Team:Wisconsin-Madison/notebook/Yue

From 2010.igem.org

(Difference between revisions)
(Replacing page with '{{Wisconsin-Madison header}} <html> <style> #nav_content { float: left; position: fixed; width: 100px; margin-left: 0px; margin-right: 0px; margin-top: 5px; height: 280p...')
 
(One intermediate revision not shown)
Line 5: Line 5:
float: left;
float: left;
position: fixed;
position: fixed;
-
width: 100px;
+
width: 200px;
margin-left: 0px;
margin-left: 0px;
margin-right: 0px;
margin-right: 0px;
Line 13: Line 13:
#page_content {
#page_content {
float: left;
float: left;
-
width: 810px;
+
width: 710px;
         text-align: justify;
         text-align: justify;
-
margin-left: 100px;
+
margin-left: 200px;
margin-right: auto;
margin-right: auto;
padding-left: 0px;
padding-left: 0px;
Line 27: Line 27:
<div id="page_content">
<div id="page_content">
</html>
</html>
 +
 +
=Note book of July 12th,2010=
 +
 +
1. Screening for the Rfal into LacI-RBS cloning
 +
 +
Gel Picture
 +
 +
[[File:IGEM 2010-07-12 13hr 39min.jpg]]
 +
 +
[[File:IGEM 2010-07-12 17hr 33min.jpg]]
 +
 +
2. Primer Design For the Cloning LacI-RBS-ygiV-RBS-Rfal-RBS-RFP-Terminator
 +
 +
One is for Rfal: the forward primer has a XbaI and RBS in it; the reverse primer is on the backbone, and has a XmaI site on it.
 +
 +
pRBS-Rfal_Fwd: TGCTCTAGA AAAGAGGAGAAAATGCTAACATCCTTTAAACT
 +
 +
pRBS-Rfal_Rev:  CCCCCCGGGTTAATTAATTGTATTGTTACGATTAT
 +
 +
 +
The other one is For RFP (I13507): The forward primer has a XmaI site on it and starts from the backbone; the reverse primer starts on the backbone too. [The original plasmid, I13507 has a structur of RBS-RFP-terminator]
 +
 +
pRFP(I13507)_Fwd: CCCCCCGGGgagaaagaggagaaatactagatgg
 +
 +
pRFP(I13507)_Rev: AGTCAGTGAGCGAGGAAG
 +
 +
=Note book of July 13th,2010=
 +
 +
1. Primer Designs:
 +
 +
Tyler helped me check the primers, and he get back to me with his comments:
 +
 +
pRBS-RfaI_Fwd - Tm for primer portion is too low(oligocalc says 44), add 4 bases from the gene sequence, try to have 3' end be G or C
 +
 +
pRBS-RfaI_Rev - GC content of the priming portion is way too low, try to get it to at least above 30%, you can move down the gene since you are at the ending site, also try to have the 3' end of the primer be a G or C
 +
 +
pRFP(I13507)_Fwd - good, I usually add a 5 base overhang, but 3 should be ok for the enzyme you are using
 +
 +
pRFP(I13507)_Fwd - good
 +
 +
So I redesigned my primers with
 +
 +
Detailed information are in:
 +
[[File:Primer Design for Rfal and RFP - 2.pdf]]
 +
 +
'''Primers For Rfal'''
 +
 +
Tm : 46  GC:41%
 +
Fwd: gagatgctaacatcctt (17bp)
 +
 +
pRBS-RfaI_Fwd : TGCTCTAGAAAAGAGGAGAAAtacgagatgctaacatcctt
 +
 +
Name Sequence                          Tm°C CG% nt A T C
 +
seq_1 tgctctagaaaagaggagaaatacgagatgctaacatcctt 75.1 39.0 41 16.0 9.0 7.0 9.0 417600.0                   12674.4             2.4 30.4
 +
 +
Name Sequence        Tm°C CG% nt A T C G
 +
seq_1 gagatgctaacatcctt 49.9 41.2 17 5.0 5.0 4.0 3.0 164400.0                   5169.4                     6.1 31.4
 +
 +
Tm:49  GC:40%
 +
Rev: taataatactagtagcggcc （17bp）
 +
 +
pRBS-RfaI_Rev: GCCGCTACTAGTATTATTA  [SpeI]
 +
 +
Name Sequence          Tm°C CG% nt A T C G
 +
seq_1 gccgctactagtattatta 49.6 36.8 19 5.0 7.0 4.0 3.0 185500.0                   5777.8                     5.4 31.1
 +
 +
'''Primers For RFP'''
 +
 +
pRFP(I13507)_Fwd: CTAGTCTAGAgagaaagaggagaaatactagatgg  [XbaI]
 +
 +
Name Sequence                          Tm°C CG% nt A T C G
 +
seq_1 ctagtctagagagaaagaggagaaatactagatgg 65.7 40.0 35 15.0 6.0 3.0 11.0 377400.0                   10950.2             2.6 29.0
 +
 +
Name Sequence                Tm°C CG% nt A T C G
 +
seq_1 gagaaagaggagaaatactagatgg 59.8 40.0 25 12.0 3.0 1.0 9.0 278000.0                   7861.2                     3.6 28.3
 +
 +
pRFP(I13507): AGTCAGTGAGCGAGGAAG  (cttcctcgctcactgact)
 +
 +
Name Sequence          Tm°C CG% nt A T C G
 +
seq_1 agtcagtgagcgaggaag 58.8 55.6 18 6.0 2.0 2.0 8.0 191900.0                   5637.7                     5.2 29.4
 +
 +
Name Sequence          Tm°C CG% nt A T C G
 +
seq_1 agtcagtgagcgaggaag 58.8 55.6 18 6.0 2.0 2.0 8.0 191900.0                   5637.7                     5.2 29.4
 +
 +
=Note book of July 14th,2010=
 +
 +
Cloning of LacI-RBS-ygiV with a terminator
 +
 +
a. Double digestion
 +
 +
b. Gel extraction and purificaiton
 +
 +
[[File:2.jpg]]
 +
 +
c. overnight ligation
 +
 +
=Note book of July 15th,2010=
 +
 +
Cloning of LacI-RBS-Rfal with a terminator
 +
 +
a. Double digestion
 +
 +
b. Gel extraction and purificaiton
 +
 +
[[File:1.jpg]]
 +
 +
c. 2 hours bench top ligation
 +
 +
d. Electroporation of LacI-RBS-ygiV-terminator and LacI-RBS-Rfal-terminator into DH10B cells.
 +
 +
e. Plate on Amp plates
 +
 +
f. run a gel to check the digestion of the backbone
 +
 +
[[File:3.jpg]]
 +
 +
=Note book of July 16th,2010=
 +
 +
A.Check the plate
 +
 +
1. LacI-RBS-ygiV-terminator
 +
 +
the pallet plate has about 200 colonies
 +
 +
the control has 8 colonies
 +
 +
 +
2.LacI-RBS-Rfal-terminator
 +
 +
the pallet plate has about 150 colonies
 +
 +
the control doesn't have colonies
 +
 +
 +
B.Screening
 +
 +
 +
 +
 +
=Note book of July 6th,2010=
 +
 +
A. Start the clone of Rfal into K200021(LacI+RBS)
 +
 +
1.cut the backbone, K200021, with PstI-HF and SpeI for 2 hours.
 +
cut the insert, Rfal, with PstI-HF and XbaI for 2 hours.
 +
 +
2.Gel Extract
 +
 +
K200021: 3264bp    Rfal:1263bp
 +
 +
[[File:IGEM 2010-07-06 13hr 05min.jpg]]
 +
 +
After the gel extraction, the concentrations are:
 +
 +
K200021: 33.1ng/ul
 +
Rfal: 53.9ng/ul
 +
 +
3.Ligation
 +
 +
for doing a K200021:Rfal is 1:4 ligation, 100ng of K200021 and 154.8ng of Rfal are needed. Based on the DNA concentration, add 3ul K200021 and 3ul Rfal for ligation.
 +
 +
Stored at 16C overnight.
 +
 +
 +
=Note book of July 7th,2010=
 +
 +
A. Cloning of LacI-RBS-Rfal
 +
 +
1.Electroporation
 +
 +
LacI-RBS-Rfal has a time constant 4.8;
 +
 +
The control has a time constant 4.7;
 +
 +
2.Plate on two Amp+Kan plate. Stored in a 37C incubator.
 +
 +
B. Cloning of LacI-RBS-ygiV into RBS
 +
 +
1.cut the backbone, RBS, with EcoRI-HF and XbaI, and cut the insert LacI-RBS-ygiV with EcoRI-HF and SpeI.
 +
 +
2.Gel Extraction
 +
 +
RBS:3200bp            LacI-RBS-ygiV:543bp
 +
 +
[[File:IGEM 2010-07-06 17hr 00min.jpg]]
 +
 +
after the gel extraction, the concentrations are:
 +
 +
RBS: 20.7ng/ul
 +
 +
lacI-RBS-ygiV: 19.8ng/ul
 +
 +
3.Ligation
 +
 +
For a 1 to 3 backbone:insert ratio, we need 100ng of RBS and 107.3ng of LacI-RBS-ygiV for Ligation. THerefore, add 3.7ul RBS and 4.3ul LacI-RBS-ygiV to ligate. Store at 4C overnight.
 +
 +
C.Run a gel to check the cutting peices
 +
 +
The orders are:
 +
 +
L-ygiV-ES; L-ygiV uncut; Rfal-PX; Rfal uncut; RBS-EX; RBS uncut; LacI-PS; LacI uncut; Ladder
 +
 +
unluckily, the first lane for L-ygiV-ES didn't show up any band.
 +
 +
[[File:IGEM 2010-07-07 11hr 24min.jpg]]
 +
 +
The rest of the bands are all correct.
 +
 +
Then run a gel for L-ygiV-ES and L-ygiV uncut by loading more DNA on the gel
 +
 +
[[File:IGEM 2010-07-07 13hr 09min.jpg]]
 +
 +
Now, this shows that the L-ygiV-ES is correct.
 +
 +
 +
=Note book of July 8th,2010=
 +
 +
A. Transformation of the Clone LacI-RBS-ygiV-RBS
 +
 +
1. Electroporation
 +
 +
LacI-RBS-ygiV-RBS: 4.7
 +
 +
Control: 4.9
 +
 +
2. Plate on two Amp plate.
 +
 +
B. Run a gel to check the Ligation of LacI-RBS-Rfal and LacI-RBS-ygiV-RBS
 +
 +
the orders are Ladder LacI-RBS-Rfal, control, LacI-RBS-ygiV-RBS, control
 +
 +
[[File:IGEM 2010-07-07 12hr 48min.jpg]]
 +
 +
C. Colony PCR for the LacI-RBS-Rfal Clone
 +
 +
1.The control plate only has one colony, compared with the regular plate with about 100 colonies.
 +
 +
2.picked 14 colonies for screening.
 +
 +
Gel for Colony PCR:
 +
 +
[[File:IGEM 2010-07-08 13hr 54min.jpg]]
 +
 +
Run for 5mins longer and add more EB
 +
 +
[[File:IGEM 2010-07-08 14hr 20min.jpg]]
 +
 +
No colony shows the correct band (around 1500bp)
 +
 +
=Note book of July 9th,2010=
 +
 +
A Cloning of LacI-RBS-ygiV into RBS, and Rfal into LacI-RBS.
 +
 +
Add 1.5mg of DNA into each tube:
 +
 +
RBS(B0034):5.3ul template; Add 1ul EcoRI-HF to digest 1 hour and inactivate at 65C for 20mins. Then Add 1ul of XbaI to digest an additional hour.
 +
 +
LacI-RBS(K200021): 9.5ul template; Add 1ul PstI-HF to digest 1 hour and inactivate at 80C for 20mins. Then Add 1ul of SpeI to digest an additional hour.
 +
 +
Rfal: 3.1ul template digest with 1ul PstI-HF and 1ul XbaI
 +
 +
LacI-ygiV: 4.4ul tempalte digest with 1ul EcoRI-HF and 1ul SpeI
 +
 +
Gel after 1 hour inactivation of EcoRI-HF in RBS and PstI-HF in LacI-RBS:
 +
 +
Orders are:
 +
 +
RBS cut with EcoRI-HF, RBS uncut, Ladder, LacI-RBS cut with PstI-HF, LacI-RBS uncut.
 +
 +
[[File:IGEM 2010-07-09 13hr 27min.jpg]]
 +
 +
 +
                                                                                             
