Team:Groningen/28 June 2010

From 2010.igem.org

(Difference between revisions)
 
(3 intermediate revisions not shown)
Line 1: Line 1:
{{Team:Groningen/Header}}
{{Team:Groningen/Header}}
-
'''Week 26, Arend Jan'''
+
'''Week 26'''
 +
----
 +
 
 +
 
 +
'''Arend Jan'''
Line 17: Line 21:
-
[[Image:PNZ8901-bbs-ins.jpg|200px|thumb|left|alt text]]
+
[[Image:PNZ8901-bbs-ins.jpg|200px|thumb|left|]]
<br style="clear: both" />
<br style="clear: both" />
Line 26: Line 30:
-
<pre>- 13ul plasmid
+
<pre>- 10ul plasmid
- 1.5ul buffer R
- 1.5ul buffer R
-
- 0.5ul EcoRV/HindIII</pre>
+
- 0.5ul EcoRV/HindIII
 +
- 3ul MQ</pre>
-
[[Image:02-07-10gn.jpg|200px|thumb|left|alt text]]
+
[[Image:02-07-10gn.jpg|200px|thumb|left|]]
<br style="clear: both" />
<br style="clear: both" />
-
bla
+
Fragments were isolated from gel and purified using Roche High Pure PCR Product Purification Kit. The fragments need to be cut with EcoRI and SpeI to ligate them in the expression backbone. However, the DNA concentration after purification was to low to continue. Repeat with more plasmid.
{{Team:Groningen/Footer}}
{{Team:Groningen/Footer}}

Latest revision as of 19:24, 24 October 2010

iGEM Groningen 2010

Hydrophobofilm
pushing coatings into a greener future

Week 26



Arend Jan


The construct was sent for sequencing (ServiceXS) to sequence the region where the Biobrick sites were inserted, and to sequence the unknown sequence containing the PstI site, using the following primers.


3'RepA-seq-for: ATTGAGAGGAGGGATTATTG

5'Cm-seq-rev: GAGTTTATCACCCTTGTC

3'Cm-seq-for: TTCAGGAATTGTCAGATAGG


The BioBricks were inserted correctly. The unknown sequence was also sequenced correctly. Blasting it revealed that the sequence represents an insertion sequence element containing the IS1 proteins InsA and InsB. It appears this IS element has jumped onto our plasmid.


PNZ8901-bbs-ins.jpg



The PstI site prevents us from inserting two biobricks at once into our expression plasmid. As our synthesized chaplin genes have arrived we will start inserting single genes into the plasmid, not using PstI.

ChpE and ChpH are and the same Mr. Gene construct (pMASK-EH) and are flanked by EcoRV, and HindIII, respectively.


- 10ul plasmid
- 1.5ul buffer R
- 0.5ul EcoRV/HindIII
- 3ul MQ


02-07-10gn.jpg


Fragments were isolated from gel and purified using Roche High Pure PCR Product Purification Kit. The fragments need to be cut with EcoRI and SpeI to ligate them in the expression backbone. However, the DNA concentration after purification was to low to continue. Repeat with more plasmid.

Search

 

iGEM 2010 main page
iGEM HQ
iGEM Groningen Team page

University of Groningen
Where on earth are we?
Share |