Team:Kyoto/Notebook1

From 2010.igem.org

(Difference between revisions)

Latest revision as of 02:17, 28 October 2010

LastModified: 2010-10-28

Notebook1

Construction

Tuesday, July 20 By: Wataru, Tomo, Yuki, Kazuya, Ken, Makoto

Transformation

Name	Well	Sample	Competent Cells	Total	Plate	Incubation	Colony
J23100	1-18-C	1 µL	20	21	LB (Amp+)	At 37℃, 7/20 20:50 - 7/21 17:00	○
J23105	1-18-M	1	20	21			○
J23116	1-20-M	1	20	21			○
R0011	1-6-G	1	20	21			○
E0840	1-12-O	1	20	21			○
J06702	2-8-E	1	20	21			○
pSB4K5	1-5-G	1	20	21			×
B0015	1-23-L	1	20	21	LB (Kan+)		×

A vector of pSB4K5 is Kanamycin-resistance, however, we plated it to LB plate (Amp+). And We didn't pre-culture B0015 despite its vector is Kanamycin-resistance. So, it was predicted that we will fail the transformation of pSB4K5 and B0015.

Wednesday, July 21 By: Wataru, Ken, Makoto, Takuya Y.

Culture at 37℃ from 07/21 20:50 to 07/22 17:00 and Making Master Plate

Transformation

Name	Well	Sample	Competent Cells	Total	Plate	Incubation	Colony
pSB4K5	1-5-G	1 µL	20	21	LB (Kan+)	At 37℃, 7/21 20:50 - 7/22 16:30	○
B0015	1-23-L	1	20	21	LB (Kan+)	At 37℃, 7/21 20:50 - 7/22 16:30	○

PCR for SRRz and S

No.	Water	MgSO4	dNTPs	10xBuffer	Template DNA	Primer Fwd.	Primer Rev. (SRRz)	Primer Rev. (S)	KOD Plus ver.2	Total
1	28 µL	3	5	5	5	1.5	1.5	-	1	50
2	28	3	5	5	5	1.5	1.5	-	1	50
3	28	3	5	5	5	1.5	-	1.5	1	50
4	28	3	5	5	5	1.5	-	1.5	1	50
5	28	3	5	5	5	1.5	1.5	-	1	50
6	28	3	5	5	5	1.5	1.5	-	1	50
7	28	3	5	5	5	1.5	-	1.5	1	50
8	28	3	5	5	5	1.5	-	1.5	1	50

94℃	2min
98℃	10s	30 cycles
55℃	30s
68℃	4min
4℃	forever

Thursday, July 22 By: Wataru

Electrophoresis (40min) of the PCR Products

Sample: 1, 2, 5, 6 = SRRz, 3, 4, 7, 8 = S
Marker: 100bp, 1kb, 1kb, 100bp.

Miniprep

Name	Concentration
J23100	18.5 (ng/µL)
J23105	12.5
J23116	14.6
R0011	8.6
E0840	12.1
J06702	14.7

The concentration of all samples was very week. Probably our shaking incubation was week.

Culture from 07/22 17:00 to 07/23 10:00 and Making Master Plates of pSB4K5 and B0015

Friday, July 23 By: Wataru, Tomo, Makoto

Miniprep

Name	Concentration
pSB4K5	79.2 (ng/µL)
B0015	-

We lost B0015 by our mistake. The concentration of pSB4K5 is high, so this condition of shaking incubation is moderate.

PCR Purification

No.	Name	Concentration	New Name
1	SRRz	18.6 ng/µL	-
3	S	77.6	S_Sam7(1)
5	SRRz	33.6	-
7	S	65.4	S_Sam7(2)

The concentration of sample number 1 and 5, the PCR products of S-R-Rz/Rz1, is week, so we desided to retry PCR.

PCR for SRRz

No.	Water	MgSO4	dNTPs	10xBuffer	Template DNA	Primer Fwd. (SRRz)	Primer Rev. (SRRz)	KOD plus ver.2	Total
1	28 µL	3	5	5	5	1.5	1.5	1	50
2	28	3	5	5	5	1.5	1.5	1	50
3	26.5	4.5	5	5	5	1.5	1.5	1	50
4	26.5	4.5	5	5	5	1.5	1.5	1	50
5	25	6	5	5	5	1.5	1.5	1	50
6	25	6	5	5	5	1.5	1.5	1	50

94℃	2min
98℃	10s	30 cycles
55℃	30s
68℃	4min
4℃	forever

Restriction Digestion and Electrophoresis (35min) to check function of our Restriction Enzyme

No.	Name	Sample	10xBuffer	BSA	Enzyme		MilliQ	Total	Incubation
1	J06702	5 µL	1	0.1	EcoRI	0.1	3.6	10	At 37℃ 7/23 18:00 - 7/23 18:30
2	J06702	5	1	0.1	XbaI	0.1	3.6	10
3	J06702	5	1	0.1	SpeI	0.1	3.6	10
4	J06702	5	1	0.1	PstI	0.1	3.6	10
5	J06702	5	1	0.1	-		3.7	10

Marker: 1kb. Comparison to No. 5 (control, circular DNA), the bands of No. 1, 2, 3, and 4 was shifted. The DNA of them was linearized by Restriction enzymes. So, our restriction enzymes work correctly.

Restriction Digestion and Ligation to insert S gene to E0840

Name	Sample	10xBuffer	Enzyme 1		Enzyme 2		MilliQ	Total	Incubation
S_Sam7(1)	11 µL	5	EcoRI	0.2	SpeI	0.2	33.6	50	At 37℃ for 2h
S_Sam7(2)	11	5	EcoRI	0.2	SpeI	0.2	33.6	50
E0840	45	5	EcoRI	0.2	XbaI	0.2	0	50

After PCR Purification, evaporated them and diluted 3µL.

Name	Vector		Insert		Ligation High	Total
S_Sam7(1)-E0840	E0840	0.5µL	S_Sam7(1)	0.5	1	2
S_Sam7(2)-E0840	E0840	0.5	S_Sam7(2)	0.5	1	2

Monday, July 26 By: Wataru, Tomonori, Makoto

Electrophoresis of PCR Products

No.	Name	Length(bp)
1	SRRz	1386
2	SRRz	1386
3	SRRz	1386
4	SRRz	1386
5	SRRz	1386
6	SRRz	1386

Marker: 1kb. At the condition 4 (4.5µL MgSO4) and 6 (6µL MgSO4), SRRz is amplified very much. So we decided to use them.

PCR Purification

No.	Name	Concentration	New Name
4	SRRZ	51.6 ng/µL	SRRz_Sam7(1)
5	SRRZ	59.3
6	SRRZ	59.6	SRRz_Sam7(2)

Transformation

Name	Well	Sample	Competent Cell	Total	Plate	Incubation	Colony
E0240	1-12-M	1 µL	20	21	LB (Amp+)	At 37℃ 7/26 - 7/27	×
I20260	2-17-F	1	20	21	LB (Kan+)		×
J04450	1-5-E	1	20	21	LB (Kan+)		×

Culture of pSB4K5, E0840, and B0015

Tuesday, July 27 By: Wataru, Tomo, Kazuya, Ken, Naoi

Colony PCR of S_Sam7-E0840 (Electrophoresis for 35min)

No.	Name	Length	Result
1	S_Sam7(1)-E0840	1522	○
2	S_Sam7(1)-E0840	1522	×
3	S_Sam7(1)-E0840	1522	○
4	S_Sam7(1)-E0840	1522	×
5	S_Sam7(1)-E0840	1522	○
6	S_Sam7(1)-E0840	1522	◎ (Use as S_Sam7(1)-E0840)
7	S_Sam7(2)-E0840	1522	×
8	S_Sam7(2)-E0840	1522	×
9	S_Sam7(2)-E0840	1522	×
10	S_Sam7(2)-E0840	1522	×
11	S_Sam7(2)-E0840	1522	◎ (Use as S_Sam7(2)-E0840)
12	S_Sam7(2)-E0840	1522	○
13	S_Sam7(2)-E0840	1522	○
+	E0840	1116
-	None

Marker: 1kb, 100bp

Miniprep

Name	Concentration
R0011	26.9 ng/µL
B0015	120.0
E0840	120.1

Restriction Digestion

Name	Sample	2 buffer	BSA	Enzyme 1		Enzyme 2		MilliQ	Total	Incubation
B0015	30 µL	5	0.5	EcoRI	0.4	XbaI	0.3	13.7	50	At 37℃ 16:45 - 18:00
SRRz_Sam7(1)	40	5	0.5	EcoRI	0.4	SpeI	0.4	3.8	50
SRRz_Sam7(2)	40	5	0.5	EcoRI	0.4	SpeI	0.4	3.8	50

Ligation

Transformation

Name	Sample	Competent Cells	Total	Plate	Incubation	Colony
SRRz_Sam7(1)-B0015						○
SRRz_Sam7(2)-B0015						○

Wednesday, July 28 By:

Miniprep

Name	Concentration
S_Sam7(1)-E0840	95.5 ng/µL
S_Sam7(2)-E0840	98.6

Diluted S_Sam7(1)-E0840 and S_Sam7(2)-E0840 20 times with water, and used as template DNA.

Deletion PCR to delete a functional domain of S gene

	Water	MgSO4	dNTPs	10xBuffer	Primer Fwd.	Primer Rev.	Template (1)	Template (2)	KOD Plus ver.2	Total
S_Sam7,ΔTMD1(1)-E0840 (1)	28 µL	3	5	5	1.5	1.5	5	-	1	50
S_Sam7,ΔTMD1(1)-E0840 (2)	28	3	5	5	1.5	1.5	5	-	1	50
S_Sam7,ΔTMD1(2)-E0840 (1)	28	3	5	5	1.5	1.5	-	5	1	50
S_Sam7,ΔTMD1(2)-E0840 (2)	28	3	5	5	1.5	1.5	-	5	1	50

94℃	2min
98℃	10s	35 cycles
55℃	30s
68℃	4min
4℃	forever

Restriction Digestion to check the function of DpnI

Name	Sample	fast digestion buffer	DpnI	MilliQ	Total
S_Sam7(1)-E0840	3 µL	1	0.1	5.8	10
S_Sam7(2)-E0840	3	1	0.1	5.8	10

Electrophoresis for 35min

No.	Name	Length
1	Not digested S_Sam7(1)-E0840	3363bp
2	Not digested S_Sam7(2)-E0840	3363
3	Digested S_Sam7(1)-E0840	1021, 933, 402, 341, 258, 105, ...
4	Digested S_Sam7(2)-E0840	1021, 933, 402, 341, 258, 105, ...

Marker: 1kb, 100bp DpnI works correctly.

Thursday, July 29 By:

Restriction Digestion

Name	Sample volume	Fastdigestion Buffer	Enzyme 1		MilliQ	Total	Incubation
S_Sam7,ΔTMD1(1)-E0840 (1)	50 µL	6	DpnI	0.2	3.8	60	07/29 09:40 - 07/29 11:00
S_Sam7,ΔTMD1(2)-E0840 (1)	50	6	DpnI	0.2	3.8	60	07/29 09:40 - 07/29 11:00

Ligation and Phosphorylation

Name	Sample	MilliQ	Ligation High	T4 Kinase	Total	Incubation
S_Sam7,ΔTMD1(1)-E0840 (1)	2 µL	7	5	1	15	07/29 11:30 ~ 07/29 13:00
S_Sam7,ΔTMD1(2)-E0840 (1)	2	7	5	1	15	07/29 11:30 ~ 07/29 13:00

Transformation

Name	Sample Volume	Competent Cell	Total	Plate	Incubation	Colony
S_Sam7,ΔTMD1(1)-E0840 (1)	3 µL	30	33	LB (Amp+)	07/29 ~ 07/30	○
S_Sam7,ΔTMD1(2)-E0840 (1)	3	30	33	LB (Amp+)	07/29 ~ 07/30	○

Monday, August 2 By: Wataru, Ken

Miniprep

Name	Concentration
S_Sam7,ΔTMD1-E0840 (1)	52.7 ng/µL
S_Sam7,ΔTMD1-E0840 (2)	54.4
S_Sam7,ΔTMD1-E0840 (3)	89.5
pSB4K5	50.7
R0011	18.6

PCR of E0240

E0240 is very important parts to measure RPU of promoters in iGEM. However, we failed to transfect it to E.coli from parts kit of iGEM. So we decided to amplify this parts by PCR.

Name	Water	MgSO4	dNTPs	10xBuffer	Primer VF2	Primer VR	Template E0240	KOD Pllus ver.2	Total
E0240(1)	28 µL	3	5	5	1.5	1.5	5	1	50
E0240(2)	28	3	5	5	1.5	1.5	5	1	50

94℃	2min
98℃	10s	35 cycles
55℃	30s
68℃	4min
4℃	forever

Electrophoresis

PCR Purification

Name	Concentration
E0240(1)	42.6 ng/µL
E0240(2)	55.3

Restriction Digestion for inserting E0240 to pSB4K5 by 3A assembly

Name	Sample volume	2 buffer	BSA	Enzyme 1		Enzyme 2		MilliQ	Total
E0240(1) [XP]	30 µL	5	0.5	XbaI	0.2	PstI	0.2	14.1	50
E0240(2) [XP]	30	5	0.5	XbaI	0.2	PstI	0.2	14.1	50

PCR Purification

Name	Concentration	Volume
E0240(1) [XP]	21.8 ng/µL	40 µL
E0240(2) [XP]	32.4	45

Stored at -20℃.

Error PCR

Name	Water	MgSO4	dNTPs	10xBuffer	Primer VF2	Primer VR	Template (1)	Template (2)	Template (3)	KOD Pllus ver.2	Total
S_Sam7,ΔTMD1-E0840 (1)	32 µL	3	5	5	1.5	1.5	1	-	-	1	50
S_Sam7,ΔTMD1-E0840 (2)	32	3	5	5	1.5	1.5	-	1	-	1	50
S_Sam7,ΔTMD1-E0840 (3)	32	3	5	5	1.5	1.5	-	-	1	1	50

94℃	2min
98℃	10s	20 cycles
68℃	4min	20 cycles
4℃	forever

Restriction Digestion of S_Sam7,ΔTMD1-E0840 by DpnI

Transformation

Name	Sample	Competent Cells	Total	Plate	Incubation	Colony
S_Sam7,ΔTMD1-E0840 (1)	2 µL	20	22	-	-	○
S_Sam7,ΔTMD1-E0840 (2)	2	20	22			×
S_Sam7,ΔTMD1-E0840 (3)	2	20	22			○

Tuesday, August 3 By:

Culture

Picked two colonies from S_Sam7,ΔTMD1-E0840 (1), and S_Sam7,ΔTMD1-E0840 (3), and cultured at 37℃ from 08/03 to 08/04.

Miniprep

Name	Concentration
pSB4K5	60.7 ng/µL
R0011	26.8

Restriction Digestion

Name	Sample	2 buffer	BSA	Enzyme 1		Enzyme 2		MilliQ	Total
R0011 [ES]	50 µL	6	0.6	EcoRI	0.2	SpeI	0.2	3	60
pSB4K5 [EP]	50	6	0.6	EcoRI	0.2	PstI	0.2	3	60
E0240(1) [XP]	50	6	0.6	XbaI	0.2	PstI	0.2	3	60
E0240(2) [XP]	50	6	0.6	XbaI	0.2	PstI	0.2	3	60

PCR Purification

Name	Concentration
pSB4K5 [EP]	39.5 ng/µL
E0240(1) [XP]	21.8
E0240(2) [XP]	32.4

pSB4K5 [EP] is concentrated 10µL and E0240(1) [XP], E0240(2) [XP] are concentrated 1µL.

Ethanol Precipitation

After ethanol precipitation, we diluted pSB4K5 by 2µL MilliQ

Ligation

Name	Vector	Insert 1		Insert 2		Ligation High	T4 Kinase	Total	Incubation
ML (1)	pSB4K5 [EP]	1	R0011 [ES]	1	E0240(1) [XP]	1	3	15	17:30 - 20:20
ML (2)	pSB4K5 [EP]	1	R0011 [ES]	1	E0240(2) [XP]	1	3	15	17:30 - 20:20

PCR of I20260

Name	Water	MgSO4	dNTPs	10xBuffer	Primer VF2	Primer VR	Template I20260	KOD plus ver.2	Total
I20260 (1)	32µL	3	5	5	1.5	1.5	1	1	50
I20260 (2)	32	3	5	5	1.5	1.5	-	1	50

94℃	2min
98℃	10s	30 cycles
55℃	30s
68℃	4min
4℃	forever

PCR Purification

Name	Concentration
I20260	40.6 ng/µL

Restriction Digestion

Name	Sample volume	2 buffer	BSA	Enzyme 1		Enzyme 2		MilliQ	Total
I20260 [EP]	45 µL	6	0.6	EcoRI	0.2	PstI	0.2	8	60

PCR Purification

Name	Concentration	Volume
I20260 [EP]	74.1 ng/µL	30

I20260 [EP] is concentrated at 7µL

Ligation

	Vector	Insert		Ligation High		Total	Incubation
MS	pSB4K5 [EP]	1	I20260 [EP]	1	2	4	20:00-20:30

Transformation

Name	Sample	Competent Cell	Total	Plate	Incubation	Colony
ML (1)	1 µL	20	21	LB (Kan+)	08/03-08/04	○
ML (2)	1	20	21			○
MS	1	20	21			○

Thursday, August 5 By:

Culture and Master Plates

pSB4K5 is inserted RFP generator. We didn't distinguish this inserted parts from low copy plasmid backbone, so self-ligated colony is red. So, white colony is correctly inserted parts.

