Team:Korea U Seoul/Notebook

From 2010.igem.org

(Difference between revisions)
(Lab book)
([ Digestion ] 2010-10-01 ~ 2010-10-03)
 
(98 intermediate revisions not shown)
Line 1: Line 1:
-
<!-- *** What falls between these lines is the Alert Box!  You can remove it from your pages once you have read and understood the alert *** -->
+
{{KUmenu}}
-
 
+
<html>
<html>
-
<div id="box" style="width: 700px; margin-left: 137px; padding: 5px; border: 3px solid #000; background-color: #fe2b33;">
+
<style type="text/css">
-
<div id="template" style="text-align: center; font-weight: bold; font-size: large; color: #f6f6f6; padding: 5px;">
+
table.calendar          { margin: 0; padding: 2px; }
-
This is a template page. READ THESE INSTRUCTIONS.
+
table.calendar td      { margin: 0; padding: 1px; vertical-align: top;}
-
</div>
+
table.month .heading td { width:300px;padding:1px; background-color:#d0d0d0 ; bordr: 1px ;
-
<div id="instructions" style="text-align: center; font-weight: normal; font-size: small; color: #f6f6f6; padding: 5px;">
+
color: white ; text-align:center; font-size:140%; font-weight:bold; }
-
You are provided with this team page template with which to start the iGEM season.  You may choose to personalize it to fit your team but keep the same "look." Or you may choose to take your team wiki to a different level and design your own wiki.  You can find some examples <a href="https://2008.igem.org/Help:Template/Examples">HERE</a>.
+
table.month .dow td    { color:gray; text-align:center; font-size:100%; }
-
</div>
+
table.month td.today    { background-color:gray;}
-
<div id="warning" style="text-align: center; font-weight: bold; font-size: small; color: #f6f6f6; padding: 5px;">
+
table.month td {
-
You <strong>MUST</strong> have a team description page, a project abstract, a complete project description, a lab notebook, and a safety page. PLEASE keep all of your pages within your teams namespace.   
+
    border: none;
-
</div>
+
    margin: 0;
-
</div>
+
    padding: 0pt 0.5pt;
 +
    font-weight: bold;
 +
    font-size: 9pt;
 +
    text-align: right;
 +
    background-color: white;
 +
    }
 +
#bodyContent table.month a { background:none; padding:0 }
 +
.day-active { color:black }
 +
.day-empty { color:#d0d0d0 }
 +
 
 +
</style>  
</html>
</html>
 +
<div id="yong">
 +
<!--- The Mission, Experiments --->
-
<!-- *** End of the alert box *** -->
+
='''Brain storming & Work notes'''=
 +
Click on a date to see notes on the meeting & summary of labwork done on that day.
 +
 