 +
 +
=Note book of June 28th,2010=
 +
 +
a. Digestion of K200021 (LacI+RBS) with PstI-HF and SpeI, and digest ygiV and Rfal with PstI-HF and XbaI.
 +
 +
b. Gel Extraction and purification:
 +
 +
1. Gel
 +
 +
K200021-PS
 +
 +
ygiV and Rfal
 +
 +
[[File:IGEM 2010-06-27 13hr 19min.jpg]]
 +
 +
Concentration of the cutting peices:
 +
K200021-PS
 +
 +
ygiV-PX
 +
 +
Rfal-PX
 +
 +
Gel for the purification product
 +
 +
[[File:IGEM 2010-06-28 14hr 10min.jpg]]
 +
 +
c. Set up an overnight ligation
 +
 +
=Note book of June 29th,2010=
 +
 +
a. Transformation
 +
 +
pLacI-RBS-ygiV-PX: 4.1
 +
 +
pLacI-RBS-ygiV-PX(C): 3.9
 +
 +
pLacI-RBS-Rfal-PX: 4.0
 +
 +
pLacI-RBS-Rfal-PX(C):3.9
 +
 +
b. Plate on Amp100 plates.
 +
 +
 +
=Note book of June 30th,2010=
 +
 +
Re-plan the project.
 +
Figure out all the cloning need to be done by the end of the summer.
 +
Detailed information please see the spread sheet on Sarah's page.
 +
 +
=Note book of July 1st,2010=
 +
 +
A. Colony PCR of the LacI-RBS-ygiV and LacI-RBS-Rfal clone.
 +
 +
Upper: LacI-RBS-Rfal Clone
 +
 +
Lower: LacI-RBS-ygiV clone
 +
 +
[[File:IGEM 2010-07-01 14hr 49min-2.jpg]]
 +
 +
The LacI-RBS-ygiV clone shows up at the right length.
 +
 +
 +
B. Innoculate 5 liquid culture of the ygiV clone.
 +
 +
 +
=Note book of July 2nd,2010=
 +
 +
A. Made 3 freezer stocks of LacI-RBS-ygiV clone
 +
 +
B. Miniprep LacI-RBS-ygiV
 +
 +
LacI-RBS-ygiV-1: 388.7ng/ul
 +
LacI-RBS-ygiV-2: 357.0ng/ul
 +
LacI-RBS-ygiV-3: 350.2ng/ul
 +
LacI-RBS-ygiV-4: 255.0ng/ul
 +
 +
 +
=Note book of June 21st,2010=
 +
 +
a.Minipreped 3 sets each for pBAD33BB, pBAD35BB, ygiV, and Rfal.
 +
 +
b.Set up a overnight digestions that cut pBAD33BB and pBAD35BB with PstI-HF and SpeI, and cut ygiV and Rfal with PstI-HF and XbaI. (37C overnight)
 +
 +
c.Screening for the 2nd time ygiV and Rfal cloning.
 +
 +
ygiV:
 +
 +
[[File:IGEM 2010-06-21 bads2 Peter ScanA.jpg]]
 +
 +
Rfal:
 +
 +
[[File:IGEM 2010-06-21 bads2 Peter ScanB.jpg]]
 +
 +
They all shows up at the same length as the positive control, which means we didn't get the desired cloning.
 +
 +
=Note book of June 22nd,2010=
 +
 +
a.Gel extraction of pBAD33BB, ygiV and Rfal.
 +
 +
For pBAD33BB
 +
 +
[[File:IGEM 2010-06-23 12hr 45min.jpg]]
 +
 +
For ygiV(486bp) and Rfal(1269bp)
 +
 +
[[File:IGEM 2010-06-23 12hr 44min.jpg]]
 +
 +
b.Gel purification of pBAD33BB, ygiV and Rfal.
 +
 +
after the gel purificaion, the concentrations are:
 +
 +
pBAD33BB-PX: 39.7ng/ul
 +
 +
ygiV: 25.7ng/ul
 +
 +
Rfal: 33.5ng/ul
 +
 +
c.Set up an overnight ligation with Insert/Vector ratio equals 4.
 +
 +
tubeA
 +
 +
pBAD33BB: 3.8ul
 +
 +
ygiV: 2.2ul
 +
 +
 +
tubeB
 +
 +
pBAD33BB: 3.8ul
 +
 +
Rfal: 4.2ul
 +
 +
 +
tube C (control)
 +
 +
pBAD33BB: 3.8ul
 +
 +
(16C overnight)
 +
 +
=Note book of June 23rd,2010=
 +
 +
a. Transformation
 +
 +
pBAD33BB-ygiV: 4.4  1.8
 +
 +
pBAD33BB-Rfal: 4.4  1.8
 +
 +
Control: 4.3  1.8
 +
 +
b. Plating on CM plate
 +
 +
c. run the gel for ligation product
 +
 +
[[File:Pflegerlab 2010-06-24 11hr 07min.jpg]]
 +
 +
 +
=Note book of June 24th,2010=
 +
 +
a. Check the transformation plate
 +
 +
pBAD33BB-ygiV:
 +
 +
[[File:Photo.JPG]]
 +
 +
 +
pBAD33BB-Rfal:
 +
 +
[[File:Photo2.JPG]]
 +
 +
 +
Control:
 +
 +
[[File:Photo1.JPG]]
 +
 +
b. pick 12 colonies from pBAD33BB-Rfal plate and 10 colonies from pBAD33BB-ygiV plate for the colony PCR screening.
 +
 +
ygiV-plate B
 +
 +
[[File:Plate B of ygiV-pBAD33BB screening pflegerlab 2010-06-25 14hr 45min.jpg]]
 +
 +
 +
Rfal-plate B
 +
 +
[[File:Plate A of Rfal-pBAD33BB screening pflegerlab 2010-06-25 14hr 42min.jpg]]
 +
 +
c. pick colonies from both plates into liquid cultures. Grow overnight. (5 from plateA and 5 from plateB)
 +
 +
 +
=Note book of June 25th,2010=
 +
 +
a. miniprep 10 liquid culture for Screening.
 +
 +
b. Digest with BamHI-HF and PstI-HF
 +
 +
c. run the gel for the screening
 +
 +
[[File:Screening.jpg]]
 +
 +
 +
 +
=Summary of Week June 14th to June 18th, 2010=
 +
 +
  06-14-10
 +
'''A. Miniprep'''
 +
 +
Miniprep All the new parts received
 +
 +
1. K082006  52.7ng/ul
 +
 +
2. K142001  196.7ng/ul
 +
 +
3. K173004  330.2ng/ul
 +
 +
4. pBAD35BB  102.4ng/ul
 +
 +
5. pBAD33BB  61.5ng/ul
 +
 +
6. pBAD35BB  105.8ng/ul
 +
 +
7. K142003  212.8ng/ul
 +
 +
8. K137113  174.8ng/ul
 +
 +
9. K142002  222.5ng/ul
 +
 +
10.pBAD35BB  117.2ng/ul
 +
 +
11.K200003  207.2ng/ul
 +
 +
12.K142000  177.4ng/ul
 +
 +
 +
'''B. Ligation for vgiV and pBAD33BB'''
 +
 +
Ligation of vgiV and pBAD33BB with a molar ratio 3:1
 +
 +
one for 2 hours, one for overnight
 +
 +
 +
'''C. Thansformation of the vgiV cloning'''
 +
 +
Transformed the 2-hour ligation and plated
 +
 +
  06-15-10
 +
'''A. Screening of the cloning of vgiV into pBAD33BB'''
 +
 +
The 2-hour ligation  only had two colonies.
 +
Screening with Colony PCR but didn't see any band.
 +
 +
'''B. Transformation of vgiV cloning'''
 +
 +
Transformed the overnight ligation and plated in CM argar plate.
 +
 +
'''C. Restriction Mapping of the Newly Receiving Parts'''
 +
 +
The Correct Parts are
 +
 +
Parts Band 1@ Band2@ Band3@
 +
 +
K112808 2500 1406
 +
 +
K137113 2200 650
 +
 +
K173004 3200 2100 1106
 +
 +
K142000 2100 1100
 +
 +
K142001 2100 1100
 +
 +
K142002 2100 1100
 +
 +
K142003 2100 1100
 +
 +
K082006 3200 750
 +
 +
K200003 3200 1300
 +
 +
 +
  06-16-10
 +
'''A. Screening of the cloning of vgiV into pBAD33BB'''
 +
 +
Saw a lot colony on both the 100ul plate and the pallet plate. The Control plate (backbone only) only had one colony.
 +
 +
Pick up 10 colonies from each plate( 100ul plate and pallet plate). Colony PCR for the screening
 +
 +
Run the Gel for the Coloy PCR, but didn't see the correct band.
 +
 +
(The band is about 200bp, which means the back bone ligate itself.)
 +
 +
'''B. Cloning of Rfal into pBAD35BB'''
 +
 +
Digest pBAD35BB with PstI-HF and XbaI, and digest Rfal with PstI-HF and SpeI
 +
 +
Gel extraction and purification.
 +
 +
Ligate with a insert/vector ratio 3:1
 +
 +
Ligate at 16C overnight
 +
 +
  06-17-10
 +
 +
'''A. Another Screening of the cloning of vgiV into pBAD33BB'''
 +
 +
Pick another 10 colonies from both the 100ul plate and the pallet plate.
 +
 +
Proceed the Colony PCR
 +
 +
Run the Gel, but still didn't see the correct band(about 700bp).
 +
 +
Do see a band down at 200bp, same length as the positive control. Therefore, confirmed that the colonies are just transformed with the backbone.
 +
 +
 +
'''B. Cloning of Rfal into pBAD35BB'''
 +
 +
Transform the Rfal cloning and the control into DH10B
 +
 +
Plated on Kan plate.
 +
 +
 +
 +
 +
Cloning of pET28b+RFP
 +
[[File:Cloning of pET28b-RFP.pdf]]
 +
 +
=Notebook May 25th, 2010=
 +
 +
'''BioBrick pBAD35'''
 +
a) Target Vector: pBAD35 (about 4200bp, 4.2kb)
 +
 
