Team:Slovenia/METHODS and PARTS/notebook
From 2010.igem.org
(Difference between revisions)
(3 intermediate revisions not shown) | |||
Line 61: | Line 61: | ||
background-image:url("https://static.igem.org/mediawiki/2010/5/5a/SLOnotebookover.png"); | background-image:url("https://static.igem.org/mediawiki/2010/5/5a/SLOnotebookover.png"); | ||
} | } | ||
- | + | ||
- | + | ||
- | + | ||
</style> | </style> | ||
<div id="overhead"> | <div id="overhead"> | ||
Line 69: | Line 67: | ||
</div> | </div> | ||
<div id="thumbsi"> | <div id="thumbsi"> | ||
- | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook"><span id="stopnja3a" > | + | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook"><span id="stopnja3a" >split/FRET</span></a> |
- | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/oscil"><span id="stopnja3"> | + | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/oscil"><span id="stopnja3">oscillator</span></a> |
- | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/viola"><span id="stopnja3" margin-left:15px;"> | + | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/viola"><span id="stopnja3" margin-left:15px;">violacein</span></a> |
- | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/carot"><span id="stopnja3" > | + | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/carot"><span id="stopnja3" >carotenoids</span></a> |
- | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/protein"><span id="stopnja3"> | + | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/protein"><span id="stopnja3">proteins</span></a> |
<a href="/Team:Slovenia/METHODS_and_PARTS/notebook/znf"><span style="font-size:15px; | <a href="/Team:Slovenia/METHODS_and_PARTS/notebook/znf"><span style="font-size:15px; | ||
- | width:167px;" id="stopnja3"> | + | width:167px;" id="stopnja3">zinc-finger binding test</span></a> |
</div> | </div> | ||
<div id="besedilo"> | <div id="besedilo"> | ||
Line 94: | Line 92: | ||
<div id="week1" style="display:block"> | <div id="week1" style="display:block"> | ||
- | + | 6/17/2010 – 6/20/2010 | |
- | < | + | <br> |
- | + | PCR of C-terminal and N-terminal fragments of fluorescent proteins (termed split fluorescent proteins). mCerulean (cyan fluorescent protein) and mCitrine (yellow fluorescent protein) were used as templates. N-splits were PCRed with reverse primer carrying stop codon, C-splits with forward primer carrying start codon and reverse primer carrying linker sequence.<br> | |
- | + | ||
<p><span style="font-size: 75%;">reverse for N-splits: 5'-TGTA<span style="background-color: rgb(128, 0, 128);">CTGCAG</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(255, 0, 255);">ACTAGT</span><span style="background-color: rgb(255, 255, 0);">TTA</span>GATGTTGTGGCGGATCTTG-3'</span> </p> | <p><span style="font-size: 75%;">reverse for N-splits: 5'-TGTA<span style="background-color: rgb(128, 0, 128);">CTGCAG</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(255, 0, 255);">ACTAGT</span><span style="background-color: rgb(255, 255, 0);">TTA</span>GATGTTGTGGCGGATCTTG-3'</span> </p> | ||
<p><span style="font-size: 75%;">forward for C-splits: 5'-ACTA<span style="background-color: rgb(255, 0, 0);">GAATTC</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(0, 255, 255);">TCTAGA</span><span style="background-color: rgb(255, 255, 0);">atg</span>GCCGACAAGCAGAAGAACG-3'</span> </p> | <p><span style="font-size: 75%;">forward for C-splits: 5'-ACTA<span style="background-color: rgb(255, 0, 0);">GAATTC</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(0, 255, 255);">TCTAGA</span><span style="background-color: rgb(255, 255, 0);">atg</span>GCCGACAAGCAGAAGAACG-3'</span> </p> | ||
<p><span style="font-size: 75%;">reverse for C-splits: 5'-TGTA<span style="background-color: rgb(128, 0, 128);">CTGCAG</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(255, 0, 255);">ACTAGT</span><span style="background-color: rgb(192, 192, 192);">GCTTCCCCCACTCCCACCGCCAGAGCCACC</span><span style="text-decoration: underline;">C</span></span><span style="font-size: 10px; line-height: 11px;">TTGTACAGCTCGTCCATGC-3'</span> </p> | <p><span style="font-size: 75%;">reverse for C-splits: 5'-TGTA<span style="background-color: rgb(128, 0, 128);">CTGCAG</span><span style="background-color: rgb(0, 255, 0);">GCGGCCGC</span><span style="background-color: rgb(255, 0, 255);">ACTAGT</span><span style="background-color: rgb(192, 192, 192);">GCTTCCCCCACTCCCACCGCCAGAGCCACC</span><span style="text-decoration: underline;">C</span></span><span style="font-size: 10px; line-height: 11px;">TTGTACAGCTCGTCCATGC-3'</span> </p> | ||
- | <p><span style="font-size: 75%; background-color: rgb(255, 0, 0);">EcoRI</span><span style="font-size: 75%;"> <span style="background-color: rgb(0, 255, 0);">NotI</span> <span style="background-color: rgb(0, 255, 255);">XbaI</span> <span style="background-color: rgb(255, 0, 255);">SpeI</span> <span style="background-color: rgb(128, 0, 128);">PstI</span> <span style="background-color: rgb(192, 192, 192);">linker</span> | + | <p><span style="font-size: 75%; background-color: rgb(255, 0, 0);">EcoRI</span><span style="font-size: 75%;"> <span style="background-color: rgb(0, 255, 0);">NotI</span> <span style="background-color: rgb(0, 255, 255);">XbaI</span> <span style="background-color: rgb(255, 0, 255);">SpeI</span> <span style="background-color: rgb(128, 0, 128);">PstI</span> <span style="background-color: rgb(192, 192, 192);">linker</span></span></p> |
+ | |||
+ | <p> </p> | ||
+ | |||
</div> | </div> |
Latest revision as of 22:58, 27 October 2010
notebook - split/FRET
week 1 week 11
week 2 week 12
week 3 week 13
week 4 week 14
week 5 week 15
week 6 week 16
week 7 week 17
week 8 week 18
week 9 week 19
week 10week 20
6/17/2010 – 6/20/2010
PCR of C-terminal and N-terminal fragments of fluorescent proteins (termed split fluorescent proteins). mCerulean (cyan fluorescent protein) and mCitrine (yellow fluorescent protein) were used as templates. N-splits were PCRed with reverse primer carrying stop codon, C-splits with forward primer carrying start codon and reverse primer carrying linker sequence.
PCR of C-terminal and N-terminal fragments of fluorescent proteins (termed split fluorescent proteins). mCerulean (cyan fluorescent protein) and mCitrine (yellow fluorescent protein) were used as templates. N-splits were PCRed with reverse primer carrying stop codon, C-splits with forward primer carrying start codon and reverse primer carrying linker sequence.
reverse for N-splits: 5'-TGTACTGCAGGCGGCCGCACTAGTTTAGATGTTGTGGCGGATCTTG-3'
forward for C-splits: 5'-ACTAGAATTCGCGGCCGCTCTAGAatgGCCGACAAGCAGAAGAACG-3'
reverse for C-splits: 5'-TGTACTGCAGGCGGCCGCACTAGTGCTTCCCCCACTCCCACCGCCAGAGCCACCCTTGTACAGCTCGTCCATGC-3'
EcoRI NotI XbaI SpeI PstI linker