 +
 
 +
{| align="center"
 +
|-valign="top"
 +
|align="center" width="150pt"|{{#calendar: title=Korea_U_Seoul |year=2010 | month=06}}
 +
|align="center" width="150pt"|{{#calendar: title=Korea_U_Seoul |year=2010 | month=07}}
 +
|align="center" width="150pt"|{{#calendar: title=Korea_U_Seoul |year=2010 | month=08}}
 +
|align="center" width="150pt"|{{#calendar: title=Korea_U_Seoul |year=2010 | month=09}}
 +
|align="center" width="150pt"|{{#calendar: title=Korea_U_Seoul |year=2010 | month=10}}
 +
|}
 +
<br>
 +
='''Experimental notes'''=
 +
== [Discussion] 2010-08-02 ~ 2010-08-29 ==
 +
<br/>
 +
1. Strategy and overview of iGEM 2010 experiment
 +
[[Image:Kuprojectmain.png]]
-
{|align="justify"
+
2. Design of primers
-
|You can write a background of your team here.  Give us a background of your team, the members, etc.  Or tell us more about something of your choosing.
+
<br/>
-
|[[Image:Korea_U_Seoul_logo.png|200px|right|frame]]
+
<br/>
 +
{| border="2"
 +
!Primer
 +
!Sequence ( 5’ → 3’ )
|-
|-
-
|
+
|PyodA(''Eco''RI)_F
-
''Tell us more about your project.  Give us background.  Use this is the abstract of your project.  Be descriptive but concise (1-2 paragraphs)''
+
|CCGGAATTCCTTCATATTGCCGACAAAGTACG
-
|[[Image:Korea_U_Seoul_team.png|right|frame|Your team picture]]
+
|-
|-
-
|
+
|mAAA(''Spe''I)_R
-
|align="center"|[[Team:Korea_U_Seoul | Team Example]]
+
|GGACTAGTTTATCACAGGGGCCGTCCG
 +
|-
 +
|PzntA(''Xba''I)_F
 +
|GCTCTAGACGTCCGCTCGCTGTATCTC
 +
|-
 +
|RFP(''Pst''I)_R
 +
|AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
 +
|-
 +
|ParsR(''Xba''I)_F
 +
|GCTCTAGACCAACTCAAAATTCACACCTATTAC
 +
|-
 +
|GFP(''Pst''I)_R
 +
|AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC
|}
|}
-
<!--- The Mission, Experiments --->
+
== [ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03 ==
 +
<br/>
 +
1. Inoculation of ''E. coli'' DH5α and ''E. coli'' BL21(DE3) to 3mL LB broth
-
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
+
2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively
-
!align="center"|[[Team:Korea_U_Seoul|Home]]
+
-
!align="center"|[[Team:Korea_U_Seoul/Team|Team]]
+
-
!align="center"|[https://igem.org/Team.cgi?year=2010&team_name=Korea_U_Seoul Official Team Profile]
+
-
!align="center"|[[Team:Korea_U_Seoul/Project|Project]]
+
-
!align="center"|[[Team:Korea_U_Seoul/Parts|Parts Submitted to the Registry]]
+
-
!align="center"|[[Team:Korea_U_Seoul/Modeling|Modeling]]
+
-
!align="center"|[[Team:Korea_U_Seoul/Notebook|Notebook]]
+
-
!align="center"|[[Team:Korea_U_Seoul/Safety|Safety]]
+
-
|}
+
 +
3. Inoculation of subcultured ''E. coli'' to 200mL 2x LB borth
-
==Lab book==
+
4. Preparation of competent cells by CSBL laboratory protocol
 +
5. Transformation of pUC19 plasmid(10ng/μL) to competent cells for transformation efficiency check
 +
 +
<br/>
 +
<br/>
 +
== [ Transformation efficiency ] 2010-09-04 ==
 +
<br/>
<center>
<center>
-
{|style="vertical-align:top;" cellpadding=4
+
{| border="2"
 +
! Strain
 +
! Number of colonies (colonies/μg DNA)
|-
|-
-
|style="vertical-align:top;"|{{#calendar: title=Team:Korea_U_Seoul |year=2010 | month=06}}
+
|''E. coli'' DH5α
-
|-
+
|Number of colonies (colonies/μg DNA)
-
|style="vertical-align:top;"|{{#calendar: title=Team:Korea_U_Seoul |year=2010 | month=07}}
+
|-
|-
 +
|''E. coli'' BL21(DE3)
 +
|1.5 x 105
|}
|}
</center>
</center>
 +
<br/>
 +
<br/>
 +
== [ Amplification of BioBrick parts : pSB1A2 and pSB1C3 ] 2010-09-05 ==
 +
<br/>
 +
1. Confirmed location : pSB1A2-BBa_E0040 (2010 Kit plate 1/ 14K) and pSB1C3-BBa_J04450 (2010 Kit plate 1/ 3A)
-
{{Team:Newcastle/footer}}
+
2. 20uL suspension by autoclaved distilled water
 +
 
 +
3. 3uL transformation to ''E. coli'' DH5α
 +
 
 +
4. Plating to LB(Amp100), LB(Cm25)
 +
<br/>
 +
<br/>
 +
== [ Genomic DNA extraction ] 2010-09-06 ==
 +
<br/>
 +
1. Inoculation for plasmid DNA purification
 +
 
 +
2. ''E. coli'' K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit
 +
 
 +
3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)
 +
 
 +
4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL
 +
 
 +
 
 +
[[Image:Real_figure_1.jpg|left|140px|frame|figure1. lane1;M-lane2;''E. coli'' K12 genomic DNA extraction]]
 +
 
 +
 
 +
<br><br><br><br><br><br><br><br><br>br>
 +
<br><br><br><br><br><br><br><br><br><br>
 +
<br><br><br><br><br><br><br><br><br><br>
 +
<br><br><br><br><br><br><br><br><br><br>
 +
 