 +
  pBAD BioBrick Primers:
 +
  Tm value: Fwd: 72.0C
 +
            Rev: 68.1C
 +
 +
'''b) General Procedure'''
 +
1.  PCR amplify
 +
2.  Pour 2 gels during this time
 +
3.  Check PCR on 1st Gel
 +
4.  Add 1ul DpnI/rxn for 1hr at 37C
 +
5.  PCR clean up or gel extraction (depends on whether you see a bright band at right place)
 +
6.  XbarI Digest
 +
7.  PCR clean up
 +
8.  Ligate
 +
 +
'''c) Cycle Design'''
 +
98C  1min
 +
98C  15s
 +
73C  30s  33X
 +
72c  126S
 +
72c  5mins
 +
4c  forever
 +
 +
'''d)Phusion Mix'''
 +
Water: 35ul
 +
5Xbuffer:10ul
 +
template:2ul
 +
Primer FW:0.5ul
 +
Primer RV:0.5ul
 +
dNTP:1ul
 +
Phusion Enzyme:1ul
 +
 +
Note: Keep the primers and Enzyme on ICE
 +
 +
'''RESULT'''
 +
1st Gel
 +
Lane    Band@
 +
35A    3-4kb
 +
35B    3-4kb
 +
18      4kb
 +
33      5kb
 +
34      4kb and 2.5kb(wrong)
 +
 +
[[File:IGEM Biobrick first 2010-05-25 15hr 09min.jpg]]
 +
 +
'''
 +
Protocol of PCR Purification:'''
 +
[[File:PCR purification-Qiagen.pdf]]
 +
 +
'''DIGESTION'''
 +
 +
'''pBAD35-A'''
 +
DNA: 40ul
 +
Buffer4: 5ul
 +
BSA: 0.5ul
 +
Water: 3.5ul
 +
XbaI: 1ul
 +
 +
'''pBAD35-B'''
 +
DNA: 40ul
 +
Buffer4: 5ul
 +
BSA: 0.5ul
 +
Water: 2.5ul
 +
XbaI: 2ul
 +
 +
Leave the digestion on a 37c water bath overnight
 +
 +
'''
 +
Inoculation for Encryption Project'''
 +
 +
10ml LB in each tube and add 10ul Antibiotic
 +
A: BBa_K118004
 +
B: BBa_K098995
 +
C: BBa_I718008
 +
D: BBa_B1006
 +
 +
=Notebook May 26th, 2010=
 +
a)PCR purification(refer to protocol on the protocol from Notebook May 25th 2010)
 +
DNA      Conc(ng/ul)
 +
pBAD35-A  57.6
 +
pBAD35-B  69.7
 +
 +
b)Ligation
 +
(Peter did all the ligation)
 +
Ligate on pBAD18,33,34,35A-B 100ng/10ul rxn
 +
2hrs bench ligation
 +
 +
c)Electroporation transformation
 +
 +
Use DH10B
 +
Add 1ul of plasmid
 +
Let it sits on ice for 5 mins
 +
 +
after the shock, immediately add 950ul LB and mix well
 +
Transfer to centrifuge tube
 +
 +
DNA  Time
 +
35    4.2
 +
33    4.4
 +
18    4.2
 +
 +
(control)
 +
35    4.5
 +
33    4.2
 +
18    4.2
 +
 +
Let them grow in the 37c shaker for 1hr.
 +
 +
Plate 50ul of cells
 +
 +
 +
 +
'''Miniprep for Nate Pant's Project
 +
Miniprep'''
 +
Plasmid information
 +
A: BBa_K118004
 +
B: BBa_K098995
 +
C: BBa_I718008
 +
D: BBa_B1006
 +
 +
Centrifuge at 30000rpm for 10mins
 +
 +
Follow the Miniprep Protocol:
 +
[[File:Qiagenmini.pdf]]
 +
'''
 +
Result'''
 +
Measured by Nanodrop
 +
 +
DNA    Conc(ng/ul)    260/280
 +
A      324.0          1.97
 +
B      288.3          1.98
 +
C      418.2          1.96
 +
D      276.6          1.97
 +
 +
 +
 +
=Notebook May 27th, 2010=
 +
 +
Check the colonies in the plates.
 +
 +
Picked 10 colonies from pBAD35B
 +
Picked 5 colonies from pBAD33
 +
Picked 5 colonies from pBAD18
 +
 +
Inoculate them in 5ml LB with antibiotics
 +
 +
'''
 +
Parts Checking
 +
'''
 +
 +
Concentration:
 +
BBa_K200000: 199.9ng/ul
 +
BBa_I716213: 186.5ng/ul
 +
BBa_S04114: 543.6ng/ul
 +
BBa_I718007: 146.1ng/ul
 +
BBa_I716212: 155.8ng/ul
 +
BBa_S03975:
 +
BBa_K200002: 309.3ng/ul
 +
BBa_K200003: 105.4ng/ul
 +
BBa_S09373: 243.1ng/ul
 +
BBa_J31000: 278.3ng/ul
 +
BBa_B1006: 276.6ng/ul
 +
BBa_K118004: 324.0ng/ul
 +
BBa_K098995: 288.3ng/ul
 +
 +
Single Digestion Test With EcoRI
 +
for
 +
1. BBa_K200000:
 +
2. BBa_I716213:
 +
3. BBa_S04114:
 +
4. BBa_I718007:
 +
5. BBa_I716212:
 +
6. BBa_S03975:(Don't have plasmid)
 +
7. BBa_K200002:
 +
8. BBa_K200003:
 +
9. BBa_S09373:
 +
10.BBa_J31000:
 +
11.BBa_B1006:
 +
12.BBa_K118004:
 +
13.BBa_K098995:
 +
 +
Protocol
 +
1.8ul Buffer3(10X)
 +
0.18ul BSA(100X)
 +
12ul MiliQ H2O
 +
3ul DNA
 +
1ul EcoRI
 +
 +
Incubate in water bath at 37C for 2 hours (total volume 18ul)
 +
add 3.6ul Dye (6X)
 +
 +
Load 6ul into the GEL
 +
Gel:
 +
[[File:2010-05-27 Map - Single digest.jpg]]
 +
 +
Gel Description:
 +
1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13
 +
 +
Results:
 +
3, 9, 11, and 12 don't have the correct bands
 +
 +
So run the single digestion for all four again with 2 hours
 +
Gel:
 +
[[File:IGEM Single Digestion Second 2010-05-28 14hr 39min.jpg]]
 +
 +
Gel Description:
 +
3, 9, Ladder, 11, 12
 +
 +
Result:
 +
Still not correct
 +
 +
Double Digestion
 +
Find one enzyme cutting site with the gene
 +
1. BBa_K200000:
 +
Buffer:4
 +
Enzyme:AflII EcoRI
 +
2. BBa_I716213:
 +
Buffer:2
 +
Enzyme:AflIII SpeI
 +
3. BBa_S04114:
 +
Buffer:3
 +
Enzyme:EcoRV EcoRI
 +
4. BBa_I718007:
 +
Buffer:3
 +
Enzyme:EcoRV EcoRI
 +
5. BBa_I716212:
 +
Buffer:3
 +
Enzyme:EcoRV EcoRI
 +
6. BBa_S03975:(Don't have plasmid)
 +
7. BBa_K200002: (don't have enzyme stock that can cut within the gene)
 +
8. BBa_K200003:
 +
Buffer:4
 +
Enzyme:NheI EcoRI
 +
9. BBa_S09373:
 +
Buffer:3
 +
Enzyme:EcoRV EcoRI
 +
10.BBa_J31000:
 +
Buffer:3
 +
Enzyme:BglI EcoRI
 +
11.BBa_B1006: (Too small, cannot cut within the gene)
 +
12.BBa_K118004:
 +
Buffer:3
 +
Enzyme:EcoRV EcoRI
 +
13.BBa_K098995:
 +
Buffer:2
 +
Enzyme:HindIII EcoRI
 +
 +
Protocol
 +
1.8ul NEB Buffer(10X)
 +
0.18ul BSA(100X)
 +
11ul MiliQ H2O
 +
3ul DNA
 +
1ul Enzyme1
 +
1ul Enzyme2
 +
 +
Incubate in water bath at 37C for 2 hours (total volume 18ul)
 +
add 3.6ul Dye (6X)
 +
 +
Load 6ul into the GEL
 +
 +
Gel
 +
[[File:IGEM Parts Double Digestion 2010-05-28 14hr 54min.jpg]]
 +
[[File:IGEM Parts Double Digestion White 2010-05-28 14hr 57min.jpg]]
 +
 +
Result
 +
Only 1, 2, 4, 5, 8, 13 show the correct bands
 +
 +
 +
=Notebook May 28th, 2010=
 +
 +
Miniprep for the screening
 +
 +
Restriction Enzyme Mapping for all the 20 screening plasmid
 +
 +
1.8ul Buffer3(10X)
 +
0.18ul BSA(100X)
 +
12ul MiliQ H2O
 +
3ul DNA
 +
1ul SpeI
 +
 +
Incubate in water bath at 37C for 2 hours (total volume 18ul)
 +
add 3.6ul Dye (6X)
 +
 +
Load 6ul into the GEL
 +
 +
Run the GEL at 100V for 30mins
 +
[[File:IGEM Biobrick 2010-05-28 16hr 55min.jpg]]
 +
GEL upper
 +
18-1 18-2 18-3 18-4 18-5 Ladder 33-1 33-2 33-3 33-4 33-5
 +
 +
Gel Lower
 +
35-1 35-2 35-3 35-4 35-5 Ladder 35-6 35-7 35-8 35-9 35-10
 +
 +
 +
=Notebook June 1st, 2010=
 +
 +
 +
Search the Detailed info of the Parts we received
 +
1. BBa_K200000: Colanic acid global regulator (RcsB)
 +
2. BBa_I716213: Cre(TTG Start)
 +
3. BBa_S04114: Lysis
 +
4. BBa_I718007: RBS-Cre
 +
5. BBa_I716212: Cre(GTG Start)
 +
6. BBa_S03975: Lacl+pL Luxr+ LuxpR(Don't have plasmid)
 +
7. BBa_K200002: ygiV
 +
8. BBa_K200003: Ligase(Rfal)
 +
9. BBa_S09373: LacZ
 +
10.BBa_J31000: Invertase Hin from Salmonella Typhimurium
 +
11.BBa_B1006: Stop
 +
12.BBa_K118004: rbs+dxs
 +
13.BBa_K098995: Heat sensitive cl QPI with high promoter
 +
 +
Extra:
 +
BBa_J31001: DNA Invertase
 +
 +
=Sequences for all the parts=
 +
>BBa_K200000 Part-only sequence (654 bp)
 +
atgaacaatatgaacgtaattattgccgatgaccatccgatagtcttgttcggtattcgcaaatcacttgagcaaattgagtgggtgaatgttgtcggcg
 +
aatttgaagactctacagcactgatcaacaacctgccgaaactggatgcgcatgtgttgattaccgatctctccatgcctggcgataagtacggcgatgg
 +
cattaccttaatcaagtacatcaagcgccatttcccaagcctgtcgatcattgttctgactatgaacaacaacccggcgattcttagtgcggtattggat
 +
ctggatatcgaagggatcgtgctgaaacaaggtgcaccgaccgatctgccgaaagctctcgccgcgctccagaaagggaagaaatttaccccggaaagcg
 +
tttctcgcctgttggaaaaaatcagtgctggtggttacggtgacaagcgtctctcgccaaaagagagtgaagttctgcgcctgtttgcggaaggcttcct
 +
ggtgaccgagatcgctaaaaagctgaaccgcagtattaaaaccatcagtagccagaagaaatctgcgatgatgaagctgggtgtcgagaacgatatcgcc
 +
ctgctgaattatctctcttcagtgaccttaagtccggcagataaagactaataa
 +
 +
 +
>BBa_I716213 Part-only sequence (1032 bp)
 +
ttgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatc
 +
gccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcaga
 +
acctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgt
 +
cggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggattcgaaaagaaaacgttgatgccggtgaacgtgcaaaacagg
 +
ctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgc
 +
ttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacg
 +
aaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatc
 +
cgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagc
 +
aactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcc
 +
cgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacagggg
 +
caatggtgcgcctgctggaagatggcgattaa
 +
 +
 +
 +
>BBa_S04114 Part-only sequence (1410 bp)
 +
gattgttctatcagtaatcgaccttattcctaattaaatagagcaaatccccttattgggggtaagacatgaagatgccagaaaaacatgacctgttggc
 +
cgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaaca
 +
gtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgt
 +
ttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaataatcaacgta
 +
aggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgacgtcattgtaggcggagagctatt
 +
tactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggat
 +
gcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattg
 +
atcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcct
 +
gattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgtatgagcagagtcaccgcgattatctccgctctggttatctgcatcatcgtct
 +
gcctgtcatgggctgttaatcattaccgtgataacgccattacctacaaagcccagcgcgacaaaaatgccagagaactgaagctggcgaacgcggcaat
 +
tactgacatgcagatgcgtcagcgtgatgttgctgcgctcgatgcaaaatacacgaaggagttagctgatgctaaagctgaaaatgatgctctgcgtgat
 +
gatgttgccgctggtcgtcgtcggttgcacatcaaagcagtctgtcagtcagtgcgtgaagccaccaccgcctccggcgtggataatgcagcctcccccc
 +
gactggcagacaccgctgaacgggattatttcaccctcagagagaggctgatcactatgcaaaaacaactggatactagagccaggcatcaaataaaacg
 +
aaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttc
 +
tgcgtttata
 +
 +
 +
 +
>BBa_I718007 Part-only sequence (1058 bp)
 +
attaaagaggagaaatactagatgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacc
 +
tgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataa
 +
ccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggc
 +
cagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatg
 +
ccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaa
 +
tctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatg
 +
ttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccg
 +
tctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgc
 +
cctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtc
 +
ggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgta
 +
acctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattaagaatt
 +
 +
 +
 +
>BBa_I716212 Part-only sequence (1032 bp)
 +
ttgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatc
 +
gccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcaga
 +
acctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgt
 +
cggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggattcgaaaagaaaacgttgatgccggtgaacgtgcaaaacagg
 +
ctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgc
 +
ttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacg
 +
aaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatc
 +
cgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagc
 +
aactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcc
 +
cgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacagggg
 +
caatggtgcgcctgctggaagatggcgattaa
 +
 +
 +
>BBa_S03975 Part-only sequence (1082 bp)
 +
aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgaaaaacataaatgccg
 +
acgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaata
 +
ttatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgct
 +
aatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctc
 +
caaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcaca
 +
ttcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaat
 +
atagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatat
 +
taggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaac
 +
aggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagt
 +
cgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatat
 +
actagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaaagaggagaaa
 +
 +
 +
 +
>BBa_K200002 Part-only sequence (486 bp)
 +
atgacaaacctgacactggatgtaaacattatcgatttcccatcaatacctgtggcgatgttgccgcaccgctgtagccctgaattgctcaactacagcg
 +
tggcgaaatttatcatgtggcgtaaagagacggggctttctcctgttaaccaaagccagacttttggcgtcgcctgggacgaccctgccaccaccgcacc
 +
ggaagcgtttcgctttgatatctgcggcagcgttagcgaaccgattcccgataatcgttatggtgtgagcaatggtgaacttaccggtggacgttatgcc
 +
gtggcccgccacgttggcgagctggacgatatttcacacacggtatggggcatcattcgccactggctgcctgcaagcggcgagaaaatgcgtaaagcac
 +
cgattctgtttcactacaccaatcttgccgaaggggtgacagagcagcgactggaaacggatgtttatgtgccgttggcgtgataa
 +
 +
 +
 +
>BBa_K200003 Part-only sequence (1263 bp)
 +
atgctaacatcctttaaacttcattcattgaaaccttacactctgaaatcatcaatgattttagagataataacttatatattatgttttttttcaatga
 +
taattgcattcgtcgataatactttcagcataaaaatatataatatcactgctatagtttgcttattgtcactaattttacgtggcagacaagaaaatta
 +
taatataaaaaaccttattcttcccctttctatatttttaataggcttgcttgatttaatttggtattctgcgtttaaagtagataattcgccatttcgt
 +
gctacttaccatagttatttaaatactgccaaaatatttatatttggttcttttattgttttcttgacactaactagccagctaaaatcaaaaaaagaga
 +
gtgtattatacactttgtattctctgtcatttctaattgctggatatgcaatgtatattaatagcattcatgaaaatgaccgcatttcttttggtgtagg
 +
aacggcaacaggagcagcatattcaacaatgctaatagggatagttagtggcgttgcgattctttatactaagaaaaatcatccttttttatttttatta
 +
aatagttgcgcggtactttatgttctggcgctaacacaaaccagagcaaccctactcctgttccctataatttgtgttgctgcattaatagcttattata
 +
ataaatcacccaagaaattcacttcctctattgttctactaattgctatattagctagcattgttattatatttaataaaccaatacagaatcgctataa
 +
tgaagcattaaatgacttaaacagttataccaatgctaatagtgttacttccctaggtgcaagactggcaatgtacgaaattggtttaaatatattcata
 +
aagtcacctttttcatttagatcagcagagtcacgcgctgaaagtatgaatttgttagttgcagaacacaataggctaagaggggcattggagttttcta
 +
acgtacatctacataatgagataattgaagcagggtcactgaaaggtctgatgggaattttttccacacttttcctctatttttcactattttatatagc
 +
atataaaaaacgagctttgggtttgttgatattaacgcttggcattgtggggattggactcagtgatgtgatcatatgggcacgcagcattccaattatc
 +
attatatccgctatagtcctcttactcgtcattaataatcgtaacaatacaattaattaataa
 +
 +
 +
>BBa_S03973 Part-only sequence (3230 bp)
 +
aaagaggagaaatactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgcc
 +
ttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctt
 +
tgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcac
 +
ggttacgatgcgcccatctacaccaacgtgacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacat
 +
ttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtcgg
 +
ttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgctggagtgac
 +
ggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcataaaccgactacacaaatcagcgatttccatg
 +
ttgccactcgctttaatgatgatttcagccgcgctgtactggaggctgaagttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttcttt
 +
atggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattatcgatgagcgtggtggttatgccgatcgcgtcacactacgtctg
 +
aacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcggtggttgaactgcacaccgccgacggcacgctgattgaagcagaag
 +
cctgcgatgtcggtttccgcgaggtgcggattgaaaatggtctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcatca
 +
tcctctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcattatccg
 +
aaccatccgctgtggtacacgctgtgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggcatggtgccaatgaatcgtctga
 +
ccgatgatccgcgctggctaccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggggaa
 +
tgaatcaggccacggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccgacacc
 +
acggccaccgatattatttgcccgatgtacgcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtccatcaaaaaatggctttcgctac
 +
ctggagagacgcgcccgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgtcagtatcc
 +
ccgtttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgatgaaaacggcaacccgtggtcggcttacggcggtgattttggc
 +
gatacgccgaacgatcgccagttctgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaagcaaaacaccagcagcagtttt
 +
tccagttccgtttatccgggcaaaccatcgaagtgaccagcgaatacctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggatgg
 +
taagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttgattgaactgcctgaactaccgcagccggagagcgccgggcaa
 +
ctctggctcacagtacgcgtagtgcaaccgaacgcgaccgcatggtcagaagccgggcacatcagcgcctggcagcagtggcgtctggcggaaaacctca
 +
gtgtgacgctccccgccgcgtcccacgccatcccgcatctgaccaccagcgaaatggatttttgcatcgagctgggtaataagcgttggcaatttaaccg
 +
ccagtcaggctttctttcacagatgtggattggcgataaaaaacaactgctgacgccgctgcgcgatcagttcacccgtgcaccgctggataacgacatt
 +
ggcgtaagtgaagcgacccgcattgaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccgaagcagcgttgttgcagtgcacgg
 +
cagatacacttgctgatgcggtgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgatgg
 +
tagtggtcaaatggcgattaccgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcctgaactgccagctggcgcaggtagcagag
 +
cgggtaaactggctcggattagggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatctgccattgtcagacatgtata
 +
ccccgtacgtcttcccgagcgaaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatcag
 +
ccgctacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggctgaatatcgacggtttccatatggggatt
 +
ggtggcgacgactcctggagcccgtcagtatcggcggaatttcagctgagcgccggtcgctaccattaccagttggtctggtgtcaaaaataatactaga
 +
gccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggct
 +
caccttcgggtgggcctttctgcgtttata
 +
 +
 +
 +
>BBa_J31000 Part-only sequence (573 bp)
 +
atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaag
 +
accgtatcagtggcaagattgcaaaccgccccggcctgaaacgggcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagact
 +
gggccgtagcgtgaaaaatctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcg
 +
atggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaatcgtcgagcgaacccttgccggactggctgccgccagagcgc
 +
aaggacgactgggagggcgccctcgggcgatcaacaaacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaattagctat
 +
tatttttggtattggcgtatccaccttatacagatactttccggcaagcagtataaaaaaacgaatgaattaa
 +
 +
 +
 +
>BBa_K118004 Part-only sequence (1882 bp)
 +
ctcaaggaggtactagatgagttttgatattgccaaatacccgaccctggcactggtcgactccacccaggagttacgactgttgccgaaagagagttta
 +
ccgaaactctgcgacgaactgcgccgctatttactcgacagcgtgagccgttccagcgggcacttcgcctccgggctgggcacggtcgaactgaccgtgg
 +
cgctgcactatgtctacaacaccccgtttgaccaattgatttgggatgtggggcatcaggcttatccgcataaaattttgaccggacgccgcgacaaaat
 +
cggcaccatccgtcagaaaggcggtctgcacccgttcccgtggcgcggcgaaagcgaatatgacgtattaagcgtcgggcattcatcaacctccatcagt
 +
gccggaattggtattgcggttgctgccgaaaaagaaggcaaaaatcgccgcaccgtctgtgtcattggcgatggcgcgattaccgcaggcatggcgtttg
 +
aagcgatgaatcacgcgggcgatatccgtcctgatatgctggtgattctcaacgacaatgaaatgtcgatttccgaaaatgtcggcgcgctcaacaacca
 +
tctggcacagctgctttccggtaagctttactcttcactgcgcgaaggcgggaaaaaagttttctctggcgtgccgccaattaaagagctgctcaaacgc
 +
accgaagaacatattaaaggcatggtagtgcctggcacgttgtttgaagagctgggctttaactacatcggcccggtggacggtcacgatgtgctggggc
 +
ttatcaccacgctaaagaacatgcgcgacctgaaaggcccgcagttcctgcatatcatgaccaaaaaaggtcgtggttatgaaccggcagaaaaagaccc
 +
gatcactttccacgccgtgcctaaatttgatccctccagcggttgtttgccgaaaagtagcggcggtttgccgagctattcaaaaatctttggcgactgg
 +
ttgtgcgaaacggcagcgaaagacaacaagctgatggcgattactccggcgatgcgtgaaggttccggcatggtcgagttttcacgtaaattcccggatc
 +
gctacttcgacgtggcaattgccgagcaacacgcggtgacctttgctgcgggtctggcgattggtgggtacaaacccattgtcgcgatttactccacttt
 +
cctgcaacgcgcctatgatcaggtgctgcatgacgtggcgattcaaaagcttccggtcctgttcgccatcgaccgcgcgggcattgttggtgctgacggt
 +
caaacccatcagggtgcttttgatctctcttacctgcgctgcataccggaaatggtcattatgaccccgagcgatgaaaacgaatgtcgccagatgctct
 +
ataccggctatcactataacgatggcccgtcagcggtgcgctacccgcgtggcaacgcggtcggcgtggaactgacgccgctggaaaaactaccaattgg
 +
caaaggcattgtgaagcgtcgtggcgagaaactggcgatccttaactttggtacgctgatgccagaagcggcgaaagtcgccgaatcgctgaacgccacg
 +
ctggtcgatatgcgttttgtgaaaccgcttgatgaagcgttaattctggaaatggccgccagccatgaagcgctggtcaccgtagaagaaaacgccatta
 +
tgggcggcgcaggcagcggcgtgaacgaagtgctgatggcccatcgtaaaccagtacccgtgctgaacattggcctgccggacttctttattccgcaagg
 +
aactcaggaagaaatgcgcgccgaactcggcctcgatgccgctggtatggaagccaaaatcaaggcctggctggcataataa
 +
 +
 +
 +
 +
>BBa_K098995 Part-only sequence (935 bp)
 +
tttatggctagctcagtcctaggtacaatgctagctactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagctt
 +
gaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcag
 +
gcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttc
 +
aatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcaggg
 +
atgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttg
 +
aaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgattt
 +
ctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatg
 +
atcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctgatactagagtcacactggctcacctt
 +
cgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagtaacaccgtgcgtg
 +
ttgactattttacctctggcggtgataatggttgc
 +
 +
 +
=Summary for Week June 7th to June 11th=
 +
  6-7-10:
 +
a) Miniprep 2 pellet each for pBAD33, pBAD35, pBAD18, ygiV (attach to the cell wall), RcsB(expression factor that increase the clonic acid).
 +
 +
b) enzyme digestion for pBAD33, vgiV, pBAD18, and RcsB.
 +
 +
c) Gel extract for vgiV and RcsB and purification
 +
 +
d) PCR purification for pBAD18 and pBAD33
 +
 +
e) overnight ligation (set up by Sarah)
 +
 +
  6-8-10:
 +
a) transformation pBAD18-RcsB and pBAD33-vgiV into DH10B E. Coli.
 +
(Sarah and Hannah plates the cloning of pBAD18-RcsB and pBAD33-vgiV)
 +
 +
b) Miniprep
 +
For Encryption Project: BBa_I11020, BBa_K199021, BBa_K2902006, BBa_200021, BBa_B1006-A, BBa_B1006-B, BBa_E0240
 +
For Drug Project: 2 pellets of each, pBAD18, pBAD33, pBAD35, vgiV, RcsB
 +
 +
  6-9-10:
 +
 +
a) For the RcsB and VgiV plates, only a few colonies growed (they are really tiny, kindda hard to see, so we put it back to the incubator growing for couple of more hours)
 +
 +
b) Did the cloning of RcsB into pBAD18 and vgiV into pBAD33 again with different insert/vector ratio.
 +
 +
c) Plate the pellet and control.
 +
 +
  6-10-10:
 +
 +
a) The pBAD18-RcsB plate has colonies growed.
 +
 +
b) Set up the screening with colony PCR
 +
 +
c)      Made MRS Broth, MRS plates, no antibiotic plates, Amp+Kan plates, and CM plates with Mary.

