Team:WashU/Notebook/Biobricks

From 2010.igem.org

(Difference between revisions)

Latest revision as of 07:26, 27 October 2010

2010/08/12

Ordered the following primers to biobrick parts

p18	Forward KanMX4	ATT CTT AGA ATT CGC GGC CGC TTC TAG CCC GCC GCC ACC ATG GGT AAG GAA AAG ACT CAC GTT TCG 
p19	Reverse KanMX4	GCC GCC CTC TGC AGC GGC CGC TAC TAG TAT TAG AAA AAC TCA TCG AGC ATC AAA TGA AAC TG
p20	Forward NatMX4	GTT TCT TCG AAT TCG CGG CCG CTT CTA GCC CGC CGC CAC CAT GGG TAC CAC TCT TGA CGA CAC G
p21	Reverse NatMX4	GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TAG GGG CAG GGC ATG CTC ATG TAG 
p22	Forward Ura3-1	GCACAGAACAATAACCTGCTGGAAACGAAGATAAATCgaagacGATTACTTCGCGTTATGCAGGC
p23	Reverse Ura3-1	GCATCTTCTCAAATATGCTTCCCAGCCTGCTTATCcttctgAAATTCTGCCTCGTGATACGCC
p24	Forward Ura3-2	tactagtagcggccgctgcagTCTTAACCCAACTGCACAGAACAATAACCTGCTGGAAACG
p25	Reverse Ura3-2	ctctagaagcggccgcgaattcTTAGTATTGCTGGCCGCATCTTCTCAAATATGCTTCCCAGCC
p26	Forward His3-1	GAACAGGCCACACAATCGCAAGTGATTAACgaagacGATTACTTCGCGTTATGCAGGC
p27	Reverse His3-1	CCTTGAACGCACTCTCACTACGGTGATGATCActtctgAAATTCTGCCTCGTGATACGCC
p28	Forward His3-2	tactagtagcggccgctgcagAGAGGGAGAAGCAGTAGCAGAACAGGCCACACAATCGCAAG
p29	Reverse His3-2	ctctagaagcggccgcgaattcTTATGGCAACCGCAAGAGCCTTGAACGCACTCTCACTACGG
p30	Biobrick Forward	tgccacctgacgtctaagaa
p31	Biobrick Reverse	attaccgcctttgagtgagc
p32	Forward Ura3 Check	CGG TAA TCT CCG AGC AGA AGG AAG AAC G
p33	Reverse Ura3 Check	CAT TAC GAC CGA GAT TCC CGG GTA ATA ACT G
p34	Forward His3 Check	GAG CAG AAA GCC CTA GTA AAG CGT ATT ACA AAT G
p35	Reverse His3 Check	CTA CAT AAG AAC ACC TTT GGT GGA GGG AAC
p36	Forward SxL	gtttcttcgaattcgcggccgcttctagagcccgccgccaccatgtacg
p37	Reverse SxL	gtttcttcctgcagcggccgctactagtattattataccttgcgctttttcttgggg
p38	Vector internal Sequencing 1 - Forward 1400 start	ACA CCC GTC CTG TGG ATC 
p39	Vector internal Sequencing 2 - Reverse 1523 start	GAAGTGGCGAGCCCGATCTTC
p40	Vector internal Sequencing 3 2301 start	CCACCTCGACCTAACTCGAGTTAC

2010/08/19

The following PCr reactions were run and then column Purified.

Number	Product 	Template	Forward Primer 	Reverse Primer 	 Temperature
1	Kan BB 		KanMX4 		p18 		p19 		58 
2	Nat BB 		NatMX4 		p20 		p21 		58 
3	Kan BB 		KanMX4 		p18 		p19 		60 
4	Nat BB 		NatMX4 		p20		p21 		60 
5	Kan BB 		KanMX4 		p18 		p19 		64 
6	Nat BB 		NatMX4 		p20 		p21 		64

The following digestions of were run.

	K58 	N58 	K60 	N60 	K64 	N64 	P1 
H20	12.5 	12.5 	12.5 	12.5 	12.5 	12.5 	22.5 
Buffer 2	5 	5 	5 	5 	5 	5 	5 
BSA	0.5 	0.5 	0.5 	0.5 	0.5 	0.5 	0.5 
DNA	30 	30 	30 	30 	30 	30 	20 
EcoRI	1 	1 	1 	1 	1 	1 	1 
PstI	1 	1 	1 	1 	1 	1 	1

The digestions were run for 6 hours at 27 degC and then kept at 4 degC o/n
Made Chloramphenicol Plates at a concentration of 34μg/ml

2010/08/21

The ligation reactions (KFYP3, KYFP4,KYFP5, - control, + control) were transformed and plated onto amp plates.
Transformation Results

Plate		Result
1. K58&p1	2 colonies formed, one on the edge of the plate pointing towards a possible satellite colony
2. N58&p1	No colonies appeared to have formed 
3. K60&p1	No colonies appeared to have formed  
4. N60&p1	No colonies appeared to have formed  
5. K64 &p1	No colonies appeared to have formed  
6. N64 & p1	No colonies appeared to have formed  
pSB1AT3	Many ~100 colonies formed with over 50% expressing red color under room light, predominantly large colonies are red
pSB1C3	 	~30 colonies formed with slght red coloring at the center

Over Night Colonies prepared from

K58&p1 colony from middle of plate	34μg/ml chloramphenicol liquid media
pSB1AT3				50μg/ml Amp liquid media
pSB1C3					34μg/ml chloramphenicol liquid media

2010/08/22

Miniprepped the following from overnight cultures made on 8/21/10:

DNA				Concentration (ng/μl)	260/280 	20/230 
Kan BB in pSB1C3 		 37.8			1.92		2.15 
pSB1AT3 with BBa_J04450 insert  102.1			1.92 		2.26 
pSB1C3 with BBa_J04450 insert	 196.8			1.91 		2.31

The following PCR reaction was run with an elongation time of 3.5 minutes:

Number	Product 	Template 	Forward Primer 		Reverse Primer 		Annealing Temperature
1	His3 Intermediate Vector	pSB1AT3 w/ insert	 p27		p29 	 58
2	Ura3 intermediate Vector	pSB1AT3 w/ insert	 p23		p25	 58
3	His3 intermediate Vector	pSB1AT3 w/ insert	 p27		p29 	 60
4	Ura3 intermediate Vector	pSB1AT3 w/ insert	 p23		p25 	 60
5	His3 intermediate Vector	pSB1AT3 w/ insert	 p27		p29 	 62
6	Ura3 intermediate Vector	pSB1AT3 w/ insert	 p23		p25 	 62

The following Digestion was run:

	 pSB1C3 w/ insert
H20	 40
DNA	 2.5
NEB-3	 5
BSA	 0.5
EcoRI	 1
PstI	 1

The following Gel was run:

1 1kb Ladder
2 H58 intermediate
3 U58 intermediate
4 H60 intermediate
5 U60 intermediate
6 H62 intermediate
7 U62 intermediate
8 pSB1C3 Digestion product

The gel was cut and the products were gel purified using the Sigma Kit

The following PCR reaction was let run over night with an elongation time of 3.5 minutes:

Number	Product 		Template 			Forward Primer 	Reverse Primer 	Annealing Temperature
1	His3 Final Vector	 H58 Intermediate Vector	 p27		p29 	 	58
2	Ura3 Final Vector	 U58 Intermediate Vector	 p23		p25	 	58
3	His3 Final Vector	 H60 Intermediate Vector	 p27		p29 	 	60
4	Ura3 Final Vector	 U60 Intermediate Vector	 p23		p25 		60
5	His3 Final Vector	 H62 Intermediate Vector	 p27		p29 	 	62
6	Ura3 Final Vector	 U62 Intermediate Vector	 p23		p25 	 	62

2010/08/23

Nanodropped Over night PCR product:

Number	Label 	Concentration ng/μL 	260/280 	260/230 
1	H58 	10.2 	2.34 	1.22 
2	U58 	6.6 	2.31 	1.13 
3	H60 	10.2 	1.81 	1.14 
4	U60	5.5	2.33	1.16 
5	H62 	7.4 	2.00 	1.18 
6	H62 	0.4 	-0.65 	0.17

Preformed the following digestions at 37 degC for 2 hours and heat inactivation at 80 degC for 20 minutes:

	H58 	U58 	H60 	U60 	H62 	 pSB1C3 w/ insert	ADH1 Promoter 	Kan_BB 	Linear pSB1T3	pSB1AT3 w/ insert 
H20	 12.5	12.5 	12.5 	12.5 	12.5 	 40	 40	29.3 	32.5	335.6 
DNA	 30	 30 	 30 	 30 	 30 	 2.5	 2.5	13.2 	 10	 4.9
NEB-2	 -	- 	- 	- 	- 	- 	 5	5 	5 	5 
NEB-3	 5	5 	5 	5 	5 	 5	 -	- 	- 	- 
BSA	 0.5	0.5 	0.5 	0.5 	0.5 	 0.5	0.5 	0.5 	0.5 	0.5 
1μL E1	EcoRI	EcoRI 	EcoRI 	EcoRI 	EcoRI	EcoRI 	 EcoRI	XbaI 	 EcoRI	EcoRI  
1μL E2 	 PstI	PstI  	PstI 	PstI 	PstI 	PstI  	 SpeI	PstI 	 PstI	PstI 
1μL E3	 	 	 	 	 	 	 	 	 	 XbaI
1μL E4	 	 	 	 	 	 	 	 	 	 SpeI

Preformed the following ligations following the Biobrick Manual Protocol

	H58 	U58 	H60 	U60 	H62 	AHD1+K_BB+pSB1T3	ADH1+K_BB+pSB1AT3
H20	 11 	11 	11 	11 	11 	11 	11 
Component 1	H58 	U58 	H60 	U60 	H62 	ADH1 		ADH1 
Component 2	pSB1C3 	pSB1C3  pSB1C3  pSB1C3  pSB1C3 	K_BB 		K_BB 
Component 3	 	 	 	 	 	Linear pSB1T3 	pSB1AT3
10x T4 ligase buffer	2 	2 	2 	2 	2 	2 	2 
T4 DNA Ligase	1 	1 	1 	1 	1 	1 	1 	1

Preformed the following transformations:

1	H58 			Amp 
2	U58 			Amp 
3	H60 			Amp 
4	U60 			Amp 
5	H62 			Amp 
6	N58+pSB1C3		Chlor 
7	N60+pSB1C3 		Chlor 
8	N64+pSB1C3 		Chlor 
9	ADH1+Kan_BB+pSB1T3	Tet 
10	ADH1+Kan_BB+pSB1AT3	Amp 
11	Tet - Control 		Tet 
12	Chlor - Control 	Chlor

Ran the following Gel:

1	2 	3 	4 	5 	6 	7 	8 
1000bp Ladder	H58 	U58 	H60 	U60 	H62 	U62 	 1000bp

2010/08/24

The following transformations were analyzed

1	H58 			Amp 	 No colonies were observed
2	U58 			Amp 	No colonies were observed 
3	H60 			Amp 	No colonies were observed 
4	U60 			Amp 	No colonies were observed 
5	H62 			Amp 	No colonies were observed 
6	N58+pSB1C3		Chlor 	No colonies were observed 
7	N60+pSB1C3 		Chlor 	No colonies were observed 
8	N64+pSB1C3 		Chlor 	No colonies were observed 
9	ADH1+Kan_BB+pSB1T3	Tet 	A Lawn was observed 
10	ADH1+Kan_BB+pSB1AT3	Amp 	~ 80 colonies were observed with ~ 10% showing a red coloring 
11	Tet - Control 		Tet 	 A Lawn was observed
12	Chlor - Control 	Chlor 	 No colonies were observed

Conclusions:
- The tetracycline plates did not succesfully select for resistance

The following PCR reactions were run using the sigma supplied PCR kit:

		H64 	U64 	H68 	U68 	C68 
Initial Tm	64 	64 	64 	64 	64 
Second Tm	64 	64 	68 	68 	68 
H20	37.5 	37.5 	37.5 	 37.5	42.5 
PCR Buffer	 5	5 	5 	5 	5 
2.5μL Primer 1	 p26	p22 	p26 	p22 	None 
2.5μL Primer 2	 p27 	p23 	p27 	p23 	None 
pSB1AT3 10ng/μL1 	1 	1 	1 	1 
Nucleotide Mix	1 	1 	1 	1 	1 
Taq Polymerase	0.5 	0.5 	0.5 	0.5 	0.5

These reagents were made following the protocol located at ??