However, white colonies and green colonies are observed in ML (1) and ML (2) plate. We cultured both white and green colonies.

In MS, Many of colonies are red, but green colonies are observed. We cultured green colonies.

Name	Color	Incubation
ML (1-1)	Green Colony	8/5-8/6
ML (1-2)	Green Colony
ML (1-3)	White Colony
ML (1-4)	White Colony
ML (2-1)	Green Colony
ML (2-2)	White Colony
ML (2-3)	White Colony
ML (2-4)	White Colony
MS (1)	Green Colony
MS (2)	Green Colony
MS (3)	Green Colony

Sequence

Name	Concentration
S_ΔTMD1-E0840(1) A	28.9 ng/µL
S_ΔTMD1-E0840(1) B	25.3
S_ΔTMD1-E0840(3) A	26.6
S_ΔTMD1-E0840(3) B	24.0

As a result, deletion is succeeded, however, point mutation is failed. It is because DpnI is too little to digest all of template DNA.

Friday, August 6

Miniprep

Name
ML (1-1)
ML (1-2)
ML (1-3)
ML (1-4)
ML (2-1)
ML (2-2)
ML (2-3)
ML (2-4)
MS (1)
MS (2)
MS (3)

Restriction Digestion

Name	Sample	2 buffer	BSA	Enzyme 1		Enzyme 2		MilliQ	Total
ML (1-1) [EP]	50 µL	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
ML (1-2) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
ML (1-3) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
ML (1-4) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
ML (2-1) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
ML (2-2) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
ML (2-3) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
ML (2-4) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
MS (1) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
MS (2) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60
MS (3) [EP]	50	6	0.6	EcoRI	0.3	PstI	0.3	2.8	60

Electrophoresis

No.	Name	Length	Results
1	MS (1) [EP]	960, 4339
2	MS (2) [EP]	960, 4339
3	MS (3) [EP]	960, 4339
4	ML (1-1) [EP]	980 3378	○
5	ML (1-2) [EP]	980 3378	○
6	ML (1-3) [EP]	980 3378	×
7	ML (1-4) [EP]	980 3378	×
8	ML (2-1) [EP]	980 3378	○
9	ML (2-2) [EP]	980 3378	×
10	ML (2-3) [EP]	980 3378	×
11	ML (2-4) [EP]	980 3378	×
12	MS (1) [EP]	960, 4339	○
13	MS (2) [EP]	960, 4339	○

White colonies are not inserted R0011 but its vector. Top10 we used are deleted Lac operon. Then, correctly inserted parts is green because of the lack of lacI gene.

Error PCR (Retry)

Name	Water	MgSO4	dNTPs	10xBuffer	Primer VF2	Primer VR	Template S_Sam7,ΔTMD1-E0840 failed (50ng/µL)	KOD plus ver.2	Total
S_Sam7,ΔTMD1-E0840 (1)	32	3	5	5	1.5	1.5	1	1	50
S_Sam7,ΔTMD1-E0840 (2)	32	3	5	5	1.5	1.5	1	1	50

94℃	2min
98℃	10s	25 cycles
68℃	4min	25 cycles
Add DpnI 2µL
Incubate	1h
4℃	forever

Transformation

Name	Well	Sample	Competent Cell	Total	Plate	Incubation	Colony
S_Sam7,ΔTMD1-E0840 (1)	-	4 µL	50	54	LB (Kan+)	08/06-08/09	○
S_Sam7,ΔTMD1-E0840 (2)	-	4	50	54			○
I20260	2-17-F	2	50	52			○
	2-I-5	2	50	52	LB (Amp+)		○

Monday, August 9 By: Wataru, Tomonori, Ken, Takuya

Miniprep

Name	concentration
MS	116.2 ng/µL
ML	146.6

Transfotrmation

Sample	Sample	Competent Cell		Total	Plate	Incuvation	Results
MS	2 µL	KRX	50	52	LB (Kan+)	08/09 18:00-08/10 12:00	○
ML	2	KRX	50	52	LB (Kan+)	08/09 18:00-08/10 12:00	○

Restriction Eigestion and Ethanol Precipitation

To use R0011 for next ligation, we digested it by EcoRI and PstI

Name	Sample	10x Buffer	BSA	Enzyme 1		Enzyme 2		MilliQ	Total	Incubation
R0011 [EP]	50	6	0.6	EcoRI	0.5	PstI	0.5	2.4	60	At 37℃ 08/09 16:20-18:20

After restriction enzyme digestion, we did ethanol precipitation.

Ligation and Transformation

Name	Sample	Competent cell		Total	Plate	Incuvation	Colony
R0011 [pSB4K5, KRX]	2 µL	KRX	50	52	LB (Kan+)	08/09 20:00-08/10 09:00	○
R0011 [pSB4K5</partrinfo>, C2]	2	C2	50	52	LB (Kan+)	08/09 20:00-08/10 09:00	○

Tuesday, August 10 By: Wataru, Tomonori, Ken, Fumitaka

Culture

Cultured I20260 [pSB4K5, ML, R0011 [pSB4K5, KRX], and R0011 [pSB4K5</partrinfo>, C2].

Minprep

Name	Concentration
S_Sam7,ΔTMD1-E0840 (1-1)	9.9 ng/µL
S_Sam7,ΔTMD1-E0840 (1-2)	27.3
S_Sam7,ΔTMD1-E0840 (2-1)	43.2
S_Sam7,ΔTMD1-E0840 (2-2)	34.7

Culture and Master Plate

At 37℃ 08/09 18:00-08/10 9:00

Wednesday, August 11 By: Wataru, Naoi, Ken, Takuya

No.	Medium	Cloud	Incubation
1	Kanamycin	○	At 37℃, 08/10 20:00-08/11 9:00
1	Ampicillin	×
2	Kanamycin	○
2	Ampicillin	○
3	Kanamycin	○
3	Ampicillin	×
4	Kanamycin	○
4	Ampicillin	×
5	Kanamycin	○
5	Ampicillin	×
6	Kanamycin	○
6	Ampicillin	○
7	Kanamycin	○
7	Ampicillin	×

Discussion: About sample 1, 3, 4, 5 and 7, lac promoter was correctly inserted in low copy plasmid. About sample 2 and 6, low copy plasmid and vector derived from lac promoter were ligated. We decided to use sample 1 or 3.

Miniprep of R0011 [pSB4K5, C2], SRRz 1', 3'

Name	Concentration
R0011 [pSB4K5, C2] (1)	31.2 ng/µL
R0011 [pSB4K5, C2] (3)	29.9

Restriction Digestion and electrophoresis of R0011 [pSB4K5, C2]

Name	EcoRI	PstI
1	0.2	-
2	-	0.2
3	0.2	0.2
N	-	-

No.	Name	Length	Results
1	R0011 [pSB4K5, C2] (1-1)
2	R0011 [pSB4K5, C2] (1-2)
3	R0011 [pSB4K5, C2] (1-3)
4	R0011 [pSB4K5, C2] (1-N)
5	R0011 [pSB4K5, C2] (2-1)
6	R0011 [pSB4K5, C2] (2-2)
7	R0011 [pSB4K5, C2] (2-3)
8	R0011 [pSB4K5, C2] (2-N)

Each enzyme correctly cut samples.

Screening PCR of SRRz

No.	Name	Results
1	None
2	Control B0015
3	Control J06702
4	Control B0015
5-24	SRRz-B0015	×

Marker: Lambda Marker

Discussion: All of the sample were self-ligation of DT. SRRz weren't inserted.

Thursday, August 12 By: Wataru, Ken

Restriction Digestion and electrophoresis of B0015

Name	Template	10xbuffer	100xbuffer	EcoRI	XbaI 1	XbaI 2	SpeI	PstI 1	PstI 2	Water	Total
1	3	1	0.1	0.2	-	-	-	-	-	5.7	10
2	3	1	0.1	-	0.2	-	-	-	-	5.7	10
3	3	1	0.1	-	-	0.2	-	-	-	5.7	10
4	3	1	0.1	-	-	-	0.2	-	-	5.7	10
5	3	1	0.1	-	-	-	-	0.2	-	5.7	10
6	3	1	0.1	-	-	-	-	-	0.2	5.7	10
N	3	1	0.1	-	-	-	-	-	-	5.9	10

Maker: Lambda, 100bp

Discussion: Each enzyme correctly cut each sample and was active.

Thursday, August 19 By: Wataru, Tomo, Ken

Miniprep of S_Sam7,ΔTMD1-E0840

Name	Concentration
S_Sam7,ΔTMD1-E0840	29.6 ng/µL

Point mutation PCR of S_Sam7,ΔTMD1-E0840

Name	Template	10xbuffer	dNTPs	MgSO4	Primer Fwd.	Primer Rev.	MilliQ	KOD plus ver.2	Total
S_ΔTMD1-E0840 (1)	1.5	5	5	3	1.5	1.5	31.5	1	50
S_ΔTMD1-E0840 (2)	1.5	5	5	3	1.5	1.5	31.5	1	50
Control	1.5	5	5	3	1.5	1.5	32.5	-	50

94℃	2min
98℃	10s	30cycles
55℃	30s
68℃	3.5min
4℃	forever

Restriction Digestion by DpnI from 17:50 to 18:50

Electrophoresis

Name
S_ΔTMD1-E0840 (1)
S_ΔTMD1-E0840 (2)
Control

Marker: Lambda, 100bp

Ligation and Transformation

Name	Colony
S_ΔTMD1-E0840 (1)	○
S_ΔTMD1-E0840 (2)	○
Control	×

Friday, August 20 By: Wataru, Ken

Making Culture and Master Plate of S_ΔTMD1-E0840

Miniprep

Name	Concentration
B0015	41.1 ng/µL

PCR of SRRz

Name	10xBuffer	MgS04	dNTP	Template	Primer Fwd.		Primer Rev.	MilliQ	KOD plus ver.2	Total
SRRz_Sam7 (1)	5 µL	3	5	5	F1	1.5	1.5	28	1	50
SRRz_Sam7 (2)	5	3	5	5	F2	1.5	1.5	28	1	50
SRRz_Sam7 (3)	5	3	5	5	F1	1.5	1.5	28	1	50
SRRz_Sam7 (4)	5	3	5	5	F2	1.5	1.5	28	1	50
SRRz_Sam7 (5)	5	3	5	5	F1	1.5	1.5	28	1	50
SRRz_Sam7 (6)	5	3	5	5	F2	1.5	1.5	28	1	50

94℃	2min
98℃	10s	30cycles
55℃	30s
68℃	2min
4℃	forever

Electrophoresis

Name
SRRz_Sam7 (1)
SRRz_Sam7 (3)
SRRz _Sam7(5)
SRRz_Sam7 (2)
SRRz_Sam7 (4)
SRRz_Sam7 (6)

Discussion: Primer F1 might be better than F2, because the bands of 1, 2 and 3 were clearer. We decided to use sample 1 and 3. Their bands were clearer in the three.

PCR Purification

Name	Concentration
SRRz_Sam7 (1)	134.0 ng/µL
SRRz_Sam7 (3)	69.0

Restriction Digestion

Name	Sample	10xBuffer	100xBuffer	EcoRI	XbaI	SpeI	MilliQ	Total	Incubation
B0015 [EX]	50 µL	6	0.6	0.4	0.4	-	2.6	60	17:45-18:45
SRRz_Sam7 (1) [EP]	50	6	0.6	0.4	-	0.4	2.6	60
SRRz_Sam7 (3) [EP]	50	6	0.6	0.4	-	0.4	2.6	60

Purification

Name	Concentration
SRRz_Sam7 (1) [EP]	109.0 ng/µL
SRRz_Sam7 (2) [EP]	110.0
B0015	25.5

Ligation and Transformation

Monday, August 23 By: Wataru, Tomo, Ken, Fumitaka, Tasuku

Miniprep

Sample number	Concentration
S_ΔTMD1-E0840 (1-1)	58.9 ng/µL
S_ΔTMD1-E0840 (2-2)	49.9

Sequence

Sample: S_ΔTMD1-E0840 (1-1). S_ΔTMD1-E0840 (2-2), MS Discussion: The sequencing was in success and the results were desirable. It meant the point mutation was succeeded and sequence of MS was confirmed. We decided to use S_ΔTMD1-E0840.

Screening PCR of SRRz_Sam7-B0015

90℃	10min
94℃	30s	35cycles
50℃	30s
72℃	1.5min
72℃	4min
4℃	hold

No.	Name
1-13	SRRz_Sam7-B0015
C	Control: B0015
N	None

Marker: Lambda, 100bp

Discussion: We found the band; about 200bp, and it meant the lligation was completed successfully.

Deletion PCR of S_ΔTMD1-E0840 (2-2)

Name	Sample	10xBuffer	dNTPs	Primer Fwd.	Primer Rev.	Template	Water	KOD-plus-	Total
rrS_ΔTMD1-E0840 (1)	2 µL	5	5	1.5	1.5	1	35	1	50
rrS_ΔTMD1-E0840 (2)	2	5	5	1.5	1.5	1	35	1	50
rrS_ΔTMD1-E0840 (Control)	2	5	5	1.5	1.5	1	35	-	50

94℃	2min
94℃	10s	35cycles
56℃	30s
68℃	3.5min
4℃	forever

Restriction Digestion (DpnI)

Sample	DpnI	Total	Incubation
25 µL	1	26	19:00-20:10

Ligation

Name	Sample	Water	Ligation high	T4 Kinase	Total	Incubation
rrS_ΔTMD1-E0840 (1)	3 µL	6	5	1	15	20:15-21:15
rrS_ΔTMD1-E0840 (2)	3	6	5	1	15
rrS_ΔTMD1-E0840 (Control)	3	6	5	1	15

Transformation

Tuesday, August 24 By: Ken, Tomo, Tasuku, Takuya

Retry of deletion PCR of S_ΔTMD1-E0840

Name	Sample	10xBuffer	dNTPs	MgSO4	Primer1	Primer2	Template	Water	KOD-plus-	Total
rrS_ΔTMD1-E0840 (1)	2 µL	5	5	3	1.5	1.5	1	32	1	50
rrS_ΔTMD1-E0840 (2)	2	5	5	3	1.5	1.5	1	32	1	50
Control	2	5	5	3	1.5	1.5	1	32	1	50

94℃	2min
94℃	10s	35cycles
58℃	30s
68℃	3.5min
4℃	hold

Restriction Digestion (DpnI)

14:15-15:15

Electrophoreis

Lane	Name
1	rrS_ΔTMD1-E0840 (1)
2	rrS_ΔTMD1-E0840 (3)
C	rrS_ΔTMD1-E0840 (Control)

Marker: 100bp, Lambda.

We found the band of sample 1 and 2 about 3000bp and there wasn't the band of sample control. So, we confirmed the PCR and Restriction Digestion were completed successfully.

Ligation

Point mutation of SRRz

Name	10x	dNTPs	MgSO4	Primer1	Primer2	Template	Water	KOD-plus-	total
SRRz_Sam7-B0015 (1)	5	5	3	1.5	1.5	1	32	1	50
SRRz_Sam7-B0015 (2)	5	5	3	1.5	1.5	1	32	1	50
SRRz_Sam7-B0015 (Control)	5	5	3	1.5	1.5	1	32	1	50

94℃	2min
98℃	10s	30cycles
55℃	30s
68℃	4min
4℃	hold

Restriction Digestion (DpnI), Electrophoresis and Ligation

We could find point mutation PCR and restriction enzyme of DpnI was done.