 +
== [ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07==
 +
<br/>
 +
1. Plasmid miniprep by LaboPass™ Plasmid Mini (Plasmid DNA purification kit)
 +
 
 +
2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 2)
 +
 
 +
3. Quantification of DNA concentration by NanoDrop
 +
[[Image:Figure1_실험.png‎ |250px|left|frame|figure2.'''lane1;M-lane2;pSB1A2-lane3;pSB1C3''']]
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<br><br>
 +
<br><br><br>
 +
<br>
 +
<br><br>
 +
<br>
 +
<br><br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
== [ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16==
 +
<br/>
 +
1. PCR : PyodA-mAAA, PzntA-RFP(BBa_E1010) and ParsR-GFP(BBa_E0040)
 +
<br/>
 +
{| border="2"
 +
! Reagent
 +
! Volume (μL)
 +
|-
 +
|2.5mM dNTP
 +
|3
 +
|-
 +
|10x buffer
 +
|5
 +
|-
 +
|Plasmid template (20ng/μL)
 +
|2
 +
|-
 +
|Primers (10pmole/μL)
 +
|4
 +
|-
 +
|α-Taq DNA polymerase (5U/μL)
 +
|0.5
 +
|-
 +
|D.W.
 +
|35.5/total=50
 +
|-
 +
!95˚C(2’)-[95˚C(20”)-55˚C(20”)-72˚C(2’)]30-72˚C(5’)-4˚C
 +
|}
 +
<br/>
 +
2. Confirmation of PCR products by agarose gel electrophoresis (Figure 3)
 +
 
 +
3. Purified PCR products
 +
 
 +
4. Quantification of DNA concentration by NanoDrop
 +
 
 +
 
 +
[[Image:Figure2 실험.png|140px|left|frame|figure3.lane1;M-lane2;(PyodA-mAAA)-lane3;(Pznt-RFP)-lane4;(ParsR-GFP)]]
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<br/><br/><br/><br/><br/><br/>
 +
<br/><br/><br/><br/><br/><br/>
 +
<br/><br/><br/><br/><br/><br/>
 +
<br/><br/><br/><br/><br/><br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/><br/>
 +
<br/><br/><br/><br/><br/><br/><br/>
 +
 
 +
== [ Digestion] 2010-09-17 ==
 +
1. Digestion of PCR products and pSB1A2
 +
 
 +
:1) PyodA-mAAA : ''Eco''RI and ''Spe''I
 +
 
 +
:2) PzntA-RFP : ''Xba''I and ''Pst''I
 +
 
 +
:3) pSB1A3 : ''Eco''RI and ''Pst''I
 +
<br/>
 +
{| border="2"
 +
! Reagent
 +
! Volume (μL)
 +
|-
 +
|DNA (about 30ng/μL)
 +
|30
 +
|-
 +
|10x NEB buffer 2
 +
|5
 +
|-
 +
|BSA (10mg/mL)
 +
|0.5
 +
|-
 +
|Appropriate 1st and 2nd restriction enzymes
 +
|2 (each 1)
 +
|-
 +
|D.W.
 +
|12.5 / total = 50
 +
|-
 +
!Completely digestion at 37˚C for 2 hours (at least)
 +
and stop at 80˚C for 20min
 +
|}
 +
<br/>
 +
2. Confirmation of digested products by agarose gel electrophoresis (Figure 4)
 +
 
 +
3. Quantification of DNA concentration by NanoDrop
 +
 
 +
 
 +
 
 +
 
 +
 
 +
[[Image:4 Figure3 실험.png|left|140px|frame|figure4.M pSB1A2(''Eco''RI/''Pst''I) PyodA-mAAA(''Eco''RI/''Spe''I) PzntA-RFP(''Xba''I/''Pst''I)]]
 +
 
 +
 
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
<br/>
 +
<br/>
 +
 
 +
== [Chuseok, Korean thanksgiving day] 2010-09-20 ~ 2010-09==
 +
<br/>
 +
<br/>
 +
 