The following PCR program was used

1.	94 degC 2:00
2.	94 degC 0:30
3.	Initial Tm 1:00
4.	72 degC 3:30 Go to Step 2 x5
5.	94 degC 0:30
6.	Second Tm 1:00
7.	72 degC 3:30 Go to Step 5 x 30
8.	68 degC 10:00
9.	4 degC overnight

The following digestion was run and Gel Purified:

	 pSB1AT3 x3	 pSB1C3 x3
H20	 37.5		40 
DNA	 5 (102.1ng/μL)	2.5 (197ng/μL)
NEB-3	 5		5 
BSA	 0.5		0.5 
EcoRI	 1		1 
PstI	 1		1

Digestion Program:

1.	37 degC 2:00:00
2.	80 degC 20:00

1		2 	3 	4 	5 		6 		7 
1kb ladder	pSB1C3 	pSB1C3 	pSB1C3 	pSB1AT3 	pSB1AT3 	pSB1AT3

The second shortest band representing the linearized plasmid backbone was cut from each column and gel purified.
Gel purification was conducted using the Sigma kit, the the elution solution was heated to 65 degrees to accommodate the large Linear DNA fragment.
Lanes 2&3 and 4&5 were combined on one column to increase concentration.
All elutions were done with 30 μL in order to increase concentration

Nanodrop results:
- linear pSB1C3 from lane 1: 9.1 ng/uL
- linear concentrated pSB1C3 from lanes 2&3: 8.1 ng/ul
- linear pSB1AT3 from lane 4: 4.1 ng/ul
- linear concentrated pSB1AT3 from lanes 5&6: 5.5 ng/ul

New LB and Amp Plates were Made

The Kan_BB was submitted to sequencing
1μM dilutions of the biobrick primers were made.
The following sequencing reaction was set up for both the forward and reverse primers:

5.3 μL of  37ng/μL Kan_BB DNA
3.2 μL of 1μM plasmid
3.5 μL of H20

2010/08/25

Nanodropped the products of the PCR-1 on 8/24 of the Ura3 and His3 vectors
A blank that underwent the PCR reaction with primers added only after the reaction was run to completion was used.

	ng/μL 	260/280 260/230 
U64	570.1 	1.72 	1.41 
H64	594.6 	1.80 	1.59 
U68	585.3 	1.79 	1.61 
H68	350.9 	1.71 	1.57

The PCR-1 Products were gel Purified

1	1kb Ladder		
2	Ura3 at 64, 64 degC	No PCR Product Formed
3	His3 at 64, 64 degC	Excised ~3.5kb band
4	Ura3 at 64, 68 degC 	No PCR Product Formed
5	His3 at 64, 68 degC	Excised ~3.5kb band
6	Control at 64, 68 degC	The 10ng of template doesn't show up on the gel

Lanes 3 and 5 were gel purified with the sigma kit, in 25 μL elution that was preheated to 65 degC.

	ng/μL 	260/280 	260/230 
H64	16.2	2.35		0.11
H68	32.2	1.93		0.06

12 Kanamycin and 12 tetracycline plates were made

The Following Tranformations were conducted:
- pSB1AT3 was obtained from miniprepped freezer stock, pSB1K3 was obtained from a iGEM well plate

Number	Plasmid 	Plate 
1	pSB1AT3 	Tet 
2	None 		Tet 
3	pSB1AT3 	Amp 
4	None 		Amp 
5	pSB1K3 		Kan 
6	None 		Kan

The Following PCR reactions were let run overnight:

		 1	2 	3 	4 	5 	6 	7 	8 
	 	U64-1	H64-2 	U68-1 	H68-2 	K64	N64 	 K60	 N71
Initial Tm	 64	64 	64 	64 	 64	 64	 60	 68
Second Tm	 64	64 	68 	68 	 64	 64	 64	 71
H20		 37.5	37.5 	37.5 	37.5 	 37.5	 37.5	 37.5	37.5 
PCR Buffer	 5	5 	5 	5 	5 	5 	5 	 5
2.5μL Primer 1	 p22 	 p28	 p22	 p28	 p18	 p20	 p18	 p20
2.5μL Primer 2	 p23	 p29	 p23	 p29	 p19	 p21	 p19	 p21

pSB1AT3 H64-1 pSB1AT3 H68-1 KanMX4 NatMX4 KanMX4 NatMX4

Nucleotide Mix	1 	1 	1 	1 	1 	1 	1 	1 
Taq Polymerase	 0.5	0.5 	0.5 	0.5 	0.5 	0.5 	0.5 	0.5 
Annealing Time	 3:30	3:30 	3:30 	3:30 	3:30 	3:30 	1:00 	1:00

These reagents were made following the protocol located at ??