PCR of E0240

Sample	10xBuffer	dNTPs	MgSO4	VF2	VR	Template	Water	KOD-plus-	Total
E0240 (1)	5	5	3	1.5	1.5	1	31.5	1	50
E0240 (2)	5	5	3	1.5	1.5	1	31.5	1	50

PCR Purification

Name	Concentration
E0240 (1)	5.5 x 50 ng/µL
E0240 (2)	5.2 x 50

Restriction Digestion (EcoRI, PstI) and Gel Extraction

Name	Concentration
E0240 (1)	28.8 ng/µL
E0240 (2)	26.4

Transformation

Wednesday, August 25 By:Ken, Tomo, Kazuya, Tasuku, Takuya

Making culture and Master plate

Name	Colony
rrS_ΔTMD1-E0840 (1)	○
rrS_ΔTMD1-E0840 (2)	○
rrS_ΔTMD1-E0840 (Control)	×
SRRz_Sam7-B0015 (1)	○
SRRz_Sam7-B0015 (2)	○
SRRz_Sam7-B0015 (Control)	×

Miniprep

Name	Concentration
pSB4K5	29.0 ng/µL

Restriction Digestion

Sample name	Template	10xbuffer	100xbuffer	EcoRI	SpeI	PstI	Water	Total
pSB4K5	50	6	0.6	0.4	0.4	-	2.6	60
R0011 [pSB4K5]	10	4	0.4	-	0.3	0.3	25	40

Purification

Sample Name	Concentration
pSB4K5	18.4 ng/µL
R0011 [pSB4K5]	8.6

Ligation of E0240 and pSB4K5, Transformation

Thursday, August 26 By:Ken, Tomo, Kazuya, Tasuku, Takuya, Fumitaka

Miniprep

Sample name	Concentration
J23116 (RPU0.7)	44.5 ng/µL

Restriction Digestion

Name	Template	10xbuffer	100xbuffer	SpeI	PstI	Water	Total
J23116 (RPU0.7)	25	4	0.4	0.3	0.3	10	40

Purification of

Name	Concentration
J23116 (RPU0.7)	49.8 ng/µL

Friday, August 27 By: Ken, Tomo, Kazuya, Fumitaka

Making master plate of E0240 [pSB4K5]

Sample Name	Concentration
rrS_ΔTMD1-E0840 (1-2)	20.9 ng/µL
SRRz-B0015 (1-1)	16.4

Restriction Digestion

Name	Template	10xbuffer	100xbuffer	XbaI	PstI	Water	Total	Incubation
rrS_ΔTMD1-E0840 (1-2)	45 µL	6	0.6	0.3	0.3	7.8	60	13:20-14:20
SRRz-B0015 (1-1)	45	6	0.6	0.3	0.3	7.8	60	13:20-14:20

Purification

rrS_ΔTMD1-E0840 (1-2)	44.7 ng/µL
SRRz-B0015 (1-1)	56.1

Ligation and Transformation

Name
R0011-rrS_ΔTMD1-E0840 (1-2)
J23116 (RPU0.7)- rrS_ΔTMD1-E0840 (1-2)
R0011-SRRz-B0015 (1-1) [pSB4K5]

Monday, August 30 By: Tomonori, Kazuya, Tasuku, Ken

Making culture and Master plate

Name	Colony
R0011-rrS_ΔTMD1-E0840	Many colonies
R0011-rrS_ΔTMD1-E0840 (Control)	Some colonies
J23116 (RPU0.7)- rrS_ΔTMD1-E0840	Many colonies
J23116 (RPU0.7)- rrS_ΔTMD1-E0840 (Control)	Many colonies
R0011-SRRz-B0015 (1-1) [pSB4K5]	No colony
R0011-SRRz-B0015 (1-1) [pSB4K5] (Control)	No colony

Discussion: There ware some colonies, which emitted green light, on the plate 1. So, we cultured those colonies on master plate. On the plate 5 and 6, even though we used KRX, which is able to repress lac promoter, colonies might be dead. However, we still have to do some experience so that we confirm lac promoter cannot repress enough and E. coli cannot survive.

Tuesday, August 31 By: Tomonori, Takuya Y., Kazuya, Tasuku, Takuya, Ken

Miniprep

Name	Concentration
J23105 (RPU0.3)	48.5 ng/µL
R0011-rrS_ΔTMD1-E0840	107.3

Restriction Digestion

Gel Extraction of R0011-rrS_ΔTMD1-E0840 (Electrophoresis for 45min)

Discussion: There were two band at the bottom of the gel. It was too long -45min-, and insert and vector might be contaminated. But we went on next operation.

Purification of J23105 (RPU0.3) and R0011-rrS_ΔTMD1-E0840

Name	Concentration
J23105 (RPU0.3)	5.8 ng/µL
R0011-rrS_ΔTMD1-E0840	7.8

Ligation and Transformation

Insert	Vector
R0011-rrS_ΔTMD1-E0840	J23105 (RPU0.3)

Wednesday, September 1 By: Tomonori, Kazuya, Tasuku, Fumitaka, Ken

Making culture and Master plate

Name	Colony
R0011-rrS_ΔTMD1-E0840-J23105 (RPU0.3)	Many colonies
R0011-rrS_ΔTMD1-E0840-J23105 (RPU0.3) (Control)	Many colonies

Screenig PCR of R0011-rrS_ΔTMD1-E0840-J23105 (RPU0.3)

Sample: 1-13
Control: Positive (B0015)
Maker: lambda, 100

Discussion: All of the sample except sample 10 might be self-ligation products of J23105 (RPU0.3).

Miniprep

SRRz-B0015 (1-1)	33.8 ng/µL
pSB4K5	56.0

Restriction Digestion of SRRz and pSB4K5

Name	Template	10xbuffer	100xbuffer	EcoRI	PstI	Water	Total	Incubation
SRRz-B0015 (1-1)	20 µL	4	0.4	0.3	0.3	15	40	13:25-14:30
pSB4K5	20	4	0.4	0.3	0.3	15	40	13:25-14:30

Purification

SRRz-B0015 (1-1)	6.5 ng/µL
pSB4K5	16.8

Ligation and transformation

Insert: SRRz-B0015 (1-1)
Vector: pSB4K5

Thursday, September 2 By: Tomonori, Tomo, Takuya, Ken

Making culture and Master plate

SRRz-B0015 (1-1) [pSB4K5]	13 colonies
SRRz-B0015 (1-1) [pSB4K5] (Control)	13 colonies

Screening PCR of rSRRz low

Sample: (1-13) SRRz-B0015 (1-1) [pSB4K5] Maker: Lambda, 100 Control: Positive (B0015), Neganive Discussion: From sample 1, two vectors might be ligated. Sample 3 and 4, SRRz-B0015 might be inserted in low copy plasmid correctly. Sample 11, it might be the self-ligation product of low copy plasmid. Anyway, we decided to culture those 4 colonies on master plate.

Friday, September 3 By: Tomonori, Tomo, Kazuya, Tasuku, Fumitaka, Ken

Making culture

R0011-rrS_ΔTMD1-E0840 (1)
R0011-rrS_ΔTMD1-E0840 (3)
rrS_ΔTMD1-E0840 (1-1)
rrS_ΔTMD1-E0840 (1-2)
SRRz-B0015 (1-1) [pSB4K5]
SRRz-B0015 (1-2) [pSB4K5]
ML

Monday, September 6 By: Wataru, Tomo, Kazuya, Ken

Sequence Analysis

R0011-rrS_ΔTMD1-E0840 (A)
R0011-rrS_ΔTMD1-E0840 (B)
SRRz-B0015 [pSB4K5] (A)
SRRz-B0015 [pSB4K5] (B)
rrS_ΔTMD1-E0840 (1-1)
rrS_ΔTMD1-E0840 (1-2)

R0011-rrS_ΔTMD1-E0840 (A), SRRz-B0015 [pSB4K5] (A) is correct.

Miniprep

Name	Concentration
SRRz	29.6 ng/µL
R0011-rrS_ΔTMD1-E0840	70.2
J23105 (RPU0.3)	75.3
rrS_ΔTMD1-E0840 (1-1)	30.3

Restriction Digestion

J23105 (RPU0.3): SpeI, PstI
rrS_ΔTMD1-E0840: XbaI, PstI

Gel Extraction

Name	Concentration
J23105 (RPU0.3) [SP]	20ng / 10µL
rrS_ΔTMD1-E0840	100ng / 1µL

Ligation

Vector		Insert	Ligation High	Total	Incubation
J23105 (RPU0.3) [SP]	1 µL	rrS_ΔTMD1-E0840 [XP]	1	2	4	30min

Transformation

Name	Competent Cell	Product of Ligation
J23105 (RPU0.3)-rrS_ΔTMD1-E0840	50 µL	4

Tuesday, September 7 By: Wataru, Ken

Insert Check

We did colony PCR, and three colonies were inserted rrS_ΔTMD1-E0840. So we succeeded in making J23105 (RPU0.3)-rrS_ΔTMD1-E0840.

Thirsday, September 9 By: Wataru, Ken

Culture

Culture pSB4K5 and SRRz_Sam7

Friday, September 10 By: Wataru, Ken

Miniprep

Name	Concentration
pSB4K5	48.8
SRRz_Sam7	33.4

Mutagenesis

We lost SRRz-B0015, so we decided to retry point mutation.

Name	MgS04	dNTP	10xBuffer	Template	KOD	MilliQ	Total
SRRz (1)	3	5	5	1.5	1	34	50
SRRz (2)	3	5	5	1.5	1	34	50
Control	3	5	5	1.5	1	34	50

94℃	1min
94℃	5s	25 cycles
55℃	30s
68℃	3min 40s
4℃	Forever

After digestion by DpnI, Ligation and Transformation.

Sunday, September 12 By: Wataru

Culture

Culture SRRz (1), (2), (3) from original plate.

Monday, September 13 By: Wataru, Ken

Miniprep

Name	Concentration
SRRz (1)	61.3 ng/µL
SRRz (2)	59.3
SRRz (3)	69.3

Sequence Analysis

SRRz (1), (2), (3)

SRRz (1), (2), (3) are correct.

Restriction Digestion

J23105 (RPU0.3)-rrS_ΔTMD1-E0840: EcoRI, SpeI
R0011: EcoRI, XbaI

Ligation

J23105 (RPU0.3)-rrS_ΔTMD1-E0840 [ES] + R0011 [EX]

Transformation

Tuesday, September 14 By: Ken, Wataru

Colony PCR

We did Colony PCR, and we succeeded in making J23105 (RPU0.3)-rrS_ΔTMD1-E0840-R0011

Sequence Analysis

From the product of Colony PCR.

J23105 (RPU0.3)-rrS_ΔTMD1-E0840-R0011

J23105 (RPU0.3)-rrS_ΔTMD1-E0840-R0011 is correct.

Tuesday, September 30 By: Ken

Miniprep

Name	Concentration
LTC (1)	84.6 ng/µL
LTC (2)	97.6
LTC (3)	127.4
LTC (4)	85.4
LTC (5)	70.0

Friday, October 1 By: Ken

Sequence Analysis

Analyzed LTC 1-5. The sequencing on each sample was in success. The results of sequencing with VF2 were desirable, but, on the other, only one of those with VR was desirable, the others were found bad sequencing. We decided to use LTC 2.

Saturday, October 2 By: Ken

Miniprep

Name	Concentration
SRRz-low	162.3 ng/µL
CTL	60.8 ng/µL

Restriction Digestion

LTC (EcoRI-SpeI)
CTL (EcoRI-SpeI)
SRRz low (EcoRI-XbaI)

Sunday, October 3 By: Ken

Miniprep

Name	Concentration
SRRz-low	237.3 ng/µL
CTL	138.8
LTC	441.2
CT	252.1

Restriction Digestion

Name	Template	10xbuffer	100xbuffer	EcoRI	XbaI	SpeI	CIAP	Water	Total
SRRz-low	7	4	0.4	0.3	0.3	-	1	27	40
CTL	10	4	0.4	0.3	-	0.3	-	25	40
LTC	4	4	0.4	0.3	-	0.3	-	31	40

Concentration(after purification)

Name	Concentration
SRRz-low(E-X)	36.9 ng/µL
CTL(E-S)	25.0
LTC(E-S)	64.3

Ligation and Transformation

Ligation and transformation of CTL-SRRz(CTLS) and LTC-SRRz(LTCS).

Name	Colony
CTLS	Some colonies
LTCS	Some colonies

Monday, October 4 By: Ken

Making culture

Cultured CTLS and LTCS with LB-Kan(+/- IPTG).

Tuesday, October 5 By: Ken

Results of Screening

The propagation wasn't observed on some samples on CTLS cultured with M9-Kan +IPTG. It meant that the construction of CTLS was in success. However, the growth was observed on all of samples of LTCS. So, we decided to retry the construction of LTCS.

Miniprep

Name	Concentration
LT	387.1 ng/µL

Making culture

Cultured CTLS.

Wednesday, October 6 By: Ken

Thursday, October 7 By: Ken

Miniprep

Name	Concentration
S_ΔTMD1	84.1 ng/µL
lac-SRRz	172.5

Restriction Digestion

Name	Template	10xbuffer	100xbuffer	EcoRI	PstI	Water	Total
LT	4	4	0.4	0.4	0.4	30.8	40
CT	6	4	0.4	0.4	0.4	28.8	40
CTL	11	4	0.4	0.4	0.4	23.8	40
LTC	4	4	0.4	0.4	0.4	30.8	40
SRRz	7	4	0.4	0.4	0.4	27.8	40
S_ΔTMD1	17	4	0.4	0.4	0.4	17.8	40

Concentration after purification

Name	Concentration
LT	107.9 ng/µL
CT	56.9
CTL	37.1
LTC	101.9
SRRz	55.7
S_ΔTMD1	102.9

Friday, October 8 By: Ken

Screening

Screened lac-SRRz 1-7(LB-Tc with IPTG 1.5mM). Except for sample 4, the propagation could be observed. So, we decided to use sample 4.

Restriction Digestion of pSB1C3

Template	10xbuffer	100xbuffer	EcoRI	PstI	Water	Total
5	4	0.4	0.4	0.4	28.4

Concentration after purification

Name	Concentration
pSB1C3(E-P)	16.1 ng/µL

Ligation and Transformation

Inserted LTC, CTL, T, SRRz, LT or CT to pSB1C3.

Name	Colony
LTC	Some colonies
CTL	No colony
T	Some colonies
SRRz	Some colonies
LT	Some colonies
CT	Some colonies

Saturday, October 9 By: Ken

Making culture

Cultured LTC, T, SRRz, LT, and CT with LB (Cp/Amp+).

Restriction digestion of LTC and SRRz-low

Name	Template	10xbuffer	100xbuffer	EcoRI	SpeI	Water	Total
LTC	3.5	4	0.4	0.6	0.6	30.9	40
SRRz-low	4	4	0.4	0.6	0.6	30.4	40

Ligation and Transformation of LTCS

Name	Colony
LTCS	Many colonies
control	few colonies

Used Top 10.

Sunday, October 10 By: Ken

Screening

Screened LTC, T, SRRz, LT, and CT. Except for LT1, the propagation could not be observed on each sample with LB (Amp+).

Miniprep

Name	Concentration
LTC1	210.6 ng/µL
T2	193.2
SRRz3	208.9
LT2	195.7
CT1	219.9
CTLS4-2	231.0
LTCS1	50.6

Restriction Digestion of LTC, T, SRRz, LT, CT, and CTLS

Template	10xBuffer	100xBuffer	EcoRI	PstI	MilliQ	Incubation
2 µL	1	0.1	0.2	0.2	6.5	60min

Electrophoreis

Lane 1, 8: Lambda, 100bp Marker
Lane 2-7: LTC, T, SRRz, LT, CT, CTLS

We could observe that the each part was correctly inserted to the pSB1C3.

Retry - Transformation of CTL (pSB1C3) and LTCS

Used KRX.

Deletion PCR of T2

Name	Template	2xBuffer	dNTPs	MgSO4	Primer1	Primer2	Primer3	KOD-FX	MilliQ	Total
GFP-Deletion1, 2	0.25 µL	25	10	3	1.5	-	1.5	1	8.75	50
GFP-DT-Deletion1, 2	0.25 µL	25	10	3	-	1.5	1.5	1	8.75	50

94℃	2min
98℃	10s	30 cycles
59℃	30s
68℃	3.5min
4℃	Hold

Primer:

ccaggcatcaaataaaacgaaaggctc
tactagtagcggccgctgc
ctctagtattattgatttctaccatcttctactcc

Monday, October 11 By: Ken

Restriction Digestion, Electrophoresis, Ligation and Transformation of PCR products

Template	DpnI	Incubation
25 µL	1	60min

Lane	Name
1,6	Lambda, 100bp Marker
2	GFP-Deletion1
3	GFP-Deletion2
4	GFP-DT-Deletion1
5	GFP-DT-Deletion2

Deletion PCR was well performed.

Template	Ligation High	T4 Kinase	Incubation
9 µL	5	1	90min

Name	Colony
S_ΔTMD1-dT	Many colonies
S_ΔTMD1	Many colonies

Competent Cell: TOP10

Sequence

Sequenced LTC1, T2, SRRz3, LT2, CT1, CTLS4-2 and LTCS1.

Template	5xBuffer	Primer	Big Dye	MilliQ	Total
(200ng)	2 µL	1	0.5	6.5	10

Primer:

VF2
VR
aggtgatgcaacatacggaaaacttacc
tgctgggattacacatggcatggatg
ttcctcgatatgctggcgtggtc

Used Primer 1 or 2 to each sample, and Primer 3, 4, or 5 only to CTLS4-2 and LTCS1.

96℃	1min
96℃	10s	40 cycles
50℃	5s
60℃	2min 5s
4℃	Hold

Except for CTLS4-2 and LTCS1 with Primer2, the sequencing of each sample were well performed. And LCT1, T2, LT2, and CT1 were confirmed that the sequence were correct. There was, however, deletion of some base pairs on lactose promoter [R0011]. of CTLS402.