 +
== [ Ligation & Transformation ] 2010-09-27==
 +
<br/>
 +
1. Ligation of each parts : PyodA-mAAA, PzntA-RFP and pSB1A2
 +
{| border="2"
 +
!Reagent
 +
!Volume (μL)
 +
|-
 +
|10x T4 DNA ligase reaction buffer
 +
|2
 +
|-
 +
|T4 DNA ligase
 +
|2
 +
|-
 +
|Each of the digests
 +
|2 + 2 + 2 = 8
 +
|-
 +
|D.W.
 +
|8 / total = 20
 +
|-
 +
!Incubation at room temperature for 30min
 +
and stop at 80˚C for 20min
 +
|}
 +
<br/>
 +
2. Transformation to ''E. coli'' DH5α
 +
<br/>
 +
<br/>
 +
 
 +
== [ Confirmation of 1st cloning ] 2010-09-28==
 +
<br/>
 +
1. Check : the color of colonies '''(pSB1A2 : green, recombinant plasmid : white)'''
 +
 
 +
2. Inoculation of white colonies to 3mL LB(Amp100)
 +
<br/>
 +
<br/>
 +
== [ Plasmid DNA extraction : pSB1A2-( PyodA-mAAA-PzntA-RFP) ] 2010-09-29==
 +
<br/>
 +
1. Plasmid DNA purification by LaboPass™ Plasmid Mini
 +
 
 +
2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 5)
 +
 
 +
3. Recombinant plasmid sequencing by COSMO GeneTech
 +
 
 +
[[Image:5_Figure4_실험.png|left|140px|frame|figure5. lane1;M-lane2; (pSB1A2)-[PyodA-mAA-Pznt-RFP] #1,2,3]]
 +
 
 +
<br><br>
 +
<br><br><br><br><br><br><br><br><br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br><br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br>
 +
<br><br><br><br><br><br>
 +
 
 +
== [ Digestion ] 2010-10-01 ~ 2010-10-03==
 +
<br/>
 +
1. Check : recombinant plasmid sequence
 +
2. Selection of correct clones
 +
3. Digestion of PCR products(ParsR-GFP) and pSB1C3
 +
:1) PyodA-mAAA-PzntA-RFP : ''Eco''RI and ''Spe''I
 +
:2) ParsR-GFP : ''Eco''RI and ''Spe''I
 +
:3) pSB1C3 : ''Eco''RI and ''Pst''I
 +
<br/>
 +
{| border="2"
 +
!Reagent
 +
!Volume (μL)
 +
|-
 +
|DNA (about 30ng/μL)
 +
|30
 +
|-
 +
|10x NEB buffer 2
 +
|5
 +
|-
 +
|BSA (10mg/mL)
 +
|0.5
 +
|-
 +
|Appropriate 1st and 2nd restriction enzymes
 +
|2 (each 1)
 +
|-
 +
|D.W.
 +
|12.5 / total = 50
 +
|-
 +
!Completely digestion at 37˚C for 2 hours (at least)
 +
and stop at 80˚C for 20min
 +
|}
 +
<br/>
 +
4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)
 +
[[Image:Figure6 aaa.png|left|140px|frame|figure6. lane1; M-lane2; (PyodA-mAAA-PzntA-RFP(EcoRI/SpeI))-lane3; (ParsR-GFP(XbaI/SpeI))-lane4; (pSB1C3(EcoRI/PstI))]]
 +
 
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
 
 +
 
 +
 
 +
5. Quantification of DNA concentration by NanoDrop
 +
 
 +
6. Ligation of each parts : PyodA-mAAA-PzntA-RFP, ParsR-GFP and pSB1C3
 +
 
 +
<br/>
 +
{| border="2"
 +
!Reagent
 +
!Volume (μL)
 +
|-
 +
|10x T4 DNA ligase reaction buffer
 +
|2
 +
|-
 +
|T4 DNA ligase
 +
|2
 +
|-
 +
|Each of the digests
 +
|2 + 2 + 2 = 8
 +
|-
 +
|D.W.
 +
|8 / total = 20
 +
|-
 +
!Incubation at room temperature for 30min
 +
and stop at 80˚C for 20min
 +
|}
 +
<br/>
 +
7. Transformation to ''E. coli'' DH5α
 +
<br/>
 +
<br/>
 +
 
 +
== [ Confirmation of 2nd cloning ] 2010-10-06==
 +
<br/>
 +
1. Check : the color of colonies (pSB1C3 : red, recombinant plasmid : white)
 +
 