Latest revision as of 22:03, 24 October 2010

Contents

Note book of July 12th,2010

1. Screening for the Rfal into LacI-RBS cloning

Gel Picture

File:IGEM 2010-07-12 13hr 39min.jpg

File:IGEM 2010-07-12 17hr 33min.jpg

2. Primer Design For the Cloning LacI-RBS-ygiV-RBS-Rfal-RBS-RFP-Terminator

One is for Rfal: the forward primer has a XbaI and RBS in it; the reverse primer is on the backbone, and has a XmaI site on it.

pRBS-Rfal_Fwd: TGCTCTAGA AAAGAGGAGAAAATGCTAACATCCTTTAAACT

pRBS-Rfal_Rev: CCCCCCGGGTTAATTAATTGTATTGTTACGATTAT


The other one is For RFP (I13507): The forward primer has a XmaI site on it and starts from the backbone; the reverse primer starts on the backbone too. [The original plasmid, I13507 has a structur of RBS-RFP-terminator]

pRFP(I13507)_Fwd: CCCCCCGGGgagaaagaggagaaatactagatgg

pRFP(I13507)_Rev: AGTCAGTGAGCGAGGAAG

Note book of July 13th,2010

1. Primer Designs:

Tyler helped me check the primers, and he get back to me with his comments:

pRBS-RfaI_Fwd - Tm for primer portion is too low(oligocalc says 44), add 4 bases from the gene sequence, try to have 3' end be G or C

pRBS-RfaI_Rev - GC content of the priming portion is way too low, try to get it to at least above 30%, you can move down the gene since you are at the ending site, also try to have the 3' end of the primer be a G or C

pRFP(I13507)_Fwd - good, I usually add a 5 base overhang, but 3 should be ok for the enzyme you are using

pRFP(I13507)_Fwd - good

So I redesigned my primers with

Detailed information are in: File:Primer Design for Rfal and RFP - 2.pdf

Primers For Rfal

Tm : 46 GC:41% Fwd: gagatgctaacatcctt (17bp)

pRBS-RfaI_Fwd : TGCTCTAGAAAAGAGGAGAAAtacgagatgctaacatcctt

Name Sequence Tm°C CG% nt A T C seq_1 tgctctagaaaagaggagaaatacgagatgctaacatcctt 75.1 39.0 41 16.0 9.0 7.0 9.0 417600.0 12674.4 2.4 30.4

Name Sequence Tm°C CG% nt A T C G seq_1 gagatgctaacatcctt 49.9 41.2 17 5.0 5.0 4.0 3.0 164400.0 5169.4 6.1 31.4

Tm:49 GC:40% Rev: taataatactagtagcggcc （17bp）

pRBS-RfaI_Rev: GCCGCTACTAGTATTATTA [SpeI]

Name Sequence Tm°C CG% nt A T C G seq_1 gccgctactagtattatta 49.6 36.8 19 5.0 7.0 4.0 3.0 185500.0 5777.8 5.4 31.1

Primers For RFP

pRFP(I13507)_Fwd: CTAGTCTAGAgagaaagaggagaaatactagatgg [XbaI]

Name Sequence Tm°C CG% nt A T C G seq_1 ctagtctagagagaaagaggagaaatactagatgg 65.7 40.0 35 15.0 6.0 3.0 11.0 377400.0 10950.2 2.6 29.0

Name Sequence Tm°C CG% nt A T C G seq_1 gagaaagaggagaaatactagatgg 59.8 40.0 25 12.0 3.0 1.0 9.0 278000.0 7861.2 3.6 28.3

pRFP(I13507): AGTCAGTGAGCGAGGAAG (cttcctcgctcactgact)

Name Sequence Tm°C CG% nt A T C G seq_1 agtcagtgagcgaggaag 58.8 55.6 18 6.0 2.0 2.0 8.0 191900.0 5637.7 5.2 29.4

Name Sequence Tm°C CG% nt A T C G seq_1 agtcagtgagcgaggaag 58.8 55.6 18 6.0 2.0 2.0 8.0 191900.0 5637.7 5.2 29.4

Note book of July 14th,2010

Cloning of LacI-RBS-ygiV with a terminator

a. Double digestion

b. Gel extraction and purificaiton

2.jpg

c. overnight ligation

Note book of July 15th,2010

Cloning of LacI-RBS-Rfal with a terminator

a. Double digestion

b. Gel extraction and purificaiton

1.jpg

c. 2 hours bench top ligation

d. Electroporation of LacI-RBS-ygiV-terminator and LacI-RBS-Rfal-terminator into DH10B cells.

e. Plate on Amp plates

f. run a gel to check the digestion of the backbone

3.jpg

Note book of July 16th,2010

A.Check the plate

1. LacI-RBS-ygiV-terminator

the pallet plate has about 200 colonies

the control has 8 colonies


2.LacI-RBS-Rfal-terminator

the pallet plate has about 150 colonies

the control doesn't have colonies


B.Screening



Note book of July 6th,2010

A. Start the clone of Rfal into K200021(LacI+RBS)

1.cut the backbone, K200021, with PstI-HF and SpeI for 2 hours. cut the insert, Rfal, with PstI-HF and XbaI for 2 hours.

2.Gel Extract

K200021: 3264bp Rfal:1263bp

File:IGEM 2010-07-06 13hr 05min.jpg

After the gel extraction, the concentrations are:

K200021: 33.1ng/ul Rfal: 53.9ng/ul

3.Ligation

for doing a K200021:Rfal is 1:4 ligation, 100ng of K200021 and 154.8ng of Rfal are needed. Based on the DNA concentration, add 3ul K200021 and 3ul Rfal for ligation.

Stored at 16C overnight.