Result: AATTGTGAGCGGATAACAAGATACTGAGCACA
BBa_R0011: AATTGTGAGCGGATAACAATTGACATTGTGAGCGGATAACAAGATACTGAGCACA

There is repeated sequence on lactose promoter and the one was deleted. So, we supposed that the homologous recombination was occureed. From this result, we could say that the function check of CTLS was failed because SRRz gene wasn't induced by IPTG.

Making culture of LTCS and CTL

Tuesday, October 12 By: Ken

Screening of CTL

The propagation could not be observed with LB-Amp and could be observed with LB-Cp. It meant that the part, CTL, was correctly inserted to the plasmid, pSB1C3.

Making culture

Cultured two samples on each part: S_ΔTMD1-dT and S_ΔTMD1. Named T1,3,4 and 6.

Wednesday, October 13 By: Ken

Thursday, October 14 By: Ken

Retry of the construction of CTLS

Friday, October 15 By: Ken

Screening of CTLS

Cultured CTLS with M9+IPTG. And the propagation couldn't be observed on one sample. We decided to use this sample.

Sequence Analysis

We did the sequencing on ML, MS, CTLS, T4 and CTL. The sequencing of T4 and CTL were in success and the others were failed. The results of CTL was desirable, but that of T4 was bad sequence and there was a mutation on PstI site. Including the last time sequencing, we could say that the deletion of GFP-terminator from S_ΔTMD1-GFP was failed. So, we decided to retry the deletion PCR.

Sunday, October 17 By: Ken

Retry of deletion PCR of T2

We used PCR to delete GFP and terminator[E0840] from S_ΔTMD1-E0840.

Name	Template	2xBuffer	dNTPs	Primer(fwd)	Primer(rev)	KOD-FX	MilliQ	Total
GFP-DT-Deletion1, 2	0.25 µL	25	10	1.5	1.5	1	10.75	50

94℃	2min
98℃	10s	30 cycles
68℃	3.5min	30 cycles
4℃	Hold

After the PCR, digestion by DpnI(37C/60min).

Electrophoresis

Lane 1,2,5,6: Lambda, 100bp Maker
Lane 3,4 PCR products[T'1,T'2]

PCR was in success.

Ligation

Ligation PCR products.

Monday, October 18 By: Ken

Transformation

Transformed T'1 and T'2.

Name	Colony
T'1	Some colonies
T'2	Some colonies

Thursday, October 21 By: Ken

Making Culture

Cultured two samples on each plate, T'1 and T'2. Named dele1-4. And also cultured lac-SRRz.

Friday, Ocotber 22 By: Ken

Miniprep

Name	Concentration
dele1	117.9 ng/µL
dele2	130.8
dele3	108.7
dele4	176.0
lac-SRRz	67.2

Saturday, October 23 By: Ken

Sequence Analysis

We used VF2 on dele1-4 and lac-SRRz and VR on lac-SRRz. The sequencing of lac-SRRz with VR was failed, the others were in success. The results were desirable on dele1,3,4 and lac-SRRz.

Deletion PCR of lac-SRRz

We used deletion PCR to get lac-S_ΔTMD1RRz.

Name	Template	2xBuffer	dNTPs	Primer1	Primer2	KOD	MilliQ	Total
lac-S_ΔTMD1RRz (1)	0.8	25	10	1.5	1.5	1	10.2	50
lac-S_ΔTMD1RRz (2)	0.8	25	10	1.5	1.5	1	10.2	50
control	0.8	25	10	1.5	1.5	0	11.2	50

94℃	2min
98℃	10s	30 cycles
68℃	5min	30 cycles
4℃	Hold

After the PCR, done restriction digestion by DpnI(37℃/60min).

Electrophoresis

Lane 1,8,2,7: Lambda, 100bp Maker
Lane3,4: lac-S_ΔTMD1RRz (1,2)
Lane5: control

Ligation and Transformation

Name	Colony
lac-S_ΔTMD1RRz(1)	some colonies
lac-S_ΔTMD1RRz(2)	some colonies
control	no colony

Used KRX.

Sunday, October 24 By: Ken

Making Culture

Cultured CTLS, Lysisbox and three samples of lac-S_ΔTMD1RRz with LB-Tc(IPTG 0 or 1mM).

Monday, October 25 By: Ken

Miniprep

Name	Concentration
CTLS	62.9 ng/µL
Lysisbox	31.9
lac-S_ΔTMD1RRz 1	140.9
lac-S_ΔTMD1RRz 2	71.6

The propagation was not observed on lac-S_ΔTMD1RRz 3 with LB (IPTG 1mM). It meant this sample might be lac-SRRz. We decided not to use this.

PCR

We used PCR on CTLS and Lysisbox to change its own constitutive promoter to another.

Name	Template	2xBuffer	dNTPs	Primer1	Primer2	Primer3	Primer4	KOD-FX	MilliQ	Total
C'TLS(1)	0.8 µL	25	10	1.5	1.5	-	-	1	10.2	50
C'TLS(2)	0.8 µL	25	10	1.5	1.5	-	-	1	10.2	50
Lysisbox'(1)	1.5 µL	25	10	-	-	1.5	1.5	1	9.5	50
Lysisbox'(2)	1.5 µL	25	10	-	-	1.5	1.5	1	9.5	50

94℃	2min
98℃	10s	30 cycles
68℃	6min 20s	30 cycles
4℃	Hold

Primer

aggtacagtgctagctactagaggagc
aggactgagctagccgtcaactc
aggtattatgctagctactagaggagc
aggactgagctagctgtaaactctag

Electrophoresis

Lane 1,8,2,7: Lambda, 100bp Maker
Lane 3,4: C'TLS(1,2)
Lane 5,6: Lysisbox'(1,2)

Two bands were observed on lane 5 and 6. We decided to do gel extraction.

Ligation

We did ligation of C'TLS(1,2).

Tuesday, October 26 By: Ken

Gel Extraction of Lysisbox'

Name	Concentration
Lysisbox'(1)	33.6 ng/µL
Lysisbox'(2)	43.4 ng/µL

Ligation

We did ligation of Lysisbox'(1,2).

Transformaiton

Transformed C'TLS(1,2) and Lysisbox'(1,2).