The following PCR program was used

1.	94 degC 2:00
2.	94 degC 0:30
3.	Initial Tm 1:00
4.	72 degC 3:30 Go to Step 2 x5
5.	94 degC 0:30
6.	Second Tm 1:00
7.	72 degC 3:30 Go to Step 5 x 30
8.	68 degC 10:00
9.	4 degC overnight

3020/08/30

Ligations from 8/26 were transformed into E. coli:

Number 	 Transformation	 Resistance
1	 Negative Amp control		 Ampicillin
2	 Negative Chloramphenicol controlChloramphenicol 
3	 His-64_2 with RFP		 Ampicillin
4	 His-68_2 with RFP    		 Ampicillin         
5	 Kan64 in pSB1C3		 Chloramphenicol
6	 Nat64 in pSB1C3    		 Chloramphenicol
7	 Kan60 in pSB1C3    		 Chloramphenicol
8	 Nat71 in pSB1C3		 Chloramphenicol
9	 kYFP3 in pSB1C3		 Chloramphenicol

Made new LB Amp plates

2010/09/02

Analyzed results of transformation from 8/30

Number 	 Transformation	 Resistance	 Results
1	 Negative Amp control			 Ampicillin		 No colonies
2	 Negative Chloramphenicol control	Chloramphenicol 	 No colonies
3	 His-64_2 with RFP			 Ampicillin	 	Three groups of ~ 150 colonies, no red colonies
4	 His-68_2 with RFP    			 Ampicillin         	3 colonies- 1 large red one
5	 Kan64 in pSB1C3			 Chloramphenicol	 12 colonies
6	 Nat64 in pSB1C3    			 Chloramphenicol	 ~70 colonies
7	 Kan60 in pSB1C3    			 Chloramphenicol	 14 colonies
8	 Nat71 in pSB1C3			 Chloramphenicol	 6 colonies- 1 red coloniy
9	 kYFP3 in pSB1C3			 Chloramphenicol	 lawn of red colonies

2010/09/06

Ran the following Colony PCR Reactions and plated the colonies onto a plate.

1.	K60-1
2.	K60-2
3.	K60-3
4.	K60-4
5.	K60-5
6.	K64-1
7.	K64-2
8.	K64-3
9.	K64-4
10.	K64-5
11.	N64-1
12.	N64-1
13.	N64-3
14.	N64-4
15.	N64-5
16.	N71-1
17.	N71-2
18.	N72-3
19.	N72-4
20.	N72-5
21.	SxL_BB-1
22.	SxL_BB-1

Reactions 1-20 were run using the following PCR mix form the Sigma Kit:

37.5 μL H20
5μL PCR Buffer
1μL DNucleotides
0.5μL Taq polymerase
2.5μL p30
2.5μL p31

Reactions 21 and 22 were run using the following PCR mix from the Sigma Kit:

37.5 μL H20
5μL PCR Buffer
1μL DNucleotides
0.5μL Taq polymerase
2.5μL p36
2.5μL p37

All of the PCR reactions were run with annealing temperatures of 67 &deg C.

The PCR reactions were then loaded onto a gel in the following order with 100bp ladders

1	2 	3 	4 	5 	6 	7 	8 	9 	10 	11 	12 	13 	14 	15 
Lad.	1 	2 	3 	4 	5 	6 	Lad. 	7 	8 	9 	10 	11 	12 	Lad

1	2 	3 	4 	5 	6 	7 	8 	9 	10	11 	12 	13 	14 	15 
Lad	13 	14 	15 	16 	16 	17 	Lad 	18 	20 	21 	22 	Lad

PCR reaction 16 was accidently loaded onto the gel twice. Lower lanes 7 and 8 may be shifted to contain PCR mix 19 instead of 17 or 18, so they should be treated with suspicious.

Expected Results:
- Expected Results =gene length +316 for the flanking regions between primers and insert
- Lanes U2-U12 will run at 810+316=1126
- Lanes U13-L10 will run at 573+316=889
- Lanes U11, U12 will run at 1000+316=1316

The gels were observed using a handheld UV light and 4 different banding patterns were observed.
- Pattern A: No Banding observed
- Pattern B: A band right below the second highest band (1,200bp)
- Pattern C: Well flouresced

1	2 	3 	4 	5 	6 	7 	8 	9 	10 	11 	12 	13 	14 	15 
Lad	A 	B 	A 	B 	B 	A 	B 	Lad 	A 	A 	B 	A 	A 	Lad

1	2 	3 	4 	5 	6 	7 	8 	9 	10 	11 	12 	13 	14 	15 
Lad	A 	C Smear	A 	A 	A 	A 	Lad 	A 	C 	C 	A 	Lad

2010/09/10

The colonies plated from the colony PCR on monday were mistakenly plated onto an Amp plate so no growth or viable colonies were observed.
The following colony PCR was run.

1.	K60-1
2.	K60-2
3.	K60-3
4.	K60-4
5.	K60-5
6.	N64-1
7.	N64-2
8.	N64-3
9.	N64-4
10.	N64-5
11.	N71-1
12.	N71-2
13.	N71-3
14.	N71-4
15.	N71-5

The following PCR master mix was made using the Sigma kit then used with reaction volumes of 30μL.

392.7μL H20
51μL Buffer
10.2μL dNTP
25.5μL p30
25.5μL p31
5.1μL Taq

2010/09/11

A PCR was run on U64-1 and U68-1 Using p24, p25 and the PCR Master Mix that was previously made from the sigma kit. *The following program was used

1.	1:00 94 degC
2.	0:30 94 degC
3.	1:00 64 degC
4.	3:30 72 degC GoTo 2 4X
5.	0:30 94 degC
6.	3:30 68 degC GoTo 5 29X
7.	10:00 72 degC
8.	Forever 4 degC

A Gel was run with the Colony PCR samples from 9/10.
The gel was made with 8ml 5XTBE in 40 ml Water and 0.4g Agarose and 0.8μL EtBr
10μL were loaded into each lane and a 100bp Ladder was used.
The lanes of the gel are as follows

1	2 	3 	4 	5 	6	7 	8 	9 	10 	11 	12 	13 	14 	15 
Lad	K60-1 	K60-2 	K60-3 	K60-4	K60-5	N64-1	N64-2	N64-3	N64-4	N71-1	N71-2	N71-3	N71-4	Lad

Expected Results:
- Expected Results =gene length +316 for the flanking regions between primers and insert
- Lanes 2-6 will run at 810+316=1126
- Lanes 7-14 will run at 573+316=889

Results:

1.	Ladder
2.	11,000bp fragment, birght
3.	11,000bp fragment
4.	11,000bp fragment bright
5.	300bp fragment
6.	300bp fragment
7.	550bp fragment
8.	400bp fragment
9.	500bp fragment
10.	13,000-14,000bp fragment, faint
11.	200bp fragment
12.	200bp fragment
13.	200bp fragment
14.	200bp fragment
15.	Ladder