 +
2. Inoculation of white colonies to 3mL LB(Amp100)
 +
<br/>
 +
<br/>
 +
== [ Plasmid DNA extraction : pSB1C3-( PyodA-mAAA-PzntA-RFP-ParsR-GFP) ] 2010-10-07==
 +
<br/>
 +
1. Plasmid DNA purification by LaboPass™ Plasmid Mini
 +
 
 +
2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 7)
 +
 
 +
3. Recombinant plasmid full-sequencing by COSMO GeneTech
 +
 
 +
[[Image:Figure7_실험.png|left|100px|frame|figure7. lane1;M-lane2; (psB1A2) Heavy-metal detector #1~3]]
 +
 
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
<br/>
 +
 
 +
== [ Completion : Heavy-metal detector ] 2010-10-18==
 +
<br/>
 +
1. Check : recombinant plasmid sequence
 +
 
 +
2. Selection of correct clones
 +
 
 +
3. Transformation to ''E. coli'' BL21(DE3) for expression test
 +
 
 +
<br/>
 +
<br/>
 +
</div>

Latest revision as of 03:58, 28 October 2010

무제 문서 Javascript DHTML Drop Down Menu Powered by dhtml-menu-builder.comJavascript DHTML Drop Down Menu Powered by dhtml-menu-builder.com


Contents

Brain storming & Work notes

Click on a date to see notes on the meeting & summary of labwork done on that day.