@@ Line 1: / Line 1: @@
 {{:Team:Kyoto/Header}}
-==Notebook==
+==Notebook1==
-===Construction for Lysisbox===
+===Construction===
 ====Tuesday, July 20 <span class="by">By: Wataru, Tomo, Yuki, Kazuya, Ken, Makoto</span>====
-=====[[Team:Kyoto/Protocols#Transformation|Transformation]]=====
+=====Transformation=====
 {| class="experiments"
 !Name||Well||Sample||Competent Cells||Total||Plate||Incubation||Colony
 |-
-|<partinfo>J23100</partinfo>||1-18-C||1 &micro;L||20||21||rowspan="7"|LB (Amp+)||rowspan="8"|At 37&#x2103;, 7/20 20:50 - 7/21 17:00||&#x25CB;
+|J23100||1-18-C||1 &micro;L||20||21||rowspan="7"|LB (Amp+)||rowspan="8"|At 37&#x2103;, 7/20 20:50 - 7/21 17:00||&#x25CB;
 |-
-|<partinfo>J23105</partinfo>||1-18-M||1||20||21||&#x25CB;
+|J23105||1-18-M||1||20||21||&#x25CB;
 |-
-|<partinfo>J23116</partinfo>||1-20-M||1||20||21||&#x25CB;
+|J23116||1-20-M||1||20||21||&#x25CB;
 |-
-|<partinfo>R0011</partinfo>||1-6-G||1||20||21||&#x25CB;
+|R0011||1-6-G||1||20||21||&#x25CB;
 |-
-|<partinfo>E0840</partinfo>||1-12-O||1||20||21||&#x25CB;
+|E0840||1-12-O||1||20||21||&#x25CB;
 |-
-|<partinfo>J06702</partinfo>||2-8-E||1||20||21||&#x25CB;
+|J06702||2-8-E||1||20||21||&#x25CB;
 |-
-|<partinfo>pSB4K5</partinfo>||1-5-G||1||20||21||&#xD7;
+|pSB4K5||1-5-G||1||20||21||&#xD7;
 |-
-|<partinfo>B0015</partinfo>||1-23-L||1||20||21||LB (Kan+)||&#xD7;
+|B0015||1-23-L||1||20||21||LB (Kan+)||&#xD7;
 |}
-A vector of <partinfo>pSB4K5</partinfo> is Kanamycin-resistance, however, we plated it to LB plate (Amp+). And We didn't pre-culture <partinfo>B0015</partinfo> despite its vector is Kanamycin-resistance. So, it was predicted that we will fail the transformation of <partinfo>pSB4K5</partinfo> and <partinfo>B0015</partinfo>.
+A vector of pSB4K5 is Kanamycin-resistance, however, we plated it to LB plate (Amp+). And We didn't pre-culture B0015 despite its vector is Kanamycin-resistance. So, it was predicted that we will fail the transformation of pSB4K5 and B0015.
 ====Wednesday, July 21 <span class="by">By: Wataru, Ken, Makoto, Takuya Y.</span>====
 =====Culture at 37&#x2103; from 07/21 20:50 to 07/22 17:00 and Making Master Plate=====
-=====[[Team:Kyoto/Protocols#Transformation|Transformation]]=====
+=====Transformation=====
 {| class="experiments"
 !Name||Well||Sample||Competent Cells||Total||Plate||Incubation||Colony
 |-
-|<partinfo>pSB4K5</partinfo>||1-5-G||1 &micro;L||20||21||rowspan="2"|LB (Kan+)||rowspan="2"|At 37&#x2103;, 7/21 20:50 - 7/22 16:30||&#x25CB;
+|pSB4K5||1-5-G||1 &micro;L||20||21||rowspan="2"|LB (Kan+)||rowspan="2"|At 37&#x2103;, 7/21 20:50 - 7/22 16:30||&#x25CB;
 |-
-|<partinfo>B0015</partinfo>||1-23-L||1||20||21||&#x25CB;
+|B0015||1-23-L||1||20||21||&#x25CB;
 |}
-=====[[Team:Kyoto/Protocols#Stantard PCR|PCR]] for SRRz and S=====
+=====PCR for SRRz and S=====
 {| class="experiments"
 !No.||Water||MgSO4||dNTPs||10xBuffer||Template DNA||Primer Fwd.||Primer Rev. (SRRz)||Primer Rev. (S)||KOD Plus ver.2||Total
@@ Line 71: / Line 71: @@
 ====Thursday, July 22 <span class="by">By: Wataru</span>====
-=====[[Team:Kyoto/Protocols#Electrophoresis|Electrophoresis]] (40min) of the PCR Products=====
+=====Electrophoresis (40min) of the PCR Products=====
 [[Image:KyotoExp100722-1.png|300px|right]]
-{| class="electrophoresis"
+* Sample: 1, 2, 5, 6 = SRRz, 3, 4, 7, 8 = S
-!No.||Name||Length(bp)||Result
+* Marker: 100bp, 1kb, 1kb, 100bp.
-|-
-|1||SRRz||1386||&#x25CB;
+=====Miniprep=====
-|-
-|2||SRRz||1386||&#x25CB;
-|-
-|3||S||442||&#x25CB;
-|-
-|4||S||442||&#x25CB;
-|-
-|5||SRRz||1386||&#x25CB;
-|-
-|6||SRRz||1386||&#x25CB;
-|-
-|7||S||442||&#x25CB;
-|-
-|8||S||442||&#x25CB;
-|}
-Marker: 100bp, 1kb, 1kb, 100bp.
-=====[[Team:Kyoto/Protocols#Miniprep|Miniprep]]=====
 {| class="experiments"
 !Name||Concentration
 |-
-|<partinfo>J23100</partinfo>||18.5 (ng/&micro;L)
+|J23100||18.5 (ng/&micro;L)
 |-
-|<partinfo>J23105</partinfo>||12.5
+|J23105||12.5
 |-
-|<partinfo>J23116</partinfo>||14.6
+|J23116||14.6
 |-
-|<partinfo>R0011</partinfo>||8.6
+|R0011||8.6
 |-
-|<partinfo>E0840</partinfo>||12.1
+|E0840||12.1
 |-
-|<partinfo>J06702</partinfo>||14.7
+|J06702||14.7
 |}
 The concentration of all samples was very week. Probably our shaking incubation was week.
-=====Culture from 07/22 17:00 to 07/23 10:00 and Making Master Plates of <partinfo>pSB4K5</partinfo> and <partinfo>B0015</partinfo>=====
+=====Culture from 07/22 17:00 to 07/23 10:00 and Making Master Plates of pSB4K5 and B0015=====
 ====Friday, July 23 <span class="by">By: Wataru, Tomo, Makoto</span>====
-=====[[Team:Kyoto/Protocols#Miniprep|Miniprep]]=====
+=====Miniprep=====
 {| class="experiments"
 !Name||Concentration
 |-
-|<partinfo>pSB4K5</partinfo>||79.2 (ng/&micro;L)
+|pSB4K5||79.2 (ng/&micro;L)
 |-
-|<partinfo>B0015</partinfo>||-
+|B0015||-
 |}
-We lost <partinfo>B0015</partinfo> by our mistake. The concentration of <partinfo>pSB4K5</partinfo> is high, so this condition of shaking incubation is moderate.
+We lost B0015 by our mistake. The concentration of pSB4K5 is high, so this condition of shaking incubation is moderate.
-=====[[Team:Kyoto/Protocols#PCR Purification|PCR Purification]]=====
+=====PCR Purification=====
 {| class="experiments"
 !No.||Name||Concentration||New Name
@@ Line 136: / Line 119: @@
 |}
 The concentration of sample number 1 and 5, the PCR products of S-R-Rz/Rz1, is week, so we desided to retry PCR.
-=====[[Team:Kyoto/Protocols#Standard_PCR|PCR]] for SRRz=====
+=====PCR for SRRz=====
 {| class="experiments"
 !No.||Water||MgSO4||dNTPs||10xBuffer||Template DNA||Primer Fwd. (SRRz)||Primer Rev. (SRRz)||KOD plus ver.2||Total
@@ Line 164: / Line 147: @@
 |4&#x2103;||forever||
 |}
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]] and [[Team:Kyoto/Protocols#Electrophoresis|Electrophoresis]] (35min) to check function of our Restriction Enzyme=====
+=====Restriction Digestion and Electrophoresis (35min) to check function of our Restriction Enzyme=====
 {| class="experiments"
 !No.||Name||Sample||10xBuffer||BSA||colspan="2"|Enzyme||MilliQ||Total||Incubation
 |-
-|1||<partinfo>J06702</partinfo>||5 &micro;L||1||0.1||EcoRI||0.1||3.6||10||rowspan="5"|At 37&#x2103; 7/23 18:00 - 7/23 18:30
+|1||J06702||5 &micro;L||1||0.1||EcoRI||0.1||3.6||10||rowspan="5"|At 37&#x2103; 7/23 18:00 - 7/23 18:30
 |-
-|2||<partinfo>J06702</partinfo>||5||1||0.1||XbaI||0.1||3.6||10
+|2||J06702||5||1||0.1||XbaI||0.1||3.6||10
 |-
-|3||<partinfo>J06702</partinfo>||5||1||0.1||SpeI||0.1||3.6||10
+|3||J06702||5||1||0.1||SpeI||0.1||3.6||10
 |-
-|4||<partinfo>J06702</partinfo>||5||1||0.1||PstI||0.1||3.6||10
+|4||J06702||5||1||0.1||PstI||0.1||3.6||10
 |-
-|5||<partinfo>J06702</partinfo>||5||1||0.1||colspan="2"|-||3.7||10
+|5||J06702||5||1||0.1||colspan="2"|-||3.7||10
 |}
 [[Image:KyotoExp100723-1.png|300px|right]]
 Marker: 1kb.
 Comparison to No. 5 (control, circular DNA), the bands of No. 1, 2, 3, and 4 was shifted. The DNA of them was linearized by Restriction enzymes.  So, our restriction enzymes work correctly.
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]] and [[Team:Kyoto/Protocols#Ligation|Ligation]] to insert S gene to <partinfo>E0840</partinfo>=====
+=====Restriction Digestion and Ligation to insert S gene to E0840=====
 {| class="experiments"
 !Name||Sample||10xBuffer||colspan="2"|Enzyme 1||colspan="2"|Enzyme 2||MilliQ||Total||Incubation
@@ Line 189: / Line 172: @@
 |S<sub>Sam7</sub>(2)||11||5||EcoRI||0.2||SpeI||0.2||33.6||50
 |-
-|<partinfo>E0840</partinfo>||45||5||EcoRI||0.2||XbaI||0.2||0||50
+|E0840||45||5||EcoRI||0.2||XbaI||0.2||0||50
 |}
 After PCR Purification, evaporated them and diluted 3&micro;L.
@@ Line 195: / Line 178: @@
 !Name||colspan="2"|Vector||colspan="2"|Insert||Ligation High||Total
 |-
-|S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||<partinfo>E0840</partinfo>||0.5&micro;L||S<sub>Sam7</sub>(1)||0.5||1||2
+|S<sub>Sam7</sub>(1)-E0840||E0840||0.5&micro;L||S<sub>Sam7</sub>(1)||0.5||1||2
 |-
-|S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||<partinfo>E0840</partinfo>||0.5||S<sub>Sam7</sub>(2)||0.5||1||2
+|S<sub>Sam7</sub>(2)-E0840||E0840||0.5||S<sub>Sam7</sub>(2)||0.5||1||2
 |}
 ====Monday, July 26 <span class="by">By: Wataru, Tomonori, Makoto</span>====
-=====[[Team:Kyoto/Protocols#Electrophoresis|Electrophoresis]] of PCR Products=====
+=====Electrophoresis of PCR Products=====
 [[Image:KyotoExp100726-1.png|300px|right]]
 {| class="electrophoresis"
@@ Line 231: / Line 214: @@
 |6||SRRZ||59.6||SRRz<sub>Sam7</sub>(2)
 |}
-=====[[Team:Kyoto/Protocols#Transformation|Transformation]]=====
+=====Transformation=====
 {| class="experiments"
 !Name||Well||Sample||Competent Cell||Total||Plate||Incubation||Colony
 |-
-|<partinfo>E0240</partinfo>||1-12-M||1 &micro;L||20||21||LB (Amp+)||rowspan="3"|At 37&#x2103; 7/26 - 7/27||&#xD7;
+|E0240||1-12-M||1 &micro;L||20||21||LB (Amp+)||rowspan="3"|At 37&#x2103; 7/26 - 7/27||&#xD7;
 |-
-|<partinfo>I20260</partinfo>||2-17-F||1||20||21||rowspan="2"|LB (Kan+)||&#xD7;
+|I20260||2-17-F||1||20||21||rowspan="2"|LB (Kan+)||&#xD7;
 |-
-|<partinfo>J04450</partinfo>||1-5-E||1||20||21||&#xD7;
+|J04450||1-5-E||1||20||21||&#xD7;
 |}
-=====Culture of <partinfo>pSB4K5</partinfo>, <partinfo>E0840</partinfo>, and <partinfo>B0015</partinfo>=====
+=====Culture of pSB4K5, E0840, and B0015=====
-====Tuesday, July 27 <span class="by">By: Wataru, Tomo, Kazuya, Ken, Naoi====
+====Tuesday, July 27 <span class="by">By: Wataru, Tomo, Kazuya, Ken, Naoi</span>====
-=====[[Team:Kyoto/Protocols#Colony PCR|Colony PCR]] of S<sub>Sam7</sub>-<partinfo>E0840</partinfo> (Electrophoresis for 35min)=====
+=====Colony PCR of S<sub>Sam7</sub>-E0840 (Electrophoresis for 35min)=====
 [[Image:KyotoExp100727-1.png|300px|right]]
 {| class="electrophoresis"
 !No.||Name||Length||Result
 |-
-|1||S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||1522||&#x25CB;
+|1||S<sub>Sam7</sub>(1)-E0840||1522||&#x25CB;
 |-
-|2||S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||1522||&#xD7;
+|2||S<sub>Sam7</sub>(1)-E0840||1522||&#xD7;
 |-
-|3||S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||1522||&#x25CB;
+|3||S<sub>Sam7</sub>(1)-E0840||1522||&#x25CB;
 |-
-|4||S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||1522||&#xD7;
+|4||S<sub>Sam7</sub>(1)-E0840||1522||&#xD7;
 |-
-|5||S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||1522||&#x25CB;
+|5||S<sub>Sam7</sub>(1)-E0840||1522||&#x25CB;
 |-
-|6||S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||1522||&#x25CE; (Use as S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>)
+|6||S<sub>Sam7</sub>(1)-E0840||1522||&#x25CE; (Use as S<sub>Sam7</sub>(1)-E0840)
 |-
-|7||S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||1522||&#xD7;
+|7||S<sub>Sam7</sub>(2)-E0840||1522||&#xD7;
 |-
-|8||S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||1522||&#xD7;
+|8||S<sub>Sam7</sub>(2)-E0840||1522||&#xD7;
 |-
-|9||S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||1522||&#xD7;
+|9||S<sub>Sam7</sub>(2)-E0840||1522||&#xD7;
 |-
-|10||S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||1522||&#xD7;
+|10||S<sub>Sam7</sub>(2)-E0840||1522||&#xD7;
 |-
-|11||S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||1522||&#x25CE; (Use as S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>)
+|11||S<sub>Sam7</sub>(2)-E0840||1522||&#x25CE; (Use as S<sub>Sam7</sub>(2)-E0840)
 |-
-|12||S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||1522||&#x25CB;
+|12||S<sub>Sam7</sub>(2)-E0840||1522||&#x25CB;
 |-
-|13||S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||1522||&#x25CB;
+|13||S<sub>Sam7</sub>(2)-E0840||1522||&#x25CB;
 |-
-| +||<partinfo>E0840</partinfo>||1116||
+| +||E0840||1116||
 |-
 | -||None||||
 |}
 Marker: 1kb, 100bp
-=====[[Team:Kyoto/Protocols#Miniprep|Miniprep]]=====
+=====Miniprep=====
 {| class="experiments"
 !Name||Concentration
 |-
-|<partinfo>R0011</partinfo>||26.9 ng/&micro;L
+|R0011||26.9 ng/&micro;L
 |-
-|<partinfo>B0015</partinfo>||120.0
+|B0015||120.0
 |-
-|<partinfo>E0840</partinfo>||120.1
+|E0840||120.1
 |}
-=====[[Team:Kyoto/Protocols#RestrictionDigestion|Restriction Digestion]]=====
+=====Restriction Digestion=====
 {| class="experiments"
 !Name||Sample||2 buffer||BSA||colspan="2"|Enzyme 1||colspan="2"|Enzyme 2||MilliQ||Total||Incubation
 |-
-|<partinfo>B0015</partinfo>||30 &micro;L||5||0.5||EcoRI||0.4||XbaI||0.3||13.7||50||rowspan="3"|At 37&#x2103; 16:45 - 18:00
+|B0015||30 &micro;L||5||0.5||EcoRI||0.4||XbaI||0.3||13.7||50||rowspan="3"|At 37&#x2103; 16:45 - 18:00
 |-
 |SRRz<sub>Sam7</sub>(1)||40||5||0.5||EcoRI||0.4||SpeI||0.4||3.8||50
@@ Line 301: / Line 284: @@
 |SRRz<sub>Sam7</sub>(2)||40||5||0.5||EcoRI||0.4||SpeI||0.4||3.8||50
 |}
-=====[[Team:Kyoto/Protocols#Ligation|Ligation]]=====
+=====Ligation=====
-=====[[Team:Kyoto/Protocols#Transformation|Transformation]]=====
+=====Transformation=====
 {| class="experiments"
 !Name||Sample||Competent Cells||Total||Plate||Incubation||Colony
@@ Line 313: / Line 296: @@
 ====Wednesday, July 28 <span class="by">By: </span>====
-=====[[Team:Kyoto/Protocols#Miniprep|Miniprep]]=====
+=====Miniprep=====
 {| class="experiments"
 !Name||Concentration
 |-
-|S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||95.5 ng/&micro;L
+|S<sub>Sam7</sub>(1)-E0840||95.5 ng/&micro;L
 |-
-|S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||98.6
+|S<sub>Sam7</sub>(2)-E0840||98.6
 |}
-Diluted S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo> and S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo> 20 times with water, and used as template DNA.
+Diluted S<sub>Sam7</sub>(1)-E0840 and S<sub>Sam7</sub>(2)-E0840 20 times with water, and used as template DNA.
-=====[[Team:Kyoto/Protocols#Mutagenesis (Point mutation, Deletion, Insertion)|Deletion PCR]] to delete a functional domain of S gene=====
+=====Deletion PCR to delete a functional domain of S gene=====
 {| class="experiments"
 !||Water||MgSO4||dNTPs||10xBuffer||Primer Fwd.||Primer Rev.||Template (1)||Template (2)||KOD Plus ver.2||Total
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(1)-<partinfo>E0840</partinfo> (1)||28 &micro;L||3||5||5||1.5||1.5||5||-||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>(1)-E0840 (1)||28 &micro;L||3||5||5||1.5||1.5||5||-||1||50
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(1)-<partinfo>E0840</partinfo> (2)||28||3||5||5||1.5||1.5||5||-||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>(1)-E0840 (2)||28||3||5||5||1.5||1.5||5||-||1||50
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(2)-<partinfo>E0840</partinfo> (1)||28||3||5||5||1.5||1.5||-||5||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>(2)-E0840 (1)||28||3||5||5||1.5||1.5||-||5||1||50
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(2)-<partinfo>E0840</partinfo> (2)||28||3||5||5||1.5||1.5||-||5||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>(2)-E0840 (2)||28||3||5||5||1.5||1.5||-||5||1||50
 |}
 {| class="experiments"
@@ Line 346: / Line 329: @@
 |}
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]] to check the function of DpnI=====
+=====Restriction Digestion to check the function of DpnI=====
 {| class="experiments"
 !Name||Sample||fast digestion buffer||DpnI||MilliQ||Total
 |-
-|S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||3 &micro;L||1||0.1||5.8||10
+|S<sub>Sam7</sub>(1)-E0840||3 &micro;L||1||0.1||5.8||10
 |-
-|S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||3||1||0.1||5.8||10
+|S<sub>Sam7</sub>(2)-E0840||3||1||0.1||5.8||10
 |}
-=====[[Team:Kyoto/Protocols#Electrophoresis|Electrophoresis]] for 35min=====
+=====Electrophoresis for 35min=====
-[[image:KyotoExp100728-1.png|300px|right]]
+[[Image:KyotoExp100728-1.png|300px|right]]
 {| class="electrophoresis"
 !No.||Name||Length||Result
 |-
-|1||Not digested S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||3363bp||