Overnight Cultures were made of lanes 2 and 10 which corresponded to K60-1 and N64-4

2010/09/16

A PCR was run on SxL in order to create SxL_BB
A stock solution of the SxL construct sent by Mr. Gene was made a 10ng/µL
The PCR was made using 44µL of the master mix made from the sigma kit
2.5 µL of p36 and p37 were used
The following program was let run

1.	94 degC 3:00
2.	94 degC 0:30
3.	62 degC 0:30
4.	72 degC 1:00 GOTO 2 x5
5.	94 degC 0:30
6.	68 degC 1:30 GOTO 5 x30
7.	72 degC 10:00
8.	4 degC

2010/09/18

A PCR was run on NatMX4 in order to make Nat_BB
The following reagents were used

44µL PCR master mix made from sigma ket
2.5µL 10µM p20
2.5µL 10µM p21
1µL 10ng/µL NatMX4

The following conditions were used:

1.	94 degC 3:00
2.	94 degC 0:30
3.	66 degC 0:30
4.	72 degC 1:00 GOTO 2 x5
5.	94 degC 0:30
6.	71 degC 1:15 GOTO 5 x30
7.	72 degC 10:00
8.	4 degC forever

A Colony PCR on H_Vector was run
p30 and p31 primers are expected to give a band of 1000bp if RFP was inserted and 330 if nothing was inserted
p30 and p40 are expected to give a band of 2000bp if RFP was inserted and 1320 if nothing was inserted