June
MTWTFSS
  [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/1_June_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/2_June_2010&action=edit 2] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/3_June_2010&action=edit 3] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/4_June_2010&action=edit 4] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/5_June_2010&action=edit 5] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/6_June_2010&action=edit 6]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/7_June_2010&action=edit 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_June_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/9_June_2010&action=edit 9] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/10_June_2010&action=edit 10] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/11_June_2010&action=edit 11] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_June_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/13_June_2010&action=edit 13]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/14_June_2010&action=edit 14] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/15_June_2010&action=edit 15] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/16_June_2010&action=edit 16] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/17_June_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/18_June_2010&action=edit 18] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/19_June_2010&action=edit 19] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/20_June_2010&action=edit 20]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/21_June_2010&action=edit 21] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/22_June_2010&action=edit 22] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/23_June_2010&action=edit 23] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/24_June_2010&action=edit 24] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/25_June_2010&action=edit 25] [http://2010.igem.org/Korea_U_Seoul/26_June_2010 26] [http://2010.igem.org/Korea_U_Seoul/27_June_2010 27]
[http://2010.igem.org/Korea_U_Seoul/28_June_2010 28] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/29_June_2010&action=edit 29] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/30_June_2010&action=edit 30]
July
MTWTFSS
      [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/1_July_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/2_July_2010&action=edit 2] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/3_July_2010&action=edit 3] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/4_July_2010&action=edit 4]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/5_July_2010&action=edit 5] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/6_July_2010&action=edit 6] [http://2010.igem.org/Korea_U_Seoul/7_July_2010 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_July_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/9_July_2010&action=edit 9] [http://2010.igem.org/Korea_U_Seoul/10_July_2010 10] [http://2010.igem.org/Korea_U_Seoul/11_July_2010 11]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_July_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/13_July_2010&action=edit 13] [http://2010.igem.org/Korea_U_Seoul/14_July_2010 14] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/15_July_2010&action=edit 15] [http://2010.igem.org/Korea_U_Seoul/16_July_2010 16] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/17_July_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/18_July_2010&action=edit 18]
[http://2010.igem.org/Korea_U_Seoul/19_July_2010 19] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/20_July_2010&action=edit 20] [http://2010.igem.org/Korea_U_Seoul/21_July_2010 21] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/22_July_2010&action=edit 22] [http://2010.igem.org/Korea_U_Seoul/23_July_2010 23] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/24_July_2010&action=edit 24] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/25_July_2010&action=edit 25]
[http://2010.igem.org/Korea_U_Seoul/26_July_2010 26] [http://2010.igem.org/Korea_U_Seoul/27_July_2010 27] [http://2010.igem.org/Korea_U_Seoul/28_July_2010 28] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/29_July_2010&action=edit 29] [http://2010.igem.org/Korea_U_Seoul/30_July_2010 30] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/31_July_2010&action=edit 31]
August
MTWTFSS
            [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/1_August_2010&action=edit 1]
[http://2010.igem.org/Korea_U_Seoul/2_August_2010 2] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/3_August_2010&action=edit 3] [http://2010.igem.org/Korea_U_Seoul/4_August_2010 4] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/5_August_2010&action=edit 5] [http://2010.igem.org/Korea_U_Seoul/6_August_2010 6] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/7_August_2010&action=edit 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_August_2010&action=edit 8]
[http://2010.igem.org/Korea_U_Seoul/9_August_2010 9] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/10_August_2010&action=edit 10] [http://2010.igem.org/Korea_U_Seoul/11_August_2010 11] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_August_2010&action=edit 12] [http://2010.igem.org/Korea_U_Seoul/13_August_2010 13] [http://2010.igem.org/Korea_U_Seoul/14_August_2010 14] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/15_August_2010&action=edit 15]
[http://2010.igem.org/Korea_U_Seoul/16_August_2010 16] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/17_August_2010&action=edit 17] [http://2010.igem.org/Korea_U_Seoul/18_August_2010 18] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/19_August_2010&action=edit 19] [http://2010.igem.org/Korea_U_Seoul/20_August_2010 20] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/21_August_2010&action=edit 21] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/22_August_2010&action=edit 22]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/23_August_2010&action=edit 23] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/24_August_2010&action=edit 24] [http://2010.igem.org/Korea_U_Seoul/25_August_2010 25] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/26_August_2010&action=edit 26] [http://2010.igem.org/Korea_U_Seoul/27_August_2010 27] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/28_August_2010&action=edit 28] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/29_August_2010&action=edit 29]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/30_August_2010&action=edit 30] [http://2010.igem.org/Korea_U_Seoul/31_August_2010 31]
September
MTWTFSS
    [http://2010.igem.org/Korea_U_Seoul/1_September_2010 1] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/2_September_2010&action=edit 2] [http://2010.igem.org/Korea_U_Seoul/3_September_2010 3] [http://2010.igem.org/Korea_U_Seoul/4_September_2010 4] [http://2010.igem.org/Korea_U_Seoul/5_September_2010 5]
[http://2010.igem.org/Korea_U_Seoul/6_September_2010 6] [http://2010.igem.org/Korea_U_Seoul/7_September_2010 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_September_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/9_September_2010&action=edit 9] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/10_September_2010&action=edit 10] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/11_September_2010&action=edit 11] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_September_2010&action=edit 12]
[http://2010.igem.org/Korea_U_Seoul/13_September_2010 13] [http://2010.igem.org/Korea_U_Seoul/14_September_2010 14] [http://2010.igem.org/Korea_U_Seoul/15_September_2010 15] [http://2010.igem.org/Korea_U_Seoul/16_September_2010 16] [http://2010.igem.org/Korea_U_Seoul/17_September_2010 17] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/18_September_2010&action=edit 18] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/19_September_2010&action=edit 19]
[http://2010.igem.org/Korea_U_Seoul/20_September_2010 20] [http://2010.igem.org/Korea_U_Seoul/21_September_2010 21] [http://2010.igem.org/Korea_U_Seoul/22_September_2010 22] [http://2010.igem.org/Korea_U_Seoul/23_September_2010 23] [http://2010.igem.org/Korea_U_Seoul/24_September_2010 24] [http://2010.igem.org/Korea_U_Seoul/25_September_2010 25] [http://2010.igem.org/Korea_U_Seoul/26_September_2010 26]
[http://2010.igem.org/Korea_U_Seoul/27_September_2010 27] [http://2010.igem.org/Korea_U_Seoul/28_September_2010 28] [http://2010.igem.org/Korea_U_Seoul/29_September_2010 29] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/30_September_2010&action=edit 30]
October
MTWTFSS
        [http://2010.igem.org/Korea_U_Seoul/1_October_2010 1] [http://2010.igem.org/Korea_U_Seoul/2_October_2010 2] [http://2010.igem.org/Korea_U_Seoul/3_October_2010 3]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/4_October_2010&action=edit 4] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/5_October_2010&action=edit 5] [http://2010.igem.org/Korea_U_Seoul/6_October_2010 6] [http://2010.igem.org/Korea_U_Seoul/7_October_2010 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_October_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/9_October_2010&action=edit 9] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/10_October_2010&action=edit 10]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/11_October_2010&action=edit 11] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_October_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/13_October_2010&action=edit 13] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/14_October_2010&action=edit 14] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/15_October_2010&action=edit 15] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/16_October_2010&action=edit 16] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/17_October_2010&action=edit 17]
[http://2010.igem.org/Korea_U_Seoul/18_October_2010 18] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/19_October_2010&action=edit 19] [http://2010.igem.org/Korea_U_Seoul/20_October_2010 20] [http://2010.igem.org/Korea_U_Seoul/21_October_2010 21] [http://2010.igem.org/Korea_U_Seoul/22_October_2010 22] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/23_October_2010&action=edit 23] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/24_October_2010&action=edit 24]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/25_October_2010&action=edit 25] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/26_October_2010&action=edit 26] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/27_October_2010&action=edit 27] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/28_October_2010&action=edit 28] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/29_October_2010&action=edit 29] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/30_October_2010&action=edit 30] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/31_October_2010&action=edit 31]