Note book of July 7th,2010

A. Cloning of LacI-RBS-Rfal

1.Electroporation

LacI-RBS-Rfal has a time constant 4.8;

The control has a time constant 4.7;

2.Plate on two Amp+Kan plate. Stored in a 37C incubator.

B. Cloning of LacI-RBS-ygiV into RBS

1.cut the backbone, RBS, with EcoRI-HF and XbaI, and cut the insert LacI-RBS-ygiV with EcoRI-HF and SpeI.

2.Gel Extraction

RBS:3200bp LacI-RBS-ygiV:543bp

File:IGEM 2010-07-06 17hr 00min.jpg

after the gel extraction, the concentrations are:

RBS: 20.7ng/ul

lacI-RBS-ygiV: 19.8ng/ul

3.Ligation

For a 1 to 3 backbone:insert ratio, we need 100ng of RBS and 107.3ng of LacI-RBS-ygiV for Ligation. THerefore, add 3.7ul RBS and 4.3ul LacI-RBS-ygiV to ligate. Store at 4C overnight.

C.Run a gel to check the cutting peices

The orders are:

L-ygiV-ES; L-ygiV uncut; Rfal-PX; Rfal uncut; RBS-EX; RBS uncut; LacI-PS; LacI uncut; Ladder

unluckily, the first lane for L-ygiV-ES didn't show up any band.

File:IGEM 2010-07-07 11hr 24min.jpg

The rest of the bands are all correct.

Then run a gel for L-ygiV-ES and L-ygiV uncut by loading more DNA on the gel

File:IGEM 2010-07-07 13hr 09min.jpg

Now, this shows that the L-ygiV-ES is correct.


Note book of July 8th,2010

A. Transformation of the Clone LacI-RBS-ygiV-RBS

1. Electroporation

LacI-RBS-ygiV-RBS: 4.7

Control: 4.9

2. Plate on two Amp plate.

B. Run a gel to check the Ligation of LacI-RBS-Rfal and LacI-RBS-ygiV-RBS

the orders are Ladder LacI-RBS-Rfal, control, LacI-RBS-ygiV-RBS, control

File:IGEM 2010-07-07 12hr 48min.jpg

C. Colony PCR for the LacI-RBS-Rfal Clone

1.The control plate only has one colony, compared with the regular plate with about 100 colonies.

2.picked 14 colonies for screening.

Gel for Colony PCR:

File:IGEM 2010-07-08 13hr 54min.jpg

Run for 5mins longer and add more EB

File:IGEM 2010-07-08 14hr 20min.jpg

No colony shows the correct band (around 1500bp)

Note book of July 9th,2010

A Cloning of LacI-RBS-ygiV into RBS, and Rfal into LacI-RBS.

Add 1.5mg of DNA into each tube:

RBS(B0034):5.3ul template; Add 1ul EcoRI-HF to digest 1 hour and inactivate at 65C for 20mins. Then Add 1ul of XbaI to digest an additional hour.

LacI-RBS(K200021): 9.5ul template; Add 1ul PstI-HF to digest 1 hour and inactivate at 80C for 20mins. Then Add 1ul of SpeI to digest an additional hour.

Rfal: 3.1ul template digest with 1ul PstI-HF and 1ul XbaI

LacI-ygiV: 4.4ul tempalte digest with 1ul EcoRI-HF and 1ul SpeI

Gel after 1 hour inactivation of EcoRI-HF in RBS and PstI-HF in LacI-RBS:

Orders are:

RBS cut with EcoRI-HF, RBS uncut, Ladder, LacI-RBS cut with PstI-HF, LacI-RBS uncut.

File:IGEM 2010-07-09 13hr 27min.jpg



Note book of June 28th,2010

a. Digestion of K200021 (LacI+RBS) with PstI-HF and SpeI, and digest ygiV and Rfal with PstI-HF and XbaI.

b. Gel Extraction and purification:

1. Gel

K200021-PS

ygiV and Rfal

File:IGEM 2010-06-27 13hr 19min.jpg

Concentration of the cutting peices: K200021-PS

ygiV-PX

Rfal-PX

Gel for the purification product

File:IGEM 2010-06-28 14hr 10min.jpg

c. Set up an overnight ligation

Note book of June 29th,2010

a. Transformation

pLacI-RBS-ygiV-PX: 4.1

pLacI-RBS-ygiV-PX(C): 3.9

pLacI-RBS-Rfal-PX: 4.0

pLacI-RBS-Rfal-PX(C):3.9

b. Plate on Amp100 plates.


Note book of June 30th,2010

Re-plan the project. Figure out all the cloning need to be done by the end of the summer. Detailed information please see the spread sheet on Sarah's page.

Note book of July 1st,2010

A. Colony PCR of the LacI-RBS-ygiV and LacI-RBS-Rfal clone.

Upper: LacI-RBS-Rfal Clone

Lower: LacI-RBS-ygiV clone

File:IGEM 2010-07-01 14hr 49min-2.jpg

The LacI-RBS-ygiV clone shows up at the right length.


B. Innoculate 5 liquid culture of the ygiV clone.


Note book of July 2nd,2010

A. Made 3 freezer stocks of LacI-RBS-ygiV clone

B. Miniprep LacI-RBS-ygiV

LacI-RBS-ygiV-1: 388.7ng/ul LacI-RBS-ygiV-2: 357.0ng/ul LacI-RBS-ygiV-3: 350.2ng/ul LacI-RBS-ygiV-4: 255.0ng/ul


Note book of June 21st,2010

a.Minipreped 3 sets each for pBAD33BB, pBAD35BB, ygiV, and Rfal.

b.Set up a overnight digestions that cut pBAD33BB and pBAD35BB with PstI-HF and SpeI, and cut ygiV and Rfal with PstI-HF and XbaI. (37C overnight)

c.Screening for the 2nd time ygiV and Rfal cloning.

ygiV:

File:IGEM 2010-06-21 bads2 Peter ScanA.jpg

Rfal:

File:IGEM 2010-06-21 bads2 Peter ScanB.jpg

They all shows up at the same length as the positive control, which means we didn't get the desired cloning.

Note book of June 22nd,2010

a.Gel extraction of pBAD33BB, ygiV and Rfal.

For pBAD33BB

File:IGEM 2010-06-23 12hr 45min.jpg

For ygiV(486bp) and Rfal(1269bp)

File:IGEM 2010-06-23 12hr 44min.jpg

b.Gel purification of pBAD33BB, ygiV and Rfal.

after the gel purificaion, the concentrations are:

pBAD33BB-PX: 39.7ng/ul

ygiV: 25.7ng/ul

Rfal: 33.5ng/ul

c.Set up an overnight ligation with Insert/Vector ratio equals 4.

tubeA

pBAD33BB: 3.8ul

ygiV: 2.2ul


tubeB

pBAD33BB: 3.8ul

Rfal: 4.2ul


tube C (control)

pBAD33BB: 3.8ul

(16C overnight)

Note book of June 23rd,2010

a. Transformation

pBAD33BB-ygiV: 4.4 1.8

pBAD33BB-Rfal: 4.4 1.8

Control: 4.3 1.8

b. Plating on CM plate

c. run the gel for ligation product

File:Pflegerlab 2010-06-24 11hr 07min.jpg


Note book of June 24th,2010

a. Check the transformation plate

pBAD33BB-ygiV:

Photo.JPG


pBAD33BB-Rfal:

File:Photo2.JPG


Control:

File:Photo1.JPG

b. pick 12 colonies from pBAD33BB-Rfal plate and 10 colonies from pBAD33BB-ygiV plate for the colony PCR screening.

ygiV-plate B

File:Plate B of ygiV-pBAD33BB screening pflegerlab 2010-06-25 14hr 45min.jpg


Rfal-plate B

File:Plate A of Rfal-pBAD33BB screening pflegerlab 2010-06-25 14hr 42min.jpg

c. pick colonies from both plates into liquid cultures. Grow overnight. (5 from plateA and 5 from plateB)


Note book of June 25th,2010

a. miniprep 10 liquid culture for Screening.

b. Digest with BamHI-HF and PstI-HF

c. run the gel for the screening

File:Screening.jpg


Summary of Week June 14th to June 18th, 2010

 06-14-10

A. Miniprep

Miniprep All the new parts received

1. K082006 52.7ng/ul

2. K142001 196.7ng/ul

3. K173004 330.2ng/ul

4. pBAD35BB 102.4ng/ul

5. pBAD33BB 61.5ng/ul

6. pBAD35BB 105.8ng/ul

7. K142003 212.8ng/ul

8. K137113 174.8ng/ul

9. K142002 222.5ng/ul

10.pBAD35BB 117.2ng/ul

11.K200003 207.2ng/ul

12.K142000 177.4ng/ul


B. Ligation for vgiV and pBAD33BB

Ligation of vgiV and pBAD33BB with a molar ratio 3:1

one for 2 hours, one for overnight


C. Thansformation of the vgiV cloning

Transformed the 2-hour ligation and plated 

 06-15-10

A. Screening of the cloning of vgiV into pBAD33BB

The 2-hour ligation only had two colonies. Screening with Colony PCR but didn't see any band.

B. Transformation of vgiV cloning

Transformed the overnight ligation and plated in CM argar plate.

C. Restriction Mapping of the Newly Receiving Parts

The Correct Parts are

Parts Band 1@ Band2@ Band3@

K112808 2500 1406

K137113 2200 650

K173004 3200 2100 1106

K142000 2100 1100

K142001 2100 1100

K142002 2100 1100

K142003 2100 1100

K082006 3200 750

K200003 3200 1300 


 06-16-10

A. Screening of the cloning of vgiV into pBAD33BB

Saw a lot colony on both the 100ul plate and the pallet plate. The Control plate (backbone only) only had one colony.

Pick up 10 colonies from each plate( 100ul plate and pallet plate). Colony PCR for the screening

Run the Gel for the Coloy PCR, but didn't see the correct band.

(The band is about 200bp, which means the back bone ligate itself.)

B. Cloning of Rfal into pBAD35BB

Digest pBAD35BB with PstI-HF and XbaI, and digest Rfal with PstI-HF and SpeI

Gel extraction and purification.

Ligate with a insert/vector ratio 3:1

Ligate at 16C overnight 

 06-17-10

A. Another Screening of the cloning of vgiV into pBAD33BB

Pick another 10 colonies from both the 100ul plate and the pallet plate.

Proceed the Colony PCR

Run the Gel, but still didn't see the correct band(about 700bp).

Do see a band down at 200bp, same length as the positive control. Therefore, confirmed that the colonies are just transformed with the backbone.


B. Cloning of Rfal into pBAD35BB

Transform the Rfal cloning and the control into DH10B

Plated on Kan plate.