@@ Line 1: / Line 1: @@
 {{WashUHeader}}
-==Week of 8/9==
+==2010/08/12==
-===8/12===
+*Ordered the following primers to biobrick parts
-	Ordered the following primers to biobrick parts
   p18	Forward KanMX4	ATT CTT AGA ATT CGC GGC CGC TTC TAG CCC GCC GCC ACC ATG GGT AAG GAA AAG ACT CAC GTT TCG
   p19	Reverse KanMX4	GCC GCC CTC TGC AGC GGC CGC TAC TAG TAT TAG AAA AAC TCA TCG AGC ATC AAA TGA AAC TG
@@ Line 26: / Line 25: @@
   p39	Vector internal Sequencing 2 - Reverse 1523 start	GAAGTGGCGAGCCCGATCTTC
   p40	Vector internal Sequencing 3 2301 start	CCACCTCGACCTAACTCGAGTTAC
-==Week of 8/16==
+<br>
-===8/19===
+==2010/08/19==
-The following PCr reactions were run and then column Purified.
+*The following PCr reactions were run and then column Purified.
   Number	Product 	Template	Forward Primer 	Reverse Primer 	 Temperature
 	Kan BB 		KanMX4 		p18 		p19 		58
@@ Line 37: / Line 36: @@
 	Nat BB 		NatMX4 		p20 		p21 		64
-The following digestions of were run.
+*The following digestions of were run.
   	K58 	N58 	K60 	N60 	K64 	N64 	P1
@@ Line 46: / Line 45: @@
   EcoRI	1 	1 	1 	1 	1 	1 	1
   PstI	1 	1 	1 	1 	1 	1 	1
-The digestions were run for 6 hours at 27 degC and then kept at 4 degC o/n
+*The digestions were run for 6 hours at 27 degC and then kept at 4 degC o/n
+*Made Chloramphenicol Plates at a concentration of 34μg/ml
-Made Chloramphenicol Plates at a concentration of 34μg/ml
+<br>
 ==2010/08/21==
 *The ligation reactions (KFYP3, KYFP4,KYFP5, - control, + control) were transformed and plated onto amp plates.
+*Transformation Results
-Biobrick Group
-Transformation Results
   Plate		Result
 . K58&p1	2 colonies formed, one on the edge of the plate pointing towards a possible satellite colony
@@ Line 64: / Line 61: @@
   pSB1C3	 	~30 colonies formed with slght red coloring at the center
+*Over Night Colonies prepared from
-Over Night Colonies prepared from
   K58&p1 colony from middle of plate	34μg/ml chloramphenicol liquid media
   pSB1AT3				50μg/ml Amp liquid media
   pSB1C3					34μg/ml chloramphenicol liquid media
+<br>
-===8/22===
+==2010/08/22==
-Miniprepped the following from overnight cultures made on 8/21/10:
+*Miniprepped the following from overnight cultures made on 8/21/10:
   DNA				Concentration (ng/μl)	260/280 	20/230
   Kan BB in pSB1C3 		 37.8			1.92		2.15
@@ Line 78: / Line 74: @@
-The following PCR reaction was run with an elongation time of 3.5 minutes:
+*The following PCR reaction was run with an elongation time of 3.5 minutes:
   Number	Product 	Template 	Forward Primer 		Reverse Primer 		Annealing Temperature
 	His3 Intermediate Vector	pSB1AT3 w/ insert	 p27		p29 	 58
@@ Line 87: / Line 83: @@
 	Ura3 intermediate Vector	pSB1AT3 w/ insert	 p23		p25 	 62
-The following Digestion was run:
+*The following Digestion was run:
   	 pSB1C3 w/ insert
   H20	 40
@@ Line 96: / Line 92: @@
   PstI	 1
+*The following Gel was run:
-The following Gel was run:
 1kb Ladder
 H58 intermediate
@@ Line 106: / Line 101: @@
 U62 intermediate
 pSB1C3 Digestion product
-[[Image:WashU8-22Gel.jpg|400px]]
+<center>[[Image:WashU8-22Gel.jpg|400px]]</center>
-The gel was cut and the products were gel purified using the Sigma Kit
+*The gel was cut and the products were gel purified using the Sigma Kit
-The following PCR reaction was let run over night with an elongation time of 3.5 minutes:
+*The following PCR reaction was let run over night with an elongation time of 3.5 minutes:
   Number	Product 		Template 			Forward Primer 	Reverse Primer 	Annealing Temperature
 	His3 Final Vector	 H58 Intermediate Vector	 p27		p29 	 	58
@@ Line 118: / Line 113: @@
 	His3 Final Vector	 H62 Intermediate Vector	 p27		p29 	 	62
 	Ura3 Final Vector	 U62 Intermediate Vector	 p23		p25 	 	62
+<br>
-==Week of 8/23==
+==2010/08/23==
-===8/23===
+*Nanodropped Over night PCR product:
-Nanodropped Over night PCR product:
   Number	Label 	Concentration ng/μL 	260/280 	260/230
 	H58 	10.2 	2.34 	1.22
@@ Line 130: / Line 123: @@
 	H62 	7.4 	2.00 	1.18
 	H62 	0.4 	-0.65 	0.17
+*Preformed the following digestions at 37 degC for 2 hours and heat inactivation at 80 degC for 20 minutes:
-Preformed the following digestions at 37 degC for 2 hours and heat inactivation at 80 degC for 20 minutes:
   	H58 	U58 	H60 	U60 	H62 	 pSB1C3 w/ insert	ADH1 Promoter 	Kan_BB 	Linear pSB1T3	pSB1AT3 w/ insert
   H20	 12.5	12.5 	12.5 	12.5 	12.5 	 40	 40	29.3 	32.5	335.6
@@ Line 145: / Line 136: @@
 μL E4	 	 	 	 	 	 	 	 	 	 SpeI
-Preformed the following ligations following the Biobrick Manual Protocol
+*Preformed the following ligations following the Biobrick Manual Protocol
   	H58 	U58 	H60 	U60 	H62 	AHD1+K_BB+pSB1T3	ADH1+K_BB+pSB1AT3
   H20	 11 	11 	11 	11 	11 	11 	11
@@ Line 154: / Line 145: @@
   T4 DNA Ligase	1 	1 	1 	1 	1 	1 	1 	1
+*Preformed the following transformations:
-Preformed the following transformations:
 	H58 			Amp
 	U58 			Amp
@@ Line 169: / Line 159: @@
 	Chlor - Control 	Chlor
-Ran the following Gel:
+*Ran the following Gel:
 	2 	3 	4 	5 	6 	7 	8
 bp Ladder	H58 	U58 	H60 	U60 	H62 	U62 	 1000bp
-[[Image:WashU_8-23Gel.jpg|400px]]
+<center>[[Image:WashU_8-23Gel.jpg|400px]]</center>
+<br>
-===8/24===
+==2010/08/24==
+*The following transformations were analyzed
-Biobrick Group
-The following transformations were analyzed
 	H58 			Amp 	 No colonies were observed
 	U58 			Amp 	No colonies were observed
@@ Line 193: / Line 181: @@
 	Chlor - Control 	Chlor 	 No colonies were observed
-Conclusions:
+*Conclusions:
-.	The tetracycline plates did not succesfully select for resistance
+**The tetracycline plates did not succesfully select for resistance
-The following PCR reactions were run using the sigma supplied PCR kit:
+*The following PCR reactions were run using the sigma supplied PCR kit:
   		H64 	U64 	H68 	U68 	C68
   Initial Tm	64 	64 	64 	64 	64
@@ Line 208: / Line 196: @@
   Taq Polymerase	0.5 	0.5 	0.5 	0.5 	0.5
-These reagents were made following the protocol located at here
+*These reagents were made following the protocol located at ??
-The following PCR program was used
+*The following PCR program was used
 .	94 degC 2:00