+|1||Not digested S<sub>Sam7</sub>(1)-E0840||3363bp||
 |-
-|2||Not digested S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||3363||
+|2||Not digested S<sub>Sam7</sub>(2)-E0840||3363||
 |-
-|3||Digested S<sub>Sam7</sub>(1)-<partinfo>E0840</partinfo>||1021, 933, 402, 341, 258, 105, ...||
+|3||Digested S<sub>Sam7</sub>(1)-E0840||1021, 933, 402, 341, 258, 105, ...||
 |-
-|4||Digested S<sub>Sam7</sub>(2)-<partinfo>E0840</partinfo>||1021, 933, 402, 341, 258, 105, ...||
+|4||Digested S<sub>Sam7</sub>(2)-E0840||1021, 933, 402, 341, 258, 105, ...||
 |}
 Marker: 1kb, 100bp
@@ Line 372: / Line 355: @@
 ====Thursday, July 29 <span class="by">By: </span>====
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]]=====
+=====Restriction Digestion=====
 {| class="experiments"
 !Name||Sample volume||Fastdigestion Buffer||colspan="2"|Enzyme 1||MilliQ||Total||Incubation
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(1)-<partinfo>E0840</partinfo> (1)||50 &micro;L||6||DpnI||0.2||3.8||60||rowspan="2"|07/29 09:40 - 07/29 11:00
+|S<sub>Sam7,&Delta;TMD1</sub>(1)-E0840 (1)||50 &micro;L||6||DpnI||0.2||3.8||60||rowspan="2"|07/29 09:40 - 07/29 11:00
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(2)-<partinfo>E0840</partinfo> (1)||50||6||DpnI||0.2||3.8||60
+|S<sub>Sam7,&Delta;TMD1</sub>(2)-E0840 (1)||50||6||DpnI||0.2||3.8||60
 |}
-=====[[Team:Kyoto/Protocols#Ligation|Ligation]] and [[Team:Kyoto/Protocols#Phosphorylation|Phosphorylation]]=====
+=====Ligation and Phosphorylation=====
 {| class="experiments"
 !Name||Sample||MilliQ||Ligation High||T4 Kinase||Total||Incubation
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(1)-<partinfo>E0840</partinfo> (1)||2 &micro;L||7||5||1||15||rowspan="2"|07/29 11:30 ~ 07/29 13:00
+|S<sub>Sam7,&Delta;TMD1</sub>(1)-E0840 (1)||2 &micro;L||7||5||1||15||rowspan="2"|07/29 11:30 ~ 07/29 13:00
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(2)-<partinfo>E0840</partinfo> (1)||2||7||5||1||15
+|S<sub>Sam7,&Delta;TMD1</sub>(2)-E0840 (1)||2||7||5||1||15
 |}
-=====[[Team:Kyoto/Protocols#Transformation|Transformation]]=====
+=====Transformation=====
 {| class="experiments"
 !Name||Sample Volume||Competent Cell||Total||Plate||Incubation||Colony
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(1)-<partinfo>E0840</partinfo> (1)||3 &micro;L||30||33||rowspan="2"|LB (Amp+)||rowspan="2"|07/29 ~ 07/30||&#x25CB;
+|S<sub>Sam7,&Delta;TMD1</sub>(1)-E0840 (1)||3 &micro;L||30||33||rowspan="2"|LB (Amp+)||rowspan="2"|07/29 ~ 07/30||&#x25CB;
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>(2)-<partinfo>E0840</partinfo> (1)||3||30||33||&#x25CB;
+|S<sub>Sam7,&Delta;TMD1</sub>(2)-E0840 (1)||3||30||33||&#x25CB;
 |}
 ====Monday, August 2 <span class="by">By: Wataru, Ken</span>====
-=====[[Team:Kyoto/Protocols#Miniprep|Miniprep]]=====
+=====Miniprep=====
 {| class="experiments"
 !Name||Concentration
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1)||52.7 ng/&micro;L
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (1)||52.7 ng/&micro;L
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2)||54.4
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (2)||54.4
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (3)||89.5
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (3)||89.5
 |-
-|<partinfo>pSB4K5</partinfo>||50.7
+|pSB4K5||50.7
 |-
-|<partinfo>R0011</partinfo>||18.6
+|R0011||18.6
 |}
-=====[[Team:Kyoto/Protocols#Standard_PCR|Standard PCR]] of <partinfo>E0240</partinfo>=====
+=====PCR of E0240=====
-<partinfo>E0240</partinfo> is very important parts to measure RPU of promoters in iGEM. However, we failed to transfect it to E.coli from parts kit of iGEM. So we decided to amplify this parts by PCR.
+E0240 is very important parts to measure RPU of promoters in iGEM. However, we failed to transfect it to E.coli from parts kit of iGEM. So we decided to amplify this parts by PCR.
 {| class="experiments"
-!Name||Water||MgSO4||dNTPs||10xBuffer||Primer VF2||Primer VR||Template <partinfo>E0240</partinfo>||KOD Pllus ver.2||Total
+!Name||Water||MgSO4||dNTPs||10xBuffer||Primer VF2||Primer VR||Template E0240||KOD Pllus ver.2||Total
 |-
-|<partinfo>E0240</partinfo>(1)||28 &micro;L||3||5||5||1.5||1.5||5||1||50
+|E0240(1)||28 &micro;L||3||5||5||1.5||1.5||5||1||50
 |-
-|<partinfo>E0240</partinfo>(2)||28||3||5||5||1.5||1.5||5||1||50
+|E0240(2)||28||3||5||5||1.5||1.5||5||1||50
 |}
 {| class="experiments"
@@ Line 433: / Line 416: @@
 |4&#x2103;||forever||
 |}
-=====[[Team:Kyoto/Protocols#Electrophoresis|Electrophoresis]]=====
+=====Electrophoresis=====
-=====[[Team:Kyoto/Protocols#PCR Purification|PCR Purification]]=====
+=====PCR Purification=====
 {| class="experiments"
 !Name||Concentration
 |-
-|<partinfo>E0240</partinfo>(1)||42.6 ng/&micro;L
+|E0240(1)||42.6 ng/&micro;L
 |-
-|<partinfo>E0240</partinfo>(2)||55.3
+|E0240(2)||55.3
 |}
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]] for inserting <partinfo>E0240</partinfo> to <partinfo>pSB4K5</partinfo> by 3A assembly=====
+=====Restriction Digestion for inserting E0240 to pSB4K5 by 3A assembly=====
 {| class="experiments"
 !Name||Sample volume||2 buffer||BSA||colspan="2"|Enzyme 1||colspan="2"|Enzyme 2||MilliQ||Total
 |-
-|<partinfo>E0240</partinfo>(1) [XP]||30 &micro;L||5||0.5||XbaI||0.2||PstI||0.2||14.1||50
+|E0240(1) [XP]||30 &micro;L||5||0.5||XbaI||0.2||PstI||0.2||14.1||50
 |-
-|<partinfo>E0240</partinfo>(2) [XP]||30||5||0.5||XbaI||0.2||PstI||0.2||14.1||50
+|E0240(2) [XP]||30||5||0.5||XbaI||0.2||PstI||0.2||14.1||50
 |}
 =====PCR Purification=====
@@ Line 454: / Line 437: @@
 !Name||Concentration||Volume
 |-
-|<partinfo>E0240</partinfo>(1) [XP]||21.8 ng/&micro;L||40 &micro;L
+|E0240(1) [XP]||21.8 ng/&micro;L||40 &micro;L
 |-
-|<partinfo>E0240</partinfo>(2) [XP]||32.4||45
+|E0240(2) [XP]||32.4||45
 |}
 Stored at -20&#x2103;.
@@ Line 463: / Line 446: @@
 !Name||Water||MgSO4||dNTPs||10xBuffer||Primer VF2||Primer VR||Template (1)||Template (2)||Template (3)||KOD Pllus ver.2||Total
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1)||32 &micro;L||3||5||5||1.5||1.5||1||-||-||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (1)||32 &micro;L||3||5||5||1.5||1.5||1||-||-||1||50
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2)||32||3||5||5||1.5||1.5||-||1||-||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (2)||32||3||5||5||1.5||1.5||-||1||-||1||50
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (3)||32||3||5||5||1.5||1.5||-||-||1||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (3)||32||3||5||5||1.5||1.5||-||-||1||1||50
 |}
 {| class="experiments"
@@ Line 478: / Line 461: @@
 |4&#x2103;||forever||
 |}
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]] of S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> by DpnI=====
+=====Restriction Digestion of S<sub>Sam7,&Delta;TMD1</sub>-E0840 by DpnI=====
-=====[[Team:Kyoto/Protocols#Transformation|Transformation]]=====
+=====Transformation=====
 {| class="experiments"
 !Name||Sample||Competent Cells||Total||Plate||Incubation||Colony
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1)||2 &micro;L||20||22||rowspan="3"|-||rowspan="3"|-||&#x25CB;
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (1)||2 &micro;L||20||22||rowspan="3"|-||rowspan="3"|-||&#x25CB;
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2)||2||20||22||&#x7D;
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (2)||2||20||22||&#xD7;
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (3)||2||20||22||&#x25CB;
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (3)||2||20||22||&#x25CB;
 |}
 ====Tuesday, August 3 <span class="by">By: </span>====
 =====Culture=====
-Picked two colonies from S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1), and S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (3), and cultured at 37&#x2103; from 08/03 to 08/04.
+Picked two colonies from S<sub>Sam7,&Delta;TMD1</sub>-E0840 (1), and S<sub>Sam7,&Delta;TMD1</sub>-E0840 (3), and cultured at 37&#x2103; from 08/03 to 08/04.
-=====[[Team:Kyoto/Protocols#Miniprep|Miniprep]]=====
+=====Miniprep=====
 {| class="experiments"
 !Name||Concentration
 |-
-|<partinfo>pSB4K5</partinfo>||60.7 ng/&micro;L
+|pSB4K5||60.7 ng/&micro;L
 |-
-|<partinfo>R0011</partinfo>||26.8
+|R0011||26.8
 |}
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]]=====
+=====Restriction Digestion=====
 {| class="experiments"
 !Name||Sample||2 buffer||BSA||colspan="2"|Enzyme 1||colspan="2"|Enzyme 2||MilliQ||Total
 |-
-|<partinfo>R0011</partinfo> [ES]||50 &micro;L||6||0.6||EcoRI||0.2||SpeI||0.2||3||60
+|R0011 [ES]||50 &micro;L||6||0.6||EcoRI||0.2||SpeI||0.2||3||60
 |-
-|<partinfo>pSB4K5</partinfo> [EP]||50||6||0.6||EcoRI||0.2||PstI||0.2||3||60
+|pSB4K5 [EP]||50||6||0.6||EcoRI||0.2||PstI||0.2||3||60
 |-
-|<partinfo>E0240</partinfo>(1) [XP]||50||6||0.6||XbaI||0.2||PstI||0.2||3||60
+|E0240(1) [XP]||50||6||0.6||XbaI||0.2||PstI||0.2||3||60
 |-
-|<partinfo>E0240</partinfo>(2) [XP]||50||6||0.6||XbaI||0.2||PstI||0.2||3||60
+|E0240(2) [XP]||50||6||0.6||XbaI||0.2||PstI||0.2||3||60
 |}
 =====PCR Purification=====
@@ Line 517: / Line 500: @@
 !Name||Concentration
 |-
-|<partinfo>pSB4K5</partinfo> [EP]||39.5 ng/&micro;L
+|pSB4K5 [EP]||39.5 ng/&micro;L
 |-
-|<partinfo>E0240</partinfo>(1) [XP]||21.8
+|E0240(1) [XP]||21.8
 |-
-|<partinfo>E0240</partinfo>(2) [XP]||32.4
+|E0240(2) [XP]||32.4
 |}
-<partinfo>pSB4K5</partinfo> [EP] is concentrated 10&micro;L and <partinfo>E0240</partinfo>(1) [XP], <partinfo>E0240</partinfo>(2) [XP] are concentrated 1&micro;L.
+pSB4K5 [EP] is concentrated 10&micro;L and E0240(1) [XP], E0240(2) [XP] are concentrated 1&micro;L.
 =====Ethanol Precipitation=====
-After ethanol precipitation, we diluted <partinfo>pSB4K5</partinfo> by 2&micro;L MilliQ
+After ethanol precipitation, we diluted pSB4K5 by 2&micro;L MilliQ
-=====[[Team:Kyoto/Protocols#Ligation|Ligation]]=====
+=====Ligation=====
 {| class="experiments"
-!Name||Vector||colspan="2"|Insert 1||colspan="2"|Insert 2||Ligation High||Total||Incubation
+!Name||Vector||colspan="2"|Insert 1||colspan="2"|Insert 2||Ligation High||T4 Kinase||Total||Incubation
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>]||<partinfo>pSB4K5</partinfo> [EP]||1||<partinfo>R0011</partinfo>  [ES]||1||<partinfo>E0240</partinfo>(1) [XP]||1||3||15||rowspan="2"|17:30 - 20:20
+|ML (1)||pSB4K5 [EP]||1||R0011  [ES]||1||E0240(1) [XP]||1||3||15||rowspan="2"|17:30 - 20:20
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>]||<partinfo>pSB4K5</partinfo> [EP]||1||<partinfo>R0011</partinfo> [ES]||1||<partinfo>E0240</partinfo>(2) [XP]||1||3||15
+|ML (2)||pSB4K5 [EP]||1||R0011 [ES]||1||E0240(2) [XP]||1||3||15
 |}
-=====[[Team:Kyoto/Protocols#Standard PCR|Standard PCR]] of <partinfo>I20260</partinfo>=====
+=====PCR of I20260=====
 {| class="experiments"
-!Name||Water||MgSO4||dNTPs||10xBuffer||Primer VF2||Primer VR||Template <partinfo>I20260</partinfo>||KOD plus ver.2||Total
+!Name||Water||MgSO4||dNTPs||10xBuffer||Primer VF2||Primer VR||Template I20260||KOD plus ver.2||Total
 |-
-|<partinfo>I20260</partinfo> (1)||32&micro;L||3||5||5||1.5||1.5||1||1||50
+|I20260 (1)||32&micro;L||3||5||5||1.5||1.5||1||1||50
 |-
-|<partinfo>I20260</partinfo> (2)||32||3||5||5||1.5||1.5||-||1||50
+|I20260 (2)||32||3||5||5||1.5||1.5||-||1||50
 |}
 {| class="experiments"
@@ Line 553: / Line 537: @@
 |4&#x2103;||forever||
 |}
-=====[[Team:Kyoto/Protocols#PCR Purification|PCR Purification]]=====
+=====PCR Purification=====
 {| class="experiments"
 !Name||Concentration
 |-
-|<partinfo>I20260</partinfo>||40.6 ng/&micro;L
+|I20260||40.6 ng/&micro;L
 |}
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]]=====
+=====Restriction Digestion=====
 {| class="experiments"
 !Name||Sample volume||2 buffer||BSA||colspan="2"|Enzyme 1||colspan="2"|Enzyme 2||MilliQ||Total
 |-
-|<partinfo>I20260</partinfo> [EP]||45 &micro;L||6||0.6||EcoRI||0.2||PstI||0.2||8||60
+|I20260 [EP]||45 &micro;L||6||0.6||EcoRI||0.2||PstI||0.2||8||60
 |}
-=====[[Team:Kyoto/Protocols#PCR Purification|PCR Purification]]=====
+=====PCR Purification=====
 {| class="experiments"
 !Name||Concentration||Volume
 |-
-|<partinfo>I20260</partinfo> [EP]||74.1 ng/&micro;L||30
+|I20260 [EP]||74.1 ng/&micro;L||30
 |}
-<partinfo>I20260</partinfo> [EP] is concentrated at 7&micro;L
+I20260 [EP] is concentrated at 7&micro;L
-=====[[Team:Kyoto/Protocols#Ligation|Ligation]]=====
+=====Ligation=====
 {| class="experiments"
 !||Vector||colspan="2"|Insert||colspan="2"|Ligation High||Total||Incubation
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>]||<partinfo>pSB4K5</partinfo> [EP]||1||<partinfo>I20260</partinfo> [EP]||1||2||4||20:00-20:30
+|MS||pSB4K5 [EP]||1||I20260 [EP]||1||2||4||20:00-20:30
 |}
 <div class="measure-construction">
@@ Line 583: / Line 567: @@
 !Name||Sample||Competent Cell||Total||Plate||Incubation||Colony
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>]||1 &micro;L||20||21||rowspan="3"|LB (Kan+)||rowspan="3"|08/03-08/04||&#x25CB;
+|ML (1)||1 &micro;L||20||21||rowspan="3"|LB (Kan+)||rowspan="3"|08/03-08/04||&#x25CB;
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>]||1||20||21||&#x25CB;
+|ML (2)||1||20||21||&#x25CB;
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>]||1||20||21||&#x25CB;
+|MS||1||20||21||&#x25CB;
 |}
@@ Line 593: / Line 577: @@
 ====Thursday, August 5 <span class="by">By: </span>====
 =====Culture and Master Plates=====
-<partinfo>pSB4K5</partinfo> is inserted RFP generator. We didn't distinguish this inserted parts from low copy plasmid backbone, so self-ligated colony is red. So, white colony is correctly inserted parts.
+pSB4K5 is inserted RFP generator. We didn't distinguish this inserted parts from low copy plasmid backbone, so self-ligated colony is red. So, white colony is correctly inserted parts.
-However, white colonies and green colonies are observed in <partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] and <partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] plate. We cultured both white and green colonies.
+However, white colonies and green colonies are observed in ML (1) and ML (2) plate. We cultured both white and green colonies.
-In <partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>], Many of colonies are red, but green colonies are observed. We cultured green colonies.
+In MS, Many of colonies are red, but green colonies are observed. We cultured green colonies.
 {| class="experiments"
 !Name||Color||Incubation
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (1)||Green Colony||rowspan="11"|8/5-8/6
+|ML (1-1)||Green Colony||rowspan="11"|8/5-8/6
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (2)||Green Colony
+|ML (1-2)||Green Colony
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (3)||White Colony
+|ML (1-3)||White Colony
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (4)||White Colony
+|ML (1-4)||White Colony
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (1)||Green Colony
+|ML (2-1)||Green Colony
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (2)||White Colony
+|ML (2-2)||White Colony
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (3)||White Colony
+|ML (2-3)||White Colony
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (4)||White Colony
+|ML (2-4)||White Colony
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (1)||Green Colony
+|MS (1)||Green Colony
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (2)||Green Colony
+|MS (2)||Green Colony
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (3)||Green Colony
+|MS (3)||Green Colony
 |}
 =====Sequence=====
@@ Line 627: / Line 611: @@
 !Name||Concentration
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo>(1) A||28.9 ng/&micro;L
+|S<sub>&Delta;TMD1</sub>-E0840(1) A||28.9 ng/&micro;L
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo>(1) B||25.3
+|S<sub>&Delta;TMD1</sub>-E0840(1) B||25.3