Experimental notes

[Discussion] 2010-08-02 ~ 2010-08-29


1. Strategy and overview of iGEM 2010 experiment Kuprojectmain.png

2. Design of primers

Primer Sequence ( 5’ → 3’ )
PyodA(EcoRI)_F CCGGAATTCCTTCATATTGCCGACAAAGTACG
mAAA(SpeI)_R GGACTAGTTTATCACAGGGGCCGTCCG
PzntA(XbaI)_F GCTCTAGACGTCCGCTCGCTGTATCTC
RFP(PstI)_R AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
ParsR(XbaI)_F GCTCTAGACCAACTCAAAATTCACACCTATTAC
GFP(PstI)_R AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC

[ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03


1. Inoculation of E. coli DH5α and E. coli BL21(DE3) to 3mL LB broth

2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively

3. Inoculation of subcultured E. coli to 200mL 2x LB borth

4. Preparation of competent cells by CSBL laboratory protocol

5. Transformation of pUC19 plasmid(10ng/μL) to competent cells for transformation efficiency check



[ Transformation efficiency ] 2010-09-04


Strain Number of colonies (colonies/μg DNA)
E. coli DH5α Number of colonies (colonies/μg DNA)
E. coli BL21(DE3) 1.5 x 105



[ Amplification of BioBrick parts : pSB1A2 and pSB1C3 ] 2010-09-05


1. Confirmed location : pSB1A2-BBa_E0040 (2010 Kit plate 1/ 14K) and pSB1C3-BBa_J04450 (2010 Kit plate 1/ 3A)

2. 20uL suspension by autoclaved distilled water

3. 3uL transformation to E. coli DH5α

4. Plating to LB(Amp100), LB(Cm25)

[ Genomic DNA extraction ] 2010-09-06


1. Inoculation for plasmid DNA purification

2. E. coli K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit

3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)

4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL


figure1. lane1;M-lane2;E. coli K12 genomic DNA extraction











br>





























[ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07


1. Plasmid miniprep by LaboPass™ Plasmid Mini (Plasmid DNA purification kit)

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 2)

3. Quantification of DNA concentration by NanoDrop

figure2.lane1;M-lane2;pSB1A2-lane3;pSB1C3


































[ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16


1. PCR : PyodA-mAAA, PzntA-RFP(BBa_E1010) and ParsR-GFP(BBa_E0040)

Reagent Volume (μL)
2.5mM dNTP 3
10x buffer 5
Plasmid template (20ng/μL) 2
Primers (10pmole/μL) 4
α-Taq DNA polymerase (5U/μL) 0.5
D.W. 35.5/total=50
95˚C(2’)-[95˚C(20”)-55˚C(20”)-72˚C(2’)]30-72˚C(5’)-4˚C


2. Confirmation of PCR products by agarose gel electrophoresis (Figure 3)

3. Purified PCR products

4. Quantification of DNA concentration by NanoDrop


figure3.lane1;M-lane2;(PyodA-mAAA)-lane3;(Pznt-RFP)-lane4;(ParsR-GFP)








