 .	94 degC 0:30
 .	Initial Tm 1:00
 .	72 degC 3:30 Go to Step 2 x5
 .	94 degC 0:30
 .	Second Tm 1:00
 .	72 degC 3:30 Go to Step 5 x 30
 .	68 degC 10:00
 .	4 degC overnight
-The following digestion was run and Gel Purified:
+*The following digestion was run and Gel Purified:
   	 pSB1AT3 x3	 pSB1C3 x3
   H20	 37.5		40
@@ Line 230: / Line 218: @@
   PstI	 1		1
-Digestion Program:
+*Digestion Program:
 .	37 degC 2:00:00
 .	80 degC 20:00
-[[Image:WashU_8-24Gel.jpg|400px]]
+<center>[[Image:WashU_8-24Gel.jpg|400px]] </center>
 		2 	3 	4 	5 		6 		7
 kb ladder	pSB1C3 	pSB1C3 	pSB1C3 	pSB1AT3 	pSB1AT3 	pSB1AT3
-The second shortest band representing the linearized plasmid backbone was cut from each column and gel purified.  Gel purification was conducted using the Sigma kit, the the elution solution was heated to 65 degrees to accommodate the large Linear DNA fragment.  Lanes 2&3 and 4&5 were combined on one column to increase concentration.  All elutions were done with 30 μL in order to increase concentration
-Nanodrop results:
+*The second shortest band representing the linearized plasmid backbone was cut from each column and gel purified.
+*Gel purification was conducted using the Sigma kit, the the elution solution was heated to 65 degrees to accommodate the large Linear DNA fragment.
+*Lanes 2&3 and 4&5 were combined on one column to increase concentration.
+*All elutions were done with 30 μL in order to increase concentration
-linear pSB1C3 from lane 1: 9.1 ng/uL
+*Nanodrop results:
-linear concentrated pSB1C3 from lanes 2&3: 8.1 ng/ul
+**linear pSB1C3 from lane 1: 9.1 ng/uL
-linear pSB1AT3 from lane 4: 4.1 ng/ul
+**linear concentrated pSB1C3 from lanes 2&3: 8.1 ng/ul
-linear concentrated pSB1AT3 from lanes 5&6: 5.5 ng/ul
+**linear pSB1AT3 from lane 4: 4.1 ng/ul
+**linear concentrated pSB1AT3 from lanes 5&6: 5.5 ng/ul
-New LB and Amp Plates were Made
+*New LB and Amp Plates were Made
-The Kan_BB was submitted to sequencing
+*The Kan_BB was submitted to sequencing
-μM dilutions of the biobrick primers were made.  The following sequencing reaction was set up for both the forward and reverse primers:
+*1μM dilutions of the biobrick primers were made.
-.3 μL of  37ng/μL Kan_BB DNA
+*The following sequencing reaction was set up for both the forward and reverse primers:
-.2 μL of 1μM plasmid
+.3 μL of  37ng/μL Kan_BB DNA
-.5 μL of H20
+.2 μL of 1μM plasmid
+.5 μL of H20
-===8/25===
+==2010/08/25==
-Nanodropped the products of the PCR-1 on 8/24 of the Ura3 and His3 vectors
+*Nanodropped the products of the PCR-1 on 8/24 of the Ura3 and His3 vectors
-A blank that underwent the PCR reaction with primers added only after the reaction was run to completion was used.
+*A blank that underwent the PCR reaction with primers added only after the reaction was run to completion was used.
   	ng/μL 	260/280 260/230
   U64	570.1 	1.72 	1.41
@@ Line 264: / Line 256: @@
   H68	350.9 	1.71 	1.57
-The PCR-1 Products were gel Purified
+*The PCR-1 Products were gel Purified
 	1kb Ladder
 	Ura3 at 64, 64 degC	No PCR Product Formed
@@ Line 272: / Line 264: @@
 	Control at 64, 68 degC	The 10ng of template doesn't show up on the gel
-Lanes 3 and 5 were gel purified with the sigma kit, in 25 μL elution that was preheated to 65 degC.
+*Lanes 3 and 5 were gel purified with the sigma kit, in 25 μL elution that was preheated to 65 degC.
   	ng/μL 	260/280 	260/230
   H64	16.2	2.35		0.11
   H68	32.2	1.93		0.06
-Kanamycin and 12 tetracycline plates were made
+*12 Kanamycin and 12 tetracycline plates were made
-The Following Tranformations were conducted:
+*The Following Tranformations were conducted:
-pSB1AT3 was obtained from miniprepped freezer stock, pSB1K3 was obtained from a iGEM well plate
+**pSB1AT3 was obtained from miniprepped freezer stock, pSB1K3 was obtained from a iGEM well plate
   Number	Plasmid 	Plate
 	pSB1AT3 	Tet
@@ Line 290: / Line 281: @@
 	None 		Kan
-The Following PCR reactions were let run overnight:
+*The Following PCR reactions were let run overnight:
 	2 	3 	4 	5 	6 	7 	8
   	 	U64-1	H64-2 	U68-1 	H68-2 	K64	N64 	 K60	 N71
@@ Line 305: / Line 295: @@
   Annealing Time	 3:30	3:30 	3:30 	3:30 	3:30 	3:30 	1:00 	1:00
-These reagents were made following the protocol located at here
+*These reagents were made following the protocol located at ??
-The following PCR program was used
+*The following PCR program was used
 .	94 degC 2:00
 .	94 degC 0:30
@@ Line 317: / Line 307: @@
 .	68 degC 10:00
 .	4 degC overnight
+<br>
-==Week of 8/30==
+==3020/08/30==
-===8/30===
+*Ligations from 8/26 were transformed into E. coli:
-Ligations from 8/26 were transformed into E. coli:
+ Number 	 Transformation	 Resistance
-Number 	 Transformation	 Resistance
 	 Negative Amp control		 Ampicillin
 	 Negative Chloramphenicol controlChloramphenicol
@@ Line 332: / Line 321: @@
 	 kYFP3 in pSB1C3		 Chloramphenicol
-Made new LB  Amp plates
+*Made new LB  Amp plates
+<br>
-===9/2===
+==2010/09/02==
-Analyzed results of transformation from 8/30
+*Analyzed results of transformation from 8/30
-Number 	 Transformation	 Resistance	 Results
+ Number 	 Transformation	 Resistance	 Results
 	 Negative Amp control			 Ampicillin		 No colonies
 	 Negative Chloramphenicol control	Chloramphenicol 	 No colonies
@@ Line 346: / Line 335: @@
 	 Nat71 in pSB1C3			 Chloramphenicol	 6 colonies- 1 red coloniy
 	 kYFP3 in pSB1C3			 Chloramphenicol	 lawn of red colonies
+<br>
-==Week of 9/6==
+==2010/09/06==
-===9/6===
+*Ran the following Colony PCR Reactions and plated the colonies onto a plate.
-Ran the following Colony PCR Reactions and plated the colonies onto a plate.
 .	K60-1
 .	K60-2
@@ Line 372: / Line 360: @@
 .	SxL_BB-1
 .	SxL_BB-1
-Reactions 1-20 were run using the following PCR mix form the Sigma Kit:
+*Reactions 1-20 were run using the following PCR mix form the Sigma Kit:
 .5 μL H20
 μL PCR Buffer
@@ Line 379: / Line 368: @@
 .5μL p30
 .5μL p31
-Reactions 21 and 22 were run using the following PCR mix from the Sigma Kit:
+*Reactions 21 and 22 were run using the following PCR mix from the Sigma Kit:
 .5 μL H20
 μL PCR Buffer
@@ Line 386: / Line 376: @@