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo>(3) A||26.6
+|S<sub>&Delta;TMD1</sub>-E0840(3) A||26.6
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo>(3) B||24.0
+|S<sub>&Delta;TMD1</sub>-E0840(3) B||24.0
 |}
 As a result, deletion is succeeded, however, point mutation is failed. It is because DpnI is too little to digest all of template DNA.
@@ Line 643: / Line 627: @@
 !Name
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (1)
+|ML (1-1)
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (2)
+|ML (1-2)
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (3)
+|ML (1-3)
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (4)
+|ML (1-4)
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (1)
+|ML (2-1)
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (2)
+|ML (2-2)
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (3)
+|ML (2-3)
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (4)
+|ML (2-4)
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (1)
+|MS (1)
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (2)
+|MS (2)
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (3)
+|MS (3)
 |}
 =====Restriction Digestion=====
@@ Line 669: / Line 653: @@
 !Name||Sample||2 buffer||BSA||colspan="2"|Enzyme 1||colspan="2"|Enzyme 2||MilliQ||Total
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (1) [EP]||50 &micro;L||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|ML (1-1) [EP]||50 &micro;L||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (2) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|ML (1-2) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (3) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|ML (1-3) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (4) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|ML (1-4) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (1) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|ML (2-1) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (2) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|ML (2-2) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (3) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|ML (2-3) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (4) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|ML (2-4) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (1) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|MS (1) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (2) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|MS (2) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (3) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
+|MS (3) [EP]||50||6||0.6||EcoRI||0.3||PstI||0.3||2.8||60
 |}
-========Electrophoresis======
+=====Electrophoresis=====
-{| class="experiments"
+[[Image:KyotoExp100806-1.png|300px|right]]
+{| class="electrophoresis"
 !No.||Name||Length||Results
 |-
-|1||<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (1) [EP]||960, 4339||
+|1||MS (1) [EP]||960, 4339||
 |-
-|2||<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (2) [EP]||960, 4339||
+|2||MS (2) [EP]||960, 4339||
 |-
-|3||<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (3) [EP]||960, 4339||
+|3||MS (3) [EP]||960, 4339||
 |-
-|4||<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (1) [EP]||980 3378||&#x25CB;
+|4||ML (1-1) [EP]||980 3378||&#x25CB;
 |-
-|5||<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (2) [EP]||980 3378||&#x25CB;
+|5||ML (1-2) [EP]||980 3378||&#x25CB;
 |-
-|6||<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (3) [EP]||980 3378||&#x7D;
+|6||ML (1-3) [EP]||980 3378||&#xD7;
 |-
-|7||<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(1) [<partinfo>pSB4K5</partinfo>] (4) [EP]||980 3378||&#x7D;
+|7||ML (1-4) [EP]||980 3378||&#xD7;
 |-
-|8||<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (1) [EP]||980 3378||&#x25CB;
+|8||ML (2-1) [EP]||980 3378||&#x25CB;
 |-
-|9||<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (2) [EP]||980 3378||&#x7D;
+|9||ML (2-2) [EP]||980 3378||&#xD7;
 |-
-|10||<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (3) [EP]||980 3378||&#x7D;
+|10||ML (2-3) [EP]||980 3378||&#xD7;
 |-
-|11||<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo>(2) [<partinfo>pSB4K5</partinfo>] (4) [EP]||980 3378||&#x7D;
+|11||ML (2-4) [EP]||980 3378||&#xD7;
 |-
-|12||<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (1) [EP]||960, 4339||&#x25CB;
+|12||MS (1) [EP]||960, 4339||&#x25CB;
 |-
-|13||<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>] (2) [EP]||960, 4339||&#x25CB;
+|13||MS (2) [EP]||960, 4339||&#x25CB;
 |}
-[[Image:KyotoExp100806-1.png]]
+White colonies are not inserted R0011 but its vector. Top10 we used are deleted Lac operon. Then, correctly inserted parts is green because of the lack of ''lac''I gene.
-White colonies are not inserted <partinfo>R0011</partinfo> but its vector. Top10 we used are deleted Lac operon. Then, correctly inserted parts is green because of the lack of ''lac''I gene.
 =====Error PCR (Retry)=====
 {| class="experiments"
-!Name||Water||MgSO4||dNTPs||10xBuffer||Primer VF2||Primer VR||Template S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> failed (50ng/&micro;L)||KOD plus ver.2||Total
+!Name||Water||MgSO4||dNTPs||10xBuffer||Primer VF2||Primer VR||Template S<sub>Sam7,&Delta;TMD1</sub>-E0840 failed (50ng/&micro;L)||KOD plus ver.2||Total
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1)||32||3||5||5||1.5||1.5||1||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (1)||32||3||5||5||1.5||1.5||1||1||50
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2)||32||3||5||5||1.5||1.5||1||1||50
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (2)||32||3||5||5||1.5||1.5||1||1||50
 |}
 {| class="experiments"
-|94&#x2103;||2min
+|94&#x2103;||2min||
 |-
 |98&#x2103;||10s||rowspan="2"|25 cycles
@@ Line 738: / Line 723: @@
 |68&#x2103;||4min
 |-
-|colspan="2"|Add DpnI 2&micro;L
+|colspan="3"|Add DpnI 2&micro;L
 |-
-|Incubate||1h
+|Incubate||1h||
 |-
 |4&#x2103;||forever||
 |}
 =====Transformation=====
 {| class="experiments"
 !Name||Well||Sample||Competent Cell||Total||Plate||Incubation||Colony
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1)||-||4 &micro;L||50||54||rowspan="3"|LB (Kan+)||rowspan="4"|08/06-08/09||&#x25CB;
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (1)||-||4 &micro;L||50||54||rowspan="3"|LB (Kan+)||rowspan="4"|08/06-08/09||&#x25CB;
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2)||-||4||50||54||&#x25CB;
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (2)||-||4||50||54||&#x25CB;
 |-
-|<partinfo>I20260</partinfo>||2-17-F||2||50||52||&#x25CB;
+|I20260||2-17-F||2||50||52||&#x25CB;
 |-
 |||2-I-5||2||50||52||LB (Amp+)||&#x25CB;
@@ Line 763: / Line 749: @@
 !Name||concentration
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>]||116.2 ng/&micro;L
+|MS||116.2 ng/&micro;L
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo> [<partinfo>pSB4K5</partinfo>]||146.6
+|ML||146.6
 |}
 =====Transfotrmation=====
@@ Line 771: / Line 757: @@
 !Sample||Sample||colspan="2"|Competent Cell||Total||Plate||Incuvation||Results
 |-
-|<partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>]||2 &micro;L||KRX||50||52||rowspan="2"|LB (Kan+)||rowspan="2"|08/09 18:00-08/10 12:00||&#x25CB;
+|MS||2 &micro;L||KRX||50||52||rowspan="2"|LB (Kan+)||rowspan="2"|08/09 18:00-08/10 12:00||&#x25CB;
 |-
-|<partinfo>R0011</partinfo>-<partinfo>E0240</partinfo> [<partinfo>pSB4K5</partinfo>]||2||KRX||50||52||&#x25CB;
+|ML||2||KRX||50||52||&#x25CB;
 |}
 =====Restriction Eigestion and Ethanol Precipitation=====
-To use <partinfo>R0011</partinfo> for next ligation, we digested it by EcoRI and PstI
+To use R0011 for next ligation, we digested it by EcoRI and PstI
 {| class="experiments"
-!Name||Sample||10x Buffer||BSA||rowspan="2"|Enzyme 1||Enzyme 2||MilliQ||Total||Incubation
+!Name||Sample||10x Buffer||BSA||colspan="2"|Enzyme 1||colspan="2"|Enzyme 2||MilliQ||Total||Incubation
 |-
-|<partinfo>R0011</partinfo> [EP]||50||6||0.6||EcoRI||0.5||PstI||0.5||2.4||60||At 37&#x2103; 08/09 16:20-18:20
+|R0011 [EP]||50||6||0.6||EcoRI||0.5||PstI||0.5||2.4||60||At 37&#x2103; 08/09 16:20-18:20
 |}
 After restriction enzyme digestion, we did ethanol precipitation.
 =====Ligation and Transformation=====
 {| class="experiments"
-!Name|Sample||colspan="2"|Competent cell||Total||Plate||Incuvation||Colony
+!Name||Sample||colspan="2"|Competent cell||Total||Plate||Incuvation||Colony
 |-
-|<partinfo>R0011</partinfo> [<partinfo>pSB4K5</partinfo>, KRX]||2 &micro;L||KRX||50||52||rowspan="2"|LB (Kan+)||rowspan="2"|08/09 20:00-08/10 09:00||&#x25CB;
+|R0011 [pSB4K5, KRX]||2 &micro;L||KRX||50||52||rowspan="2"|LB (Kan+)||rowspan="2"|08/09 20:00-08/10 09:00||&#x25CB;
 |-
-|<partinfo>R0011</partinfo> [<partinfo>pSB4K5</partrinfo>, C2]||2||C2||50||52||&#x25CB;
+|R0011 [pSB4K5</partrinfo>, C2]||2||C2||50||52||&#x25CB;
 |}
-====Tuesday, August 10 <span class="by">By: Wataru, Tomonori, Ken, Fumitaka</span>
+====Tuesday, August 10 <span class="by">By: Wataru, Tomonori, Ken, Fumitaka</span>====
 =====Culture=====
-Cultured <partinfo>I20260</partinfo> [<partinfo>pSB4K5</partinfo>, <partinfo>R0011</partinfo>-<partinfo>E0240</partinfo> [<partinfo>pSB4K5</partinfo>], <partinfo>R0011</partinfo> [<partinfo>pSB4K5</partinfo>, KRX], and <partinfo>R0011</partinfo> [<partinfo>pSB4K5</partrinfo>, C2].
+Cultured I20260 [pSB4K5, ML, R0011 [pSB4K5, KRX], and R0011 [pSB4K5</partrinfo>, C2].
 =====Minprep=====
 {| class="experiments"
 !Name||Concentration
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1-1)||9.9 ng/&micro;L
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (1-1)||9.9 ng/&micro;L
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1-2)||27.3
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (1-2)||27.3
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2-1)||43.2
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (2-1)||43.2
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2-2)||34.7
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840 (2-2)||34.7
 |}
 =====Culture and Master Plate=====
@@ Line 818: / Line 806: @@
 |rowspan="2"|1||Kanamycin||&#x25CB;||rowspan="14"|At 37&#x2103;, 08/10 20:00-08/11 9:00
 |-
-|Ampicillin||&#x7D;
+|Ampicillin||&#xD7;
 |-
 |rowspan="2"|2||Kanamycin||&#x25CB;
@@ Line 826: / Line 814: @@
 |rowspan="2"|3||Kanamycin||&#x25CB;
 |-
-|Ampicillin||&#x7D;
+|Ampicillin||&#xD7;
 |-
 |rowspan="2"|4||Kanamycin||&#x25CB;
 |-
-|Ampicillin||&#x7D;
+|Ampicillin||&#xD7;
 |-
 |rowspan="2"|5||Kanamycin||&#x25CB;
 |-
-|Ampicillin||&#x7D;
+|Ampicillin||&#xD7;
 |-
 |rowspan="2"|6||Kanamycin||&#x25CB;
@@ Line 842: / Line 830: @@
 |rowspan="2"|7||Kanamycin||&#x25CB;
 |-
-|Ampicillin||&#x7D;
+|Ampicillin||&#xD7;
 |}
 Discussion: About sample 1, 3, 4, 5 and 7, lac promoter was correctly inserted in low copy plasmid. About sample 2 and 6, low copy plasmid and vector derived from lac promoter were ligated. We decided to use sample 1 or 3.
-=====Miniprep of <partinfo>R0011</partinfo> [pSB4K5, C2], SRRz 1', 3'=====
+=====Miniprep of R0011 [pSB4K5, C2], SRRz 1', 3'=====
 {| class="experiments"
 !Name||Concentration
 |-
-|<partinfo>R0011</partinfo> [pSB4K5, C2] (1)||31.2 ng/&micro;L
+|R0011 [pSB4K5, C2] (1)||31.2 ng/&micro;L
 |-
-|<partinfo>R0011</partinfo> [pSB4K5, C2] (3)||29.9
+|R0011 [pSB4K5, C2] (3)||29.9
 |}
-=====Restriction Digestion and electrophoresis of <partinfo>R0011</partinfo> [pSB4K5, C2]=====
+=====Restriction Digestion and electrophoresis of R0011 [pSB4K5, C2]=====
 {| class="experiments"
 !Name||EcoRI||PstI
@@ Line 865: / Line 853: @@
 |N||-||-
 |}
+[[image:KyotoExp100811-1.png|300px|right]]
 {| class="electrophoresis"
 !No.||Name||Length||Results
 |-
-|1||<partinfo>R0011</partinfo> [pSB4K5, C2] (1-1)||||
+|1||R0011 [pSB4K5, C2] (1-1)||||
 |-
-|2||<partinfo>R0011</partinfo> [pSB4K5, C2] (1-2)||||
+|2||R0011 [pSB4K5, C2] (1-2)||||
 |-
-|3||<partinfo>R0011</partinfo> [pSB4K5, C2] (1-3)||||
+|3||R0011 [pSB4K5, C2] (1-3)||||
 |-
-|4||<partinfo>R0011</partinfo> [pSB4K5, C2] (1-N)||||
+|4||R0011 [pSB4K5, C2] (1-N)||||
 |-
-|5||<partinfo>R0011</partinfo> [pSB4K5, C2] (2-1)||||
+|5||R0011 [pSB4K5, C2] (2-1)||||
 |-
-|6||<partinfo>R0011</partinfo> [pSB4K5, C2] (2-2)||||
+|6||R0011 [pSB4K5, C2] (2-2)||||
 |-
-|7||<partinfo>R0011</partinfo> [pSB4K5, C2] (2-3)||||
+|7||R0011 [pSB4K5, C2] (2-3)||||
 |-
-|8||<partinfo>R0011</partinfo> [pSB4K5, C2] (2-N)||||
+|8||R0011 [pSB4K5, C2] (2-N)||||
 |}
-[[image:KyotoExp100811-1.png]]
 Each enzyme correctly cut samples.
 =====Screening PCR of SRRz=====
+[[image:KyotoExp100811-2.png|300px|right]]
+[[image:KyotoExp100811-3.png|300px|right]]
 {| class="electrophoresis"
 !No.||Name||Results
@@ Line 893: / Line 883: @@
 |1||None||
 |-
-|2||Control <partinfo>B0015</partinfo>||
+|2||Control B0015||
 |-
-|3||Control <partinfo>J06702</partinfo>||
+|3||Control J06702||
 |-
-|4||Control <partinfo>B0015</partinfo>||
+|4||Control B0015||
 |-
-|5-24||SRRz-<partinfo>B0015</partinfo>||&#x7D;
+|5-24||SRRz-B0015||&#xD7;
 |}
 Marker: Lambda Marker
-[[image:KyotoExp100811-2.png]]
-[[image:KyotoExp100811-3.png]]
-Discussion: All of the sample were self-ligation of DT. SRRz weren't inserted.
+Discussion: All of the sample were self-ligation of DT. SRRz weren't inserted.
 ====Thursday, August 12 <span class="by">By: Wataru, Ken</span>====
-=====Restriction Digestion and electrophoresis of <partinfo>B0015</partinfo>=====
+=====Restriction Digestion and electrophoresis of B0015=====
 {| class="experiments"
 !Name||Template||10xbuffer||100xbuffer||EcoRI||XbaI 1||XbaI 2||SpeI||PstI 1||PstI 2||Water||Total
@@ Line 927: / Line 915: @@
 |}
 Maker: Lambda, 100bp
-[[image:KyotoExp100812-1.png]]
+[[image:KyotoExp100812-1.png|300px|right]]
 Discussion: Each enzyme correctly cut each sample and was active.
-====Thursday, August 19 <span class="by">By: Wataru, Tomo, Ken</span>
+====Thursday, August 19 <span class="by">By: Wataru, Tomo, Ken</span>====
-=====Miniprep of S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo>=====
+=====Miniprep of S<sub>Sam7,&Delta;TMD1</sub>-E0840=====
 {| class="experiments"
 !Name||Concentration
 |-
-|S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo>||29.6 ng/&micro;L
+|S<sub>Sam7,&Delta;TMD1</sub>-E0840||29.6 ng/&micro;L
 |}
-=====Point mutation PCR of S<sub>Sam7,&Delta;TMD1</sub>-<partinfo>E0840</partinfo>=====
+=====Point mutation PCR of S<sub>Sam7,&Delta;TMD1</sub>-E0840=====
 {| class="experiments"
 !Name||Template||10xbuffer||dNTPs||MgSO4||Primer Fwd.||Primer Rev.||MilliQ||KOD plus ver.2||Total
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1)||1.5||5||5||3||1.5||1.5||31.5||1||50
+|S<sub>&Delta;TMD1</sub>-E0840 (1)||1.5||5||5||3||1.5||1.5||31.5||1||50
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2)||1.5||5||5||3||1.5||1.5||31.5||1||50
+|S<sub>&Delta;TMD1</sub>-E0840 (2)||1.5||5||5||3||1.5||1.5||31.5||1||50
 |-
 |Control||1.5||5||5||3||1.5||1.5||32.5||-||50
@@ Line 961: / Line 950: @@
 =====Restriction Digestion by DpnI from 17:50 to 18:50=====
 =====Electrophoresis=====
-{| class="electrophoresis
+[[Image:KyotoExp100819-1.png|300px|right]]
+{| class="electrophoresis"
 !Name
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1)
+|S<sub>&Delta;TMD1</sub>-E0840 (1)
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2)
+|S<sub>&Delta;TMD1</sub>-E0840 (2)
 |-
 |Control
 |}
 Marker: Lambda, 100bp
-[[Image:KyotoExp100819-1.png]]
 =====Ligation and Transformation=====
 {| class="experiments
 !Name||Colony
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (1)||&#x25CB;
+|S<sub>&Delta;TMD1</sub>-E0840 (1)||&#x25CB;
 |-
-|S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo> (2)||&#x25CB;
+|S<sub>&Delta;TMD1</sub>-E0840 (2)||&#x25CB;
 |-
-|Control||&#x7D;
+|Control||&#xD7;
 |}