[ Digestion] 2010-09-17

1. Digestion of PCR products and pSB1A2

1) PyodA-mAAA : EcoRI and SpeI
2) PzntA-RFP : XbaI and PstI
3) pSB1A3 : EcoRI and PstI


Reagent Volume (μL)
DNA (about 30ng/μL) 30
10x NEB buffer 2 5
BSA (10mg/mL) 0.5
Appropriate 1st and 2nd restriction enzymes 2 (each 1)
D.W. 12.5 / total = 50
Completely digestion at 37˚C for 2 hours (at least)

and stop at 80˚C for 20min


2. Confirmation of digested products by agarose gel electrophoresis (Figure 4)

3. Quantification of DNA concentration by NanoDrop



figure4.M pSB1A2(EcoRI/PstI) PyodA-mAAA(EcoRI/SpeI) PzntA-RFP(XbaI/PstI)








































[Chuseok, Korean thanksgiving day] 2010-09-20 ~ 2010-09



[ Ligation & Transformation ] 2010-09-27


1. Ligation of each parts : PyodA-mAAA, PzntA-RFP and pSB1A2

Reagent Volume (μL)
10x T4 DNA ligase reaction buffer 2
T4 DNA ligase 2
Each of the digests 2 + 2 + 2 = 8
D.W. 8 / total = 20
Incubation at room temperature for 30min

and stop at 80˚C for 20min


2. Transformation to E. coli DH5α

[ Confirmation of 1st cloning ] 2010-09-28


1. Check : the color of colonies (pSB1A2 : green, recombinant plasmid : white)

2. Inoculation of white colonies to 3mL LB(Amp100)

[ Plasmid DNA extraction : pSB1A2-( PyodA-mAAA-PzntA-RFP) ] 2010-09-29


1. Plasmid DNA purification by LaboPass™ Plasmid Mini

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 5)

3. Recombinant plasmid sequencing by COSMO GeneTech

figure5. lane1;M-lane2; (pSB1A2)-[PyodA-mAA-Pznt-RFP] #1,2,3





































[ Digestion ] 2010-10-01 ~ 2010-10-03


1. Check : recombinant plasmid sequence 2. Selection of correct clones 3. Digestion of PCR products(ParsR-GFP) and pSB1C3

1) PyodA-mAAA-PzntA-RFP : EcoRI and SpeI
2) ParsR-GFP : EcoRI and SpeI
3) pSB1C3 : EcoRI and PstI


Reagent Volume (μL)
DNA (about 30ng/μL) 30
10x NEB buffer 2 5
BSA (10mg/mL) 0.5
Appropriate 1st and 2nd restriction enzymes 2 (each 1)
D.W. 12.5 / total = 50
Completely digestion at 37˚C for 2 hours (at least)

and stop at 80˚C for 20min


4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)

File:Figure6 aaa.png
figure6. lane1; M-lane2; (PyodA-mAAA-PzntA-RFP(EcoRI/SpeI))-lane3; (ParsR-GFP(XbaI/SpeI))-lane4; (pSB1C3(EcoRI/PstI))



























5. Quantification of DNA concentration by NanoDrop

6. Ligation of each parts : PyodA-mAAA-PzntA-RFP, ParsR-GFP and pSB1C3


Reagent Volume (μL)
10x T4 DNA ligase reaction buffer 2
T4 DNA ligase 2
Each of the digests 2 + 2 + 2 = 8
D.W. 8 / total = 20
Incubation at room temperature for 30min

and stop at 80˚C for 20min


7. Transformation to E. coli DH5α

[ Confirmation of 2nd cloning ] 2010-10-06


1. Check : the color of colonies (pSB1C3 : red, recombinant plasmid : white)

2. Inoculation of white colonies to 3mL LB(Amp100)

[ Plasmid DNA extraction : pSB1C3-( PyodA-mAAA-PzntA-RFP-ParsR-GFP) ] 2010-10-07


1. Plasmid DNA purification by LaboPass™ Plasmid Mini

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 7)

3. Recombinant plasmid full-sequencing by COSMO GeneTech

figure7. lane1;M-lane2; (psB1A2) Heavy-metal detector #1~3



























































[ Completion : Heavy-metal detector ] 2010-10-18


1. Check : recombinant plasmid sequence

2. Selection of correct clones

3. Transformation to E. coli BL21(DE3) for expression test