 .5μL p36
 .5μL p37
-All of the PCR reactions were run with annealing temperatures of 67 degC.
-The PCR reactions were then loaded onto a gel in the following order with 100bp ladders
+*All of the PCR reactions were run with annealing temperatures of 67 &deg C.
+*The PCR reactions were then loaded onto a gel in the following order with 100bp ladders
 	2 	3 	4 	5 	6 	7 	8 	9 	10 	11 	12 	13 	14 	15
   Lad.	1 	2 	3 	4 	5 	6 	Lad. 	7 	8 	9 	10 	11 	12 	Lad
@@ Line 395: / Line 386: @@
   Lad	13 	14 	15 	16 	16 	17 	Lad 	18 	20 	21 	22 	Lad
-PCR reaction 16 was accidently loaded onto the gel twice.  Lower lanes 7 and 8 may be shifted to contain PCR mix 19 instead of 17 or 18, so they should be treated with suspicious.
+*PCR reaction 16 was accidently loaded onto the gel twice.  Lower lanes 7 and 8 may be shifted to contain PCR mix 19 instead of 17 or 18, so they should be treated with suspicious.
-Expected Results
+*Expected Results:
+**Expected Results =gene length +316 for the flanking regions between primers and insert
+**Lanes U2-U12 will run at 810+316=1126
+**Lanes U13-L10 will run at 573+316=889
+**Lanes U11, U12 will run at 1000+316=1316
-Expected Results =gene length +316 for the flanking regions between primers and insert
+*The gels were observed using a handheld UV light and 4 different banding patterns were observed.
-Lanes U2-U12 will run at 810+316=1126
+**Pattern A: No Banding observed
-Lanes U13-L10 will run at 573+316=889
+**Pattern B: A band right below the second highest band (1,200bp)
-Lanes U11, U12 will run at 1000+316=1316
+**Pattern C: Well flouresced
-The gels were observed using a handheld UV light and 4 different banding patterns were observed.
-Pattern A: No Banding observed
-Pattern B: A band right below the second highest band (1,200bp)
-Pattern C: Well flouresced
 	2 	3 	4 	5 	6 	7 	8 	9 	10 	11 	12 	13 	14 	15
   Lad	A 	B 	A 	B 	B 	A 	B 	Lad 	A 	A 	B 	A 	A 	Lad
@@ Line 413: / Line 403: @@
 	2 	3 	4 	5 	6 	7 	8 	9 	10 	11 	12 	13 	14 	15
   Lad	A 	C Smear	A 	A 	A 	A 	Lad 	A 	C 	C 	A 	Lad
+<br>
-===9/10===
+==2010/09/10==
-The colonies plated from the colony PCR on monday were mistakenly plated onto an Amp plate so no growth or viable colonies were observed.
+*The colonies plated from the colony PCR on monday were mistakenly plated onto an Amp plate so no growth or viable colonies were observed.
-The following colony PCR was run.
+*The following colony PCR was run.
 .	K60-1
 .	K60-2
@@ Line 432: / Line 422: @@
 .	N71-4
 .	N71-5
-The following PCR master mix was made using the Sigma kit then used with reaction volumes of 30μL.
+*The following PCR master mix was made using the Sigma kit then used with reaction volumes of 30μL.
 .7μL H20
 μL Buffer
@@ Line 439: / Line 429: @@
 .5μL p31
 .1μL Taq
+<br>
-===9/11===
+==2010/09/11==
-A PCR was run on U64-1 and U68-1 Using p24, p25 and the PCR Master Mix that was previously made from the sigma kit.  The following program was used
+*A PCR was run on U64-1 and U68-1 Using p24, p25 and the PCR Master Mix that was previously made from the sigma kit.  *The following program was used
 .	1:00 94 degC
 .	0:30 94 degC
@@ Line 450: / Line 440: @@
 .	10:00 72 degC
 .	Forever 4 degC
-A Gel was run with the Colony PCR samples from 9/10.
+*A Gel was run with the Colony PCR samples from 9/10.
-The gel was made with 8ml 5XTBE in 40 ml Water and 0.4g Agarose and 0.8μL EtBr
+*The gel was made with 8ml 5XTBE in 40 ml Water and 0.4g Agarose and 0.8μL EtBr
-μL were loaded into each lane and a 100bp Ladder was used.
+*10μL were loaded into each lane and a 100bp Ladder was used.
-The lanes of the gel are as follows
+*The lanes of the gel are as follows
 	2 	3 	4 	5 	6	7 	8 	9 	10 	11 	12 	13 	14 	15
   Lad	K60-1 	K60-2 	K60-3 	K60-4	K60-5	N64-1	N64-2	N64-3	N64-4	N71-1	N71-2	N71-3	N71-4	Lad
-Expected Results
+*Expected Results:
+**Expected Results =gene length +316 for the flanking regions between primers and insert
+**Lanes 2-6 will run at 810+316=1126
+**Lanes 7-14 will run at 573+316=889
-Expected Results =gene length +316 for the flanking regions between primers and insert
+*Results:
-Lanes 2-6 will run at 810+316=1126
-Lanes 7-14 will run at 573+316=889
-Results
 .	Ladder
 .	11,000bp fragment, birght
@@ Line 479: / Line 468: @@
 .	200bp fragment
 .	Ladder
-Overnight Cultures were made of lanes 2 and 10 which corresponded to K60-1 and N64-4
+*Overnight Cultures were made of lanes 2 and 10 which corresponded to K60-1 and N64-4
+<br>
-==Week of 9/13==
+==2010/09/16==
+*A PCR was run on SxL in order to create SxL_BB
-===Week of 9/16===
+*A stock solution of the SxL construct sent by Mr. Gene was made a 10ng/µL
+*The PCR was made using 44µL of the master mix made from the sigma kit
-A PCR was run on SxL in order to create SxL_BB
+*2.5 µL of p36 and p37 were used
-A stock solution of the SxL construct sent by Mr. Gene was made a 10ng/µL
+*The following program was let run
-The PCR was made using 44µL of the master mix made from the sigma kit
-.5 µL of p36 and p37 were used
-The following program was let run
 .	94 degC 3:00
 .	94 degC 0:30
@@ Line 500: / Line 485: @@
 .	72 degC 10:00
 .	4 degC
+<br>
-===Week of 9/18===
+==2010/09/18==
-A PCR was run on NatMX4 in order to make Nat_BB
+*A PCR was run on NatMX4 in order to make Nat_BB
-The following reagents were used
+*The following reagents were used
 µL PCR master mix made from sigma ket
 .5µL 10µM p20
 .5µL 10µM p21
 µL 10ng/µL NatMX4
-The following conditions were used:
+*The following conditions were used:
 .	94 degC 3:00
 .	94 degC 0:30
@@ Line 517: / Line 502: @@
 .	72 degC 10:00
 .	4 degC forever
-A Colony PCR on H_Vector was run
+*A Colony PCR on H_Vector was run
-p30 and p31 primers are expected to give a band of 1000bp if RFP was inserted and 330 if nothing was inserted
+*p30 and p31 primers are expected to give a band of 1000bp if RFP was inserted and 330 if nothing was inserted
-p30 and p40 are expected to give a band of 2000bp if RFP was inserted and 1320 if nothing was inserted
+*p30 and p40 are expected to give a band of 2000bp if RFP was inserted and 1320 if nothing was inserted