Cloning of pET28b+RFP File:Cloning of pET28b-RFP.pdf

Notebook May 25th, 2010

BioBrick pBAD35 a) Target Vector: pBAD35 (about 4200bp, 4.2kb) 

  pBAD BioBrick Primers:
  Tm value: Fwd: 72.0C
            Rev: 68.1C

b) General Procedure 1. PCR amplify 2. Pour 2 gels during this time 3. Check PCR on 1st Gel 4. Add 1ul DpnI/rxn for 1hr at 37C 5. PCR clean up or gel extraction (depends on whether you see a bright band at right place) 6. XbarI Digest 7. PCR clean up 8. Ligate

c) Cycle Design 98C 1min 98C 15s 73C 30s 33X 72c 126S 72c 5mins 4c forever

d)Phusion Mix Water: 35ul 5Xbuffer:10ul template:2ul Primer FW:0.5ul Primer RV:0.5ul dNTP:1ul Phusion Enzyme:1ul

Note: Keep the primers and Enzyme on ICE

RESULT 1st Gel Lane Band@ 35A 3-4kb 35B 3-4kb 18 4kb 33 5kb 34 4kb and 2.5kb(wrong)

File:IGEM Biobrick first 2010-05-25 15hr 09min.jpg

Protocol of PCR Purification: File:PCR purification-Qiagen.pdf

DIGESTION

pBAD35-A DNA: 40ul Buffer4: 5ul BSA: 0.5ul Water: 3.5ul XbaI: 1ul

pBAD35-B DNA: 40ul Buffer4: 5ul BSA: 0.5ul Water: 2.5ul XbaI: 2ul

Leave the digestion on a 37c water bath overnight

Inoculation for Encryption Project

10ml LB in each tube and add 10ul Antibiotic A: BBa_K118004 B: BBa_K098995 C: BBa_I718008 D: BBa_B1006

Notebook May 26th, 2010

a)PCR purification(refer to protocol on the protocol from Notebook May 25th 2010) DNA Conc(ng/ul) pBAD35-A 57.6 pBAD35-B 69.7

b)Ligation (Peter did all the ligation) Ligate on pBAD18,33,34,35A-B 100ng/10ul rxn 2hrs bench ligation

c)Electroporation transformation

Use DH10B Add 1ul of plasmid Let it sits on ice for 5 mins

after the shock, immediately add 950ul LB and mix well Transfer to centrifuge tube

DNA Time 35 4.2 33 4.4 18 4.2

(control) 35 4.5 33 4.2 18 4.2

Let them grow in the 37c shaker for 1hr.

Plate 50ul of cells


Miniprep for Nate Pant's Project Miniprep Plasmid information A: BBa_K118004 B: BBa_K098995 C: BBa_I718008 D: BBa_B1006

Centrifuge at 30000rpm for 10mins

Follow the Miniprep Protocol: File:Qiagenmini.pdf Result Measured by Nanodrop

DNA Conc(ng/ul) 260/280 A 324.0 1.97 B 288.3 1.98 C 418.2 1.96 D 276.6 1.97


Notebook May 27th, 2010

Check the colonies in the plates.

Picked 10 colonies from pBAD35B Picked 5 colonies from pBAD33 Picked 5 colonies from pBAD18

Inoculate them in 5ml LB with antibiotics

Parts Checking

Concentration: BBa_K200000: 199.9ng/ul BBa_I716213: 186.5ng/ul BBa_S04114: 543.6ng/ul BBa_I718007: 146.1ng/ul BBa_I716212: 155.8ng/ul BBa_S03975: BBa_K200002: 309.3ng/ul BBa_K200003: 105.4ng/ul BBa_S09373: 243.1ng/ul BBa_J31000: 278.3ng/ul BBa_B1006: 276.6ng/ul BBa_K118004: 324.0ng/ul BBa_K098995: 288.3ng/ul

Single Digestion Test With EcoRI for 1. BBa_K200000: 2. BBa_I716213: 3. BBa_S04114: 4. BBa_I718007: 5. BBa_I716212: 6. BBa_S03975:(Don't have plasmid) 7. BBa_K200002: 8. BBa_K200003: 9. BBa_S09373: 10.BBa_J31000: 11.BBa_B1006: 12.BBa_K118004: 13.BBa_K098995:

Protocol 1.8ul Buffer3(10X) 0.18ul BSA(100X) 12ul MiliQ H2O 3ul DNA 1ul EcoRI

Incubate in water bath at 37C for 2 hours (total volume 18ul) add 3.6ul Dye (6X)

Load 6ul into the GEL Gel: File:2010-05-27 Map - Single digest.jpg

Gel Description: 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13

Results: 3, 9, 11, and 12 don't have the correct bands

So run the single digestion for all four again with 2 hours Gel: File:IGEM Single Digestion Second 2010-05-28 14hr 39min.jpg

Gel Description: 3, 9, Ladder, 11, 12

Result: Still not correct

Double Digestion Find one enzyme cutting site with the gene 1. BBa_K200000: Buffer:4 Enzyme:AflII EcoRI 2. BBa_I716213: Buffer:2 Enzyme:AflIII SpeI 3. BBa_S04114: Buffer:3 Enzyme:EcoRV EcoRI 4. BBa_I718007: Buffer:3 Enzyme:EcoRV EcoRI 5. BBa_I716212: Buffer:3 Enzyme:EcoRV EcoRI 6. BBa_S03975:(Don't have plasmid) 7. BBa_K200002: (don't have enzyme stock that can cut within the gene) 8. BBa_K200003: Buffer:4 Enzyme:NheI EcoRI 9. BBa_S09373: Buffer:3 Enzyme:EcoRV EcoRI 10.BBa_J31000: Buffer:3 Enzyme:BglI EcoRI 11.BBa_B1006: (Too small, cannot cut within the gene) 12.BBa_K118004: Buffer:3 Enzyme:EcoRV EcoRI 13.BBa_K098995: Buffer:2 Enzyme:HindIII EcoRI

Protocol 1.8ul NEB Buffer(10X) 0.18ul BSA(100X) 11ul MiliQ H2O 3ul DNA 1ul Enzyme1 1ul Enzyme2

Incubate in water bath at 37C for 2 hours (total volume 18ul) add 3.6ul Dye (6X)

Load 6ul into the GEL

Gel File:IGEM Parts Double Digestion 2010-05-28 14hr 54min.jpg File:IGEM Parts Double Digestion White 2010-05-28 14hr 57min.jpg

Result Only 1, 2, 4, 5, 8, 13 show the correct bands


Notebook May 28th, 2010

Miniprep for the screening

Restriction Enzyme Mapping for all the 20 screening plasmid

1.8ul Buffer3(10X) 0.18ul BSA(100X) 12ul MiliQ H2O 3ul DNA 1ul SpeI

Incubate in water bath at 37C for 2 hours (total volume 18ul) add 3.6ul Dye (6X)

Load 6ul into the GEL

Run the GEL at 100V for 30mins File:IGEM Biobrick 2010-05-28 16hr 55min.jpg GEL upper 18-1 18-2 18-3 18-4 18-5 Ladder 33-1 33-2 33-3 33-4 33-5

Gel Lower 35-1 35-2 35-3 35-4 35-5 Ladder 35-6 35-7 35-8 35-9 35-10


Notebook June 1st, 2010

Search the Detailed info of the Parts we received 1. BBa_K200000: Colanic acid global regulator (RcsB) 2. BBa_I716213: Cre(TTG Start) 3. BBa_S04114: Lysis 4. BBa_I718007: RBS-Cre 5. BBa_I716212: Cre(GTG Start) 6. BBa_S03975: Lacl+pL Luxr+ LuxpR(Don't have plasmid) 7. BBa_K200002: ygiV 8. BBa_K200003: Ligase(Rfal) 9. BBa_S09373: LacZ 10.BBa_J31000: Invertase Hin from Salmonella Typhimurium 11.BBa_B1006: Stop 12.BBa_K118004: rbs+dxs 13.BBa_K098995: Heat sensitive cl QPI with high promoter

Extra: BBa_J31001: DNA Invertase

Sequences for all the parts

>BBa_K200000 Part-only sequence (654 bp) atgaacaatatgaacgtaattattgccgatgaccatccgatagtcttgttcggtattcgcaaatcacttgagcaaattgagtgggtgaatgttgtcggcg aatttgaagactctacagcactgatcaacaacctgccgaaactggatgcgcatgtgttgattaccgatctctccatgcctggcgataagtacggcgatgg cattaccttaatcaagtacatcaagcgccatttcccaagcctgtcgatcattgttctgactatgaacaacaacccggcgattcttagtgcggtattggat ctggatatcgaagggatcgtgctgaaacaaggtgcaccgaccgatctgccgaaagctctcgccgcgctccagaaagggaagaaatttaccccggaaagcg tttctcgcctgttggaaaaaatcagtgctggtggttacggtgacaagcgtctctcgccaaaagagagtgaagttctgcgcctgtttgcggaaggcttcct ggtgaccgagatcgctaaaaagctgaaccgcagtattaaaaccatcagtagccagaagaaatctgcgatgatgaagctgggtgtcgagaacgatatcgcc ctgctgaattatctctcttcagtgaccttaagtccggcagataaagactaataa


>BBa_I716213 Part-only sequence (1032 bp) ttgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatc gccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcaga acctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgt cggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggattcgaaaagaaaacgttgatgccggtgaacgtgcaaaacagg ctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgc ttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacg aaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatc cgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagc aactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcc cgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacagggg caatggtgcgcctgctggaagatggcgattaa


>BBa_S04114 Part-only sequence (1410 bp) gattgttctatcagtaatcgaccttattcctaattaaatagagcaaatccccttattgggggtaagacatgaagatgccagaaaaacatgacctgttggc cgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaaca gtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgt ttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaataatcaacgta aggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgacgtcattgtaggcggagagctatt tactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggat gcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattg atcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcct gattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgtatgagcagagtcaccgcgattatctccgctctggttatctgcatcatcgtct gcctgtcatgggctgttaatcattaccgtgataacgccattacctacaaagcccagcgcgacaaaaatgccagagaactgaagctggcgaacgcggcaat tactgacatgcagatgcgtcagcgtgatgttgctgcgctcgatgcaaaatacacgaaggagttagctgatgctaaagctgaaaatgatgctctgcgtgat gatgttgccgctggtcgtcgtcggttgcacatcaaagcagtctgtcagtcagtgcgtgaagccaccaccgcctccggcgtggataatgcagcctcccccc gactggcagacaccgctgaacgggattatttcaccctcagagagaggctgatcactatgcaaaaacaactggatactagagccaggcatcaaataaaacg aaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttc tgcgtttata


>BBa_I718007 Part-only sequence (1058 bp) attaaagaggagaaatactagatgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacc tgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataa ccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggc cagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatg ccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaa tctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatg ttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccg tctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgc cctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtc ggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgta acctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattaagaatt


>BBa_I716212 Part-only sequence (1032 bp) ttgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatc gccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcaga acctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgt cggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggattcgaaaagaaaacgttgatgccggtgaacgtgcaaaacagg ctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgc ttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacg aaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatc cgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagc aactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcc cgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacagggg caatggtgcgcctgctggaagatggcgattaa


>BBa_S03975 Part-only sequence (1082 bp) aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgaaaaacataaatgccg acgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaata ttatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgct aatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctc caaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcaca ttcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaat atagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatat taggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaac aggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagt cgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatat actagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaaagaggagaaa


>BBa_K200002 Part-only sequence (486 bp) atgacaaacctgacactggatgtaaacattatcgatttcccatcaatacctgtggcgatgttgccgcaccgctgtagccctgaattgctcaactacagcg tggcgaaatttatcatgtggcgtaaagagacggggctttctcctgttaaccaaagccagacttttggcgtcgcctgggacgaccctgccaccaccgcacc ggaagcgtttcgctttgatatctgcggcagcgttagcgaaccgattcccgataatcgttatggtgtgagcaatggtgaacttaccggtggacgttatgcc gtggcccgccacgttggcgagctggacgatatttcacacacggtatggggcatcattcgccactggctgcctgcaagcggcgagaaaatgcgtaaagcac cgattctgtttcactacaccaatcttgccgaaggggtgacagagcagcgactggaaacggatgtttatgtgccgttggcgtgataa


>BBa_K200003 Part-only sequence (1263 bp) atgctaacatcctttaaacttcattcattgaaaccttacactctgaaatcatcaatgattttagagataataacttatatattatgttttttttcaatga taattgcattcgtcgataatactttcagcataaaaatatataatatcactgctatagtttgcttattgtcactaattttacgtggcagacaagaaaatta taatataaaaaaccttattcttcccctttctatatttttaataggcttgcttgatttaatttggtattctgcgtttaaagtagataattcgccatttcgt gctacttaccatagttatttaaatactgccaaaatatttatatttggttcttttattgttttcttgacactaactagccagctaaaatcaaaaaaagaga gtgtattatacactttgtattctctgtcatttctaattgctggatatgcaatgtatattaatagcattcatgaaaatgaccgcatttcttttggtgtagg aacggcaacaggagcagcatattcaacaatgctaatagggatagttagtggcgttgcgattctttatactaagaaaaatcatccttttttatttttatta aatagttgcgcggtactttatgttctggcgctaacacaaaccagagcaaccctactcctgttccctataatttgtgttgctgcattaatagcttattata ataaatcacccaagaaattcacttcctctattgttctactaattgctatattagctagcattgttattatatttaataaaccaatacagaatcgctataa tgaagcattaaatgacttaaacagttataccaatgctaatagtgttacttccctaggtgcaagactggcaatgtacgaaattggtttaaatatattcata aagtcacctttttcatttagatcagcagagtcacgcgctgaaagtatgaatttgttagttgcagaacacaataggctaagaggggcattggagttttcta acgtacatctacataatgagataattgaagcagggtcactgaaaggtctgatgggaattttttccacacttttcctctatttttcactattttatatagc atataaaaaacgagctttgggtttgttgatattaacgcttggcattgtggggattggactcagtgatgtgatcatatgggcacgcagcattccaattatc attatatccgctatagtcctcttactcgtcattaataatcgtaacaatacaattaattaataa


>BBa_S03973 Part-only sequence (3230 bp) aaagaggagaaatactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgcc ttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctt tgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcac ggttacgatgcgcccatctacaccaacgtgacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacat ttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtcgg ttacggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgctggagtgac ggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacgtctcgttgctgcataaaccgactacacaaatcagcgatttccatg ttgccactcgctttaatgatgatttcagccgcgctgtactggaggctgaagttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttcttt atggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattatcgatgagcgtggtggttatgccgatcgcgtcacactacgtctg aacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcggtggttgaactgcacaccgccgacggcacgctgattgaagcagaag cctgcgatgtcggtttccgcgaggtgcggattgaaaatggtctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcatca tcctctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcattatccg aaccatccgctgtggtacacgctgtgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggcatggtgccaatgaatcgtctga ccgatgatccgcgctggctaccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggggaa tgaatcaggccacggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccgacacc acggccaccgatattatttgcccgatgtacgcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtccatcaaaaaatggctttcgctac ctggagagacgcgcccgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgtcagtatcc ccgtttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgatgaaaacggcaacccgtggtcggcttacggcggtgattttggc gatacgccgaacgatcgccagttctgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaagcaaaacaccagcagcagtttt tccagttccgtttatccgggcaaaccatcgaagtgaccagcgaatacctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggatgg taagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttgattgaactgcctgaactaccgcagccggagagcgccgggcaa ctctggctcacagtacgcgtagtgcaaccgaacgcgaccgcatggtcagaagccgggcacatcagcgcctggcagcagtggcgtctggcggaaaacctca gtgtgacgctccccgccgcgtcccacgccatcccgcatctgaccaccagcgaaatggatttttgcatcgagctgggtaataagcgttggcaatttaaccg ccagtcaggctttctttcacagatgtggattggcgataaaaaacaactgctgacgccgctgcgcgatcagttcacccgtgcaccgctggataacgacatt ggcgtaagtgaagcgacccgcattgaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccgaagcagcgttgttgcagtgcacgg cagatacacttgctgatgcggtgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgatgg tagtggtcaaatggcgattaccgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcctgaactgccagctggcgcaggtagcagag cgggtaaactggctcggattagggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatctgccattgtcagacatgtata ccccgtacgtcttcccgagcgaaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatcag ccgctacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggctgaatatcgacggtttccatatggggatt ggtggcgacgactcctggagcccgtcagtatcggcggaatttcagctgagcgccggtcgctaccattaccagttggtctggtgtcaaaaataatactaga gccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggct caccttcgggtgggcctttctgcgtttata


>BBa_J31000 Part-only sequence (573 bp) atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaag accgtatcagtggcaagattgcaaaccgccccggcctgaaacgggcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagact gggccgtagcgtgaaaaatctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcg atggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaatcgtcgagcgaacccttgccggactggctgccgccagagcgc aaggacgactgggagggcgccctcgggcgatcaacaaacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaattagctat tatttttggtattggcgtatccaccttatacagatactttccggcaagcagtataaaaaaacgaatgaattaa


>BBa_K118004 Part-only sequence (1882 bp) ctcaaggaggtactagatgagttttgatattgccaaatacccgaccctggcactggtcgactccacccaggagttacgactgttgccgaaagagagttta ccgaaactctgcgacgaactgcgccgctatttactcgacagcgtgagccgttccagcgggcacttcgcctccgggctgggcacggtcgaactgaccgtgg cgctgcactatgtctacaacaccccgtttgaccaattgatttgggatgtggggcatcaggcttatccgcataaaattttgaccggacgccgcgacaaaat cggcaccatccgtcagaaaggcggtctgcacccgttcccgtggcgcggcgaaagcgaatatgacgtattaagcgtcgggcattcatcaacctccatcagt gccggaattggtattgcggttgctgccgaaaaagaaggcaaaaatcgccgcaccgtctgtgtcattggcgatggcgcgattaccgcaggcatggcgtttg aagcgatgaatcacgcgggcgatatccgtcctgatatgctggtgattctcaacgacaatgaaatgtcgatttccgaaaatgtcggcgcgctcaacaacca tctggcacagctgctttccggtaagctttactcttcactgcgcgaaggcgggaaaaaagttttctctggcgtgccgccaattaaagagctgctcaaacgc accgaagaacatattaaaggcatggtagtgcctggcacgttgtttgaagagctgggctttaactacatcggcccggtggacggtcacgatgtgctggggc ttatcaccacgctaaagaacatgcgcgacctgaaaggcccgcagttcctgcatatcatgaccaaaaaaggtcgtggttatgaaccggcagaaaaagaccc gatcactttccacgccgtgcctaaatttgatccctccagcggttgtttgccgaaaagtagcggcggtttgccgagctattcaaaaatctttggcgactgg ttgtgcgaaacggcagcgaaagacaacaagctgatggcgattactccggcgatgcgtgaaggttccggcatggtcgagttttcacgtaaattcccggatc gctacttcgacgtggcaattgccgagcaacacgcggtgacctttgctgcgggtctggcgattggtgggtacaaacccattgtcgcgatttactccacttt cctgcaacgcgcctatgatcaggtgctgcatgacgtggcgattcaaaagcttccggtcctgttcgccatcgaccgcgcgggcattgttggtgctgacggt caaacccatcagggtgcttttgatctctcttacctgcgctgcataccggaaatggtcattatgaccccgagcgatgaaaacgaatgtcgccagatgctct ataccggctatcactataacgatggcccgtcagcggtgcgctacccgcgtggcaacgcggtcggcgtggaactgacgccgctggaaaaactaccaattgg caaaggcattgtgaagcgtcgtggcgagaaactggcgatccttaactttggtacgctgatgccagaagcggcgaaagtcgccgaatcgctgaacgccacg ctggtcgatatgcgttttgtgaaaccgcttgatgaagcgttaattctggaaatggccgccagccatgaagcgctggtcaccgtagaagaaaacgccatta tgggcggcgcaggcagcggcgtgaacgaagtgctgatggcccatcgtaaaccagtacccgtgctgaacattggcctgccggacttctttattccgcaagg aactcaggaagaaatgcgcgccgaactcggcctcgatgccgctggtatggaagccaaaatcaaggcctggctggcataataa



>BBa_K098995 Part-only sequence (935 bp) tttatggctagctcagtcctaggtacaatgctagctactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagctt gaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcag gcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttc aatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcaggg atgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttg aaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgattt ctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatg atcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctgatactagagtcacactggctcacctt cgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagtaacaccgtgcgtg ttgactattttacctctggcggtgataatggttgc


Summary for Week June 7th to June 11th

 6-7-10:

a) Miniprep 2 pellet each for pBAD33, pBAD35, pBAD18, ygiV (attach to the cell wall), RcsB(expression factor that increase the clonic acid).

b) enzyme digestion for pBAD33, vgiV, pBAD18, and RcsB.

c) Gel extract for vgiV and RcsB and purification

d) PCR purification for pBAD18 and pBAD33

e) overnight ligation (set up by Sarah) 

 6-8-10:

a) transformation pBAD18-RcsB and pBAD33-vgiV into DH10B E. Coli. (Sarah and Hannah plates the cloning of pBAD18-RcsB and pBAD33-vgiV)

b) Miniprep For Encryption Project: BBa_I11020, BBa_K199021, BBa_K2902006, BBa_200021, BBa_B1006-A, BBa_B1006-B, BBa_E0240 For Drug Project: 2 pellets of each, pBAD18, pBAD33, pBAD35, vgiV, RcsB 

 6-9-10:

a) For the RcsB and VgiV plates, only a few colonies growed (they are really tiny, kindda hard to see, so we put it back to the incubator growing for couple of more hours)

b) Did the cloning of RcsB into pBAD18 and vgiV into pBAD33 again with different insert/vector ratio.

c) Plate the pellet and control. 

 6-10-10:

a) The pBAD18-RcsB plate has colonies growed.

b) Set up the screening with colony PCR

c) Made MRS Broth, MRS plates, no antibiotic plates, Amp+Kan plates, and CM plates with Mary.

Retrieved from "http://2010.igem.org/Team:Wisconsin-Madison/notebook/Yue"