs (which are all mercifully short) and testing their functionality and sensitivity. The result would be a fairly short, but quite versatile BioBrick.
The project would involve synthesising lots of different constructs (which are all mercifully short) and testing their functionality and sensitivity. The result would be a fairly short, but quite versatile BioBrick.
Gos recommended talking to Jim H and David Summers about whether a self-splicing structure in this functional RNA can work.
Gos recommended talking to Jim H and David Summers about whether a self-splicing structure in this functional RNA can work.
-
 
-
We've got The Aptamer Handbook from the Central Science Library, it describes about three billion compounds you can make aptamers bind to, and has a whole section on applications, but unfortunately doesn't seem to ''mention'' self-splicing. -.-
 
Paper on ribozymes, including sweet self-splicing ones:
Paper on ribozymes, including sweet self-splicing ones:
-
 
[http://lim.fcien.edu.uy/tallerbm/pdf/2.%20Serganov%202007%20Nature%20Rev%20Gen.pdf Ribozymes ftw]
[http://lim.fcien.edu.uy/tallerbm/pdf/2.%20Serganov%202007%20Nature%20Rev%20Gen.pdf Ribozymes ftw]
Another very nice review on RNA parts and their functions. This article was one of the main sources for the talk we had on hammerhead+aptamer switches.
Another very nice review on RNA parts and their functions. This article was one of the main sources for the talk we had on hammerhead+aptamer switches.
 +
[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2713350/ Smolke et al. 2009]
 +
==Papers==
 +
 +
* Paper with diagram showing cut site: http://sage.ucsc.edu/scottlab/reprints/2006_Scott_Cell_pdf/2006_Scott_Cell.pdf
 +
 +
*A new approach to making a quiescence switch would be to control the functionality of the folded RNA instead of its transcription, which proved to be problematic. Some data on the structure of different Rcd can be found here:
 +
[http://mic.sgmjournals.org/cgi/reprint/145/8/2135 1999 article by Sharpe et al. Summers being one of the al]
 +
 +
*Paper on ribozymes, including sweet self-splicing ones:
 +
[http://lim.fcien.edu.uy/tallerbm/pdf/2.%20Serganov%202007%20Nature%20Rev%20Gen.pdf Ribozymes ftw]
 +
*Another very nice review on RNA parts and their functions. This article was one of the main sources for the talk we had on hammerhead+aptamer switches.
[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2713350/ Smolke et al. 2009]
[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2713350/ Smolke et al. 2009]
 +
 +
We do not necessarily have to use hammerhead RNA. There are other self-cleaving RNA structures that have been identified, as described in this paper. We could also look into using the aptamer as a direct means of changing shape and functionality of the RNA. That could end up giving us a less digital output and might be difficult to implement, as the Rcd RNA is a very stable structure.
 +
 +
[http://www.pnas.org/content/97/11/5784.full Tang and Breaker 2000 on self-cleaving ribozymes]
==Sequences==
==Sequences==
-
Hammerhead ribozyme: GGGAGCCCCGCUGAUGAGGUCGGGGAGACCGAAAGGGACUUCGGUCCCUACGGGGCUCCC
+
Hammerhead ribozyme?: GGGAGCCCCGCUGAUGAGGUCGGGGAGACCGAAAGGGACUUCGGUCCCUACGGGGCUCCC
Rcd: AGGCGCGAUCGCGGCAGUUUUUCGGGUGGUUUGUUGCCAUUUUUACCUGUCUGCUGCCGUGAUCGCGCUGAACGCGUUUUAGCGGUGCCUACAAU
Rcd: AGGCGCGAUCGCGGCAGUUUUUCGGGUGGUUUGUUGCCAUUUUUACCUGUCUGCUGCCGUGAUCGCGCUGAACGCGUUUUAGCGGUGCCUACAAU
 +
Rcdv2AGGCGCGAUCGCGGCAGUUUUUCGGGUGGUUUGUUGCAUUUUUACCUGUCUGCUGCCGUGAUCGCGCUGAACGCGUUUUAGCGGUGCCUACAAU
 +
 +
Hammerhead sequence PDB: GGGAGCCCUGUCACCGGAUGUGCUUUCCGGUCUGAUGAGUCCGUGAGGACAAAACAGGGCUCCCGAAUU
 +
 +
 +
THERE'S A APTAMER FOR CAFFEINE!!
 +
 +
Unfortunately it is massively insensitive. According to the aptamer handbook it (characterised by Jenison et al. 1994) has an equilibrium constant of 3500µM, at this concentration it has weak cytotoxic effects. There might be more sensitive aptamers for caffeine out there. Caffeine is very closely related to theophylline (which just has a -CH3 instead of a H), the aptamer for that has a Kd of 0.1 µM and serves as a standard example for aptamers. Its also found in tea. It might be less flashy than having caffeine responding cells, but it might be easier to make them tea-addicts. We're a British team after all?
 +
Definitely possible to spin the tea-angle, BUT, I think the 3500µM figure is for the theophylline aptamer's binding to caffeine. I now can't find a specific caffeine aptamer, but we might be able to find/make one? But theophylline is probably place to start..
 +
 +
[http://nar.oxfordjournals.org/cgi/content/full/32/5/1756#GKH336F6 Interesting in general + newer caffeine aptamer? (Ferguson et al 2004)]
 +
 +
 +
[http://arep.med.harvard.edu/labgc/adnan/projects/Utilities/revcomp.html Tool for reverse complement]
 +
 +
==Doing it without a cleaving ribozyme?==
 +
[http://gcat.davidson.edu/GcatWiki/index.php/Antiswitches Antiswitches wiki site]
 +
[Smolke 2005 - the riboswitches paper]
 +
{{:Team:Cambridge/Templates/footerMinimal}}

Latest revision as of 23:46, 10 August 2010