 ====Friday, August 20 <span class="by">By: Wataru, Ken</span>====
-=====Making Culture and Master Plate of S<sub>&Delta;TMD1</sub>-<partinfo>E0840</partinfo>=====
+=====Making Culture and Master Plate of S<sub>&Delta;TMD1</sub>-E0840=====
-=====[[Team:Kyoto/Protocols#Miniprep|Miniprep]=====
+=====Miniprep=====
 {| class="expeirments"
 !Name||Concentration
 |-
-|<partinfo>B0015</partinfo>||41.1 ng/&micro;L
+|B0015||41.1 ng/&micro;L
 |}
-=====[[Team:Kyoto/Protocols#Standard PCR|PCR]] of SRRz=====
+=====PCR of SRRz=====
 {| class="experiments"
 !Name||10xBuffer||MgS04||dNTP||Template||colspan="2"|Primer Fwd.||Primer Rev.||MilliQ||KOD plus ver.2||Total
 |-
-|SRRz (1)||5 &micro;L||3||5||5||F1||1.5||1.5||28||1||50
+|SRRz<sub>Sam7</sub> (1)||5 &micro;L||3||5||5||F1||1.5||1.5||28||1||50
 |-
-|SRRz (2)||5||3||5||5||F2||1.5||1.5||28||1||50
+|SRRz<sub>Sam7</sub> (2)||5||3||5||5||F2||1.5||1.5||28||1||50
 |-
-|SRRz (3)||5||3||5||5||F1||1.5||1.5||28||1||50
+|SRRz<sub>Sam7</sub> (3)||5||3||5||5||F1||1.5||1.5||28||1||50
 |-
-|SRRz (4)||5||3||5||5||F2||1.5||1.5||28||1||50
+|SRRz<sub>Sam7</sub> (4)||5||3||5||5||F2||1.5||1.5||28||1||50
 |-
-|SRRz (5)||5||3||5||5||F1||1.5||1.5||28||1||50
+|SRRz<sub>Sam7</sub> (5)||5||3||5||5||F1||1.5||1.5||28||1||50
 |-
-|SRRz (6)||5||3||5||5||F2||1.5||1.5||28||1||50
+|SRRz<sub>Sam7</sub> (6)||5||3||5||5||F2||1.5||1.5||28||1||50
 |}
 {| class="experiments"
@@ Line 1,019: / Line 1,009: @@
 |4&#x2103;||forever||
 |}
-=====[[Team:Kyoto/Protocols#Electrophoresis|Electrophoresis]]=====
+=====Electrophoresis=====
+[[Image:KyotoExp100820-1.png|300px|right]]
 {| class="electrophoresis"
 !Name
 |-
-|SRRz (1)
+|SRRz<sub>Sam7</sub> (1)
 |-
-|SRRz (3)
+|SRRz<sub>Sam7</sub> (3)
 |-
-|SRRz (5)
+|SRRz <sub>Sam7</sub>(5)
 |-
-|SRRz (2)
+|SRRz<sub>Sam7</sub> (2)
 |-
-|SRRz (4)
+|SRRz<sub>Sam7</sub> (4)
 |-
-|SRRz (6)
+|SRRz<sub>Sam7</sub> (6)
 |}
-[[Image:KyotoExp100820-1.png]]
 Discussion: Primer F1 might be better than F2, because the bands of 1, 2 and 3 were clearer. We decided to use sample 1 and 3. Their bands were clearer in the three.
-=====[[Team:Kyoto/Protocols#PCR Purification|PCR Purification]]=====
+=====PCR Purification=====
 {| class="experiments"
 !Name||Concentration
 |-
-|SRRz (1)||134.0 ng/&micro;L
+|SRRz<sub>Sam7</sub> (1)||134.0 ng/&micro;L
 |-
-|SRRz (3)||69.0
+|SRRz<sub>Sam7</sub> (3)||69.0
 |}
-=====[[Team:Kyoto/Protocols#Restriction Digestion|Restriction Digestion]]=====
+=====Restriction Digestion=====
 {| class="experiments"
 !Name||Sample||10xBuffer||100xBuffer||EcoRI||XbaI||SpeI||MilliQ||Total||Incubation
 |-
-|<partinfo>B0015</partinfo> [EX]||50 &micro;L||6||0.6||0.4||0.4||-||2.6||60||rowspan="3"|17:45-18:45
+|B0015 [EX]||50 &micro;L||6||0.6||0.4||0.4||-||2.6||60||rowspan="3"|17:45-18:45
 |-
-|SRRz (1) [EP]||50||6||0.6||0.4||-||0.4||2.6||60
+|SRRz<sub>Sam7</sub> (1) [EP]||50||6||0.6||0.4||-||0.4||2.6||60
 |-
-|SRRz (3) [EP]||50||6||0.6||0.4||-||0.4||2.6||60
+|SRRz<sub>Sam7</sub> (3) [EP]||50||6||0.6||0.4||-||0.4||2.6||60
 |}
 =====Purification=====
@@ Line 1,059: / Line 1,050: @@
 !Name||Concentration
 |-
-|SRRz (1) [EP]||109.0 ng/&micro;L
+|SRRz<sub>Sam7</sub> (1) [EP]||109.0 ng/&micro;L
+|-
+|SRRz<sub>Sam7</sub> (2) [EP]||110.0
+|-
+|B0015||25.5
+|}
+=====Ligation and Transformation=====
+----
+====Monday, August 23 <span class="by">By: Wataru, Tomo, Ken, Fumitaka, Tasuku</span>====
+=====Miniprep=====
+{| class="experiments"
+|Sample number||Concentration
+|-
+|S<sub>&Delta;TMD1</sub>-E0840 (1-1)||58.9 ng/&micro;L
+|-
+|S<sub>&Delta;TMD1</sub>-E0840 (2-2)||49.9
+|}
+=====Sequence=====
+Sample: S<sub>&Delta;TMD1</sub>-E0840 (1-1). S<sub>&Delta;TMD1</sub>-E0840 (2-2), MS
+Discussion: The sequencing was in success and the results were desirable. It meant the point mutation was succeeded and sequence of MS was confirmed. We decided to use S<sub>&Delta;TMD1</sub>-E0840.
+=====Screening PCR of SRRz<sub>Sam7</sub>-B0015=====
+{| class="experiments"
+|90&#x2103;||10min||
+|-
+|94&#x2103;||30s||rowspan="3"|35cycles
+|-
+|50&#x2103;||30s
+|-
+|72&#x2103;||1.5min
+|-
+|72&#x2103;||4min||
+|-
+|4&#x2103;||hold||
+|}
+[[Image:KyotoExp100823-1.png|300px|right]]
+{| class="electrophoresis"
+!No.||Name
+|-
+|1-13||SRRz<sub>Sam7</sub>-B0015
+|-
+|C||Control: B0015
+|-
+|N||None
+|}
+Marker: Lambda, 100bp
+Discussion: We found the band; about 200bp, and it meant the lligation was completed successfully.
+=====Deletion PCR of S<sub>&Delta;TMD1</sub>-E0840 (2-2)=====
+{| class="experiments"
+!Name||Sample||10xBuffer||dNTPs||Primer Fwd.||Primer Rev.||Template||Water||KOD-plus-||Total
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (1)||2 &micro;L||5||5||1.5||1.5||1||35||1||50
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (2)||2||5||5||1.5||1.5||1||35||1||50
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (Control)||2||5||5||1.5||1.5||1||35||-||50
+|}
+{| class="experiments"
+|94&#x2103;||2min||
+|-
+|94&#x2103;||10s||rowspan="3"|35cycles
+|-
+|56&#x2103;||30s
+|-
+|68&#x2103;||3.5min
+|-
+|4&#x2103;||forever||
+|}
+=====Restriction Digestion (DpnI)=====
+{| class="experiments"
+!Sample||DpnI||Total||Incubation
+|-
+|25 &micro;L||1||26||19:00-20:10
+|}
+=====Ligation=====
+{| class="experiments"
+!Name||Sample||Water||Ligation high||T4 Kinase||Total||Incubation
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (1)||3 &micro;L||6||5||1||15||rowspan="3"|20:15-21:15
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (2)||3||6||5||1||15
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (Control)||3||6||5||1||15
+|}
+=====Transformation=====
+====Tuesday, August 24 <span class="by">By: Ken, Tomo, Tasuku, Takuya</span>====
+=====Retry of deletion PCR of S<sub>&Delta;TMD1</sub>-E0840=====
+{| class="experiments"
+!Name||Sample||10xBuffer||dNTPs||MgSO4||Primer1||Primer2||Template||Water||KOD-plus-||Total
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840  (1)||2 &micro;L||5||5||3||1.5||1.5||1||32||1||50
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840  (2)||2||5||5||3||1.5||1.5||1||32||1||50
+|-
+|Control||2||5||5||3||1.5||1.5||1||32||1||50
+|}
+{| class="experiments"
+|94&#x2103;||2min||
+|-
+|94&#x2103;||10s||rowspan="3"|35cycles
+|-
+|58&#x2103;||30s
+|-
+|68&#x2103;||3.5min
+|-
+|4&#x2103;||hold||
+|}
+=====Restriction Digestion (DpnI)=====
+:15-15:15
+=====Electrophoreis=====
+[[Image:KyotoExp100824-1.png|300px|right]]
+{| class="electrophoresis"
+!Lane||Name
+|-
+|1||rrS<sub>&Delta;TMD1</sub>-E0840 (1)
+|-
+|2||rrS<sub>&Delta;TMD1</sub>-E0840 (3)
+|-
+|C||rrS<sub>&Delta;TMD1</sub>-E0840 (Control)
+|}
+Marker: 100bp, Lambda.
+We found the band of sample 1 and 2 about 3000bp and there wasn't the band of sample control. So, we confirmed the PCR and Restriction Digestion were completed successfully.
+=====Ligation=====
+=====Point mutation of SRRz=====
+{| class="experiments"
+!Name||10x||dNTPs||MgSO4||Primer1||Primer2||Template||Water||KOD-plus-||total
+|-
+|SRRz<sub>Sam7</sub>-B0015 (1)||5||5||3||1.5||1.5||1||32||1||50
+|-
+|SRRz<sub>Sam7</sub>-B0015 (2)||5||5||3||1.5||1.5||1||32||1||50
+|-
+|SRRz<sub>Sam7</sub>-B0015 (Control)||5||5||3||1.5||1.5||1||32||1||50
+|}
+{| class="experiments"
+|94&#x2103;||2min||
+|-
+|98&#x2103;||10s||rowspan="3"|30cycles
+|-
+|55&#x2103;||30s
+|-
+|68&#x2103;||4min
+|-
+|4&#x2103;||hold||
+|}
+=====Restriction Digestion (DpnI), Electrophoresis and Ligation=====
+[[Image:KyotoExp100824-2.png|300px|right]]
+We could find point mutation PCR and restriction enzyme of DpnI was done.
+=====PCR of E0240=====
+{| class="experiments"
+!Sample||10xBuffer||dNTPs||MgSO4||VF2||VR||Template||Water||KOD-plus-||Total
+|-
+|E0240 (1)||5||5||3||1.5||1.5||1||31.5||1||50
+|-
+|E0240 (2)||5||5||3||1.5||1.5||1||31.5||1||50
+|-
+|}
+=====PCR Purification=====
+{| class="experiments"
+!Name||Concentration
+|-
+|E0240 (1)||5.5 x 50 ng/&micro;L
+|-
+|E0240 (2)||5.2 x 50
+|}
+=====Restriction Digestion (EcoRI, PstI) and Gel Extraction=====
+{| class="experiments"
+!Name||Concentration
+|-
+|E0240 (1)|| 28.8 ng/&micro;L
+|-
+|E0240 (2)|| 26.4
+|}
+=====Transformation=====
+====Wednesday, August 25 <span class="by">By:Ken, Tomo, Kazuya, Tasuku, Takuya</span>====
+=====Making culture and Master plate=====
+{| class="experiments"
+!Name||Colony
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (1)||&#x25CB;
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (2)||&#x25CB;
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (Control)||&#xD7;
+|-
+|SRRz<sub>Sam7</sub>-B0015 (1)||&#x25CB;
+|-
+|SRRz<sub>Sam7</sub>-B0015 (2)||&#x25CB;
+|-
+|SRRz<sub>Sam7</sub>-B0015 (Control)||&#xD7;
+|}
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|pSB4K5||29.0 ng/&micro;L
+|}
+=====Restriction Digestion=====
+{| class="experiments"
+!Sample name||Template||10xbuffer||100xbuffer||EcoRI||SpeI||PstI||Water||Total
+|-
+|pSB4K5||50||6||0.6||0.4||0.4||-||2.6||60
+|-
+|R0011 [pSB4K5]||10||4||0.4||-||0.3||0.3||25||40
+|}
+=====Purification=====
+{| class="experiments"
+|Sample Name||Concentration
+|-
+|pSB4K5||18.4 ng/&micro;L
+|-
+|R0011 [pSB4K5]||8.6
+|}
+=====Ligation of E0240 and pSB4K5, Transformation=====
+====Thursday, August 26 <span class="by">By:Ken, Tomo, Kazuya, Tasuku, Takuya, Fumitaka</span>====
+=====Miniprep=====
+{| class="experiments"
+|Sample name||Concentration
+|-
+|J23116 (RPU0.7)||44.5 ng/&micro;L
+|}
+=====Restriction Digestion=====
+{| class="experiments"
+!Name||Template||10xbuffer||100xbuffer||SpeI||PstI||Water||Total
+|-
+|J23116 (RPU0.7)||25||4||0.4||0.3||0.3||10||40
+|}
+=====Purification of=====
+{| class="experiments"
+!Name||Concentration
+|-
+|J23116 (RPU0.7)||49.8 ng/&micro;L
+|}
+====Friday, August 27 <span class="by">By: Ken, Tomo, Kazuya, Fumitaka</span>====
+=====Making master plate of E0240 [pSB4K5]=====
+{| class="experiments"
+|Sample Name||Concentration
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (1-2)||20.9 ng/&micro;L
+|-
+|SRRz-B0015 (1-1)||16.4
+|}
+=====Restriction Digestion=====
+{| class="experiments"
+!Name||Template||10xbuffer||100xbuffer||XbaI||PstI||Water||Total||Incubation
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (1-2)||45 &micro;L||6||0.6||0.3||0.3||7.8||60||rowspan="2"|13:20-14:20
+|-
+|SRRz-B0015 (1-1)||45||6||0.6||0.3||0.3||7.8||60
+|}
+=====Purification=====
+{|Sample Name||Concentration
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (1-2)||44.7 ng/&micro;L
+|-
+|SRRz-B0015 (1-1)||56.1
+|}
+=====Ligation and Transformation=====
+{| class="experiments"
+!Name
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840 (1-2)
+|-
+|J23116 (RPU0.7)- rrS<sub>&Delta;TMD1</sub>-E0840 (1-2)
+|-
+|R0011-SRRz-B0015 (1-1) [pSB4K5]
+|}
+====Monday, August 30 <span class="by">By: Tomonori, Kazuya, Tasuku, Ken</span>====
+=====Making culture and Master plate=====
+{| class="experiments"
+!Name||Colony
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840||Many colonies
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840 (Control)||Some colonies
+|-
+|J23116 (RPU0.7)- rrS<sub>&Delta;TMD1</sub>-E0840||Many colonies
+|-
+|J23116 (RPU0.7)- rrS<sub>&Delta;TMD1</sub>-E0840 (Control)||Many colonies
+|-
+|R0011-SRRz-B0015 (1-1) [pSB4K5]||No colony
+|-
+|R0011-SRRz-B0015 (1-1) [pSB4K5] (Control)||No colony
+|}
+Discussion: There ware some colonies, which emitted green light, on the plate 1.  So, we cultured those colonies on master plate.
+On the plate 5 and 6, even though we used KRX, which is able to repress lac promoter, colonies might be dead. However, we still have to do some experience so that we confirm lac promoter cannot repress enough and E. coli cannot survive.
+====Tuesday, August 31 <span class="by">By: Tomonori, Takuya Y., Kazuya, Tasuku, Takuya, Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|J23105 (RPU0.3)||48.5 ng/&micro;L
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840||107.3
+|}
+=====Restriction Digestion=====
+=====Gel Extraction of R0011-rrS<sub>&Delta;TMD1</sub>-E0840 (Electrophoresis for 45min)=====
+<!--[[image:KyotoExp100831-1.png|300px|right]]-->
+Discussion: There were two band at the bottom of the gel.  It was too long -45min-, and insert and vector might be contaminated.  But we went on next operation.
+=====Purification of J23105 (RPU0.3) and R0011-rrS<sub>&Delta;TMD1</sub>-E0840=====
+{| class="experiments"
+!Name||Concentration
+|-
+|J23105 (RPU0.3)||5.8 ng/&micro;L
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840||7.8
+|}
+=====Ligation and Transformation=====
+{| class="experiments"
+|Insert||Vector
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840||J23105 (RPU0.3)
+|}
+====Wednesday, September 1 <span class="by">By: Tomonori, Kazuya, Tasuku, Fumitaka, Ken</span>====
+=====Making culture and Master plate=====
+{| class="experiments"
+!Name||Colony
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840-J23105 (RPU0.3)||Many colonies
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840-J23105 (RPU0.3) (Control)||Many colonies
+|}
+=====Screenig PCR of R0011-rrS<sub>&Delta;TMD1</sub>-E0840-J23105 (RPU0.3)=====
+* Sample: 1-13
+* Control: Positive (B0015)
+* Maker: lambda, 100
+<!--M, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, P, M
+[[image:KyotoExp100901-1.png|300px|right]]-->
+Discussion: All of the sample except sample 10 might be self-ligation products of J23105 (RPU0.3).
+=====Miniprep=====
+{| class="experiments"
+|SRRz-B0015 (1-1)||33.8 ng/&micro;L
+|-
+|pSB4K5||56.0
+|}
+=====Restriction Digestion of SRRz and pSB4K5=====
+{| class="experiments"
+!Name||Template||10xbuffer||100xbuffer||EcoRI||PstI||Water||Total||Incubation
+|-
+|SRRz-B0015 (1-1)||20 &micro;L||4||0.4||0.3||0.3||15||40||rowspan="2"|13:25-14:30
+|-
+|pSB4K5||20||4||0.4||0.3||0.3||15||40
+|}
+=====Purification=====
+{| class="experiments"
+|SRRz-B0015 (1-1)||6.5 ng/&micro;L
+|-
+|pSB4K5||16.8
+|}
+=====Ligation and transformation=====
+* Insert: SRRz-B0015 (1-1)
+* Vector: pSB4K5
+====Thursday, September 2 <span class="by">By: Tomonori, Tomo, Takuya, Ken</span>====
+=====Making culture and Master plate=====
+{| class="experiments"
+|SRRz-B0015 (1-1) [pSB4K5]||13 colonies
+|-
+|SRRz-B0015 (1-1) [pSB4K5] (Control)||13 colonies
+|}
+=====Screening PCR of rSRRz low=====
+Sample: (1-13) SRRz-B0015 (1-1) [pSB4K5]
+Maker: Lambda, 100
+Control: Positive (B0015), Neganive
+<!--M, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, P, N, M
+[[image:KyotoExp100902-1.png|300px|right]]-->
+Discussion: From sample 1, two vectors might be ligated.  Sample 3 and 4, SRRz-B0015 might be inserted in low copy plasmid correctly.  Sample 11, it might be the self-ligation product of low copy plasmid.  Anyway, we decided to culture those 4 colonies on master plate.
+====Friday, September 3 <span class="by">By: Tomonori, Tomo, Kazuya, Tasuku, Fumitaka, Ken</span>====
+=====Making culture=====
+*R0011-rrS<sub>&Delta;TMD1</sub>-E0840 (1)
+*R0011-rrS<sub>&Delta;TMD1</sub>-E0840 (3)
+*rrS<sub>&Delta;TMD1</sub>-E0840 (1-1)
+*rrS<sub>&Delta;TMD1</sub>-E0840 (1-2)
+*SRRz-B0015 (1-1) [pSB4K5]
+*SRRz-B0015 (1-2) [pSB4K5]
+*ML
+====Monday, September 6 <span class="by">By: Wataru, Tomo, Kazuya, Ken</span>====
+=====Sequence Analysis=====
+* R0011-rrS<sub>&Delta;TMD1</sub>-E0840 (A)
+* R0011-rrS<sub>&Delta;TMD1</sub>-E0840 (B)
+* SRRz-B0015 [pSB4K5] (A)
+* SRRz-B0015 [pSB4K5] (B)
+* rrS<sub>&Delta;TMD1</sub>-E0840 (1-1)
+* rrS<sub>&Delta;TMD1</sub>-E0840 (1-2)
+R0011-rrS<sub>&Delta;TMD1</sub>-E0840 (A), SRRz-B0015 [pSB4K5] (A) is correct.
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|SRRz||29.6 ng/&micro;L
+|-
+|R0011-rrS<sub>&Delta;TMD1</sub>-E0840||70.2
+|-
+|J23105 (RPU0.3)||75.3
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840 (1-1)||30.3
+|}
+=====Restriction Digestion=====
+* J23105 (RPU0.3): SpeI, PstI
+* rrS<sub>&Delta;TMD1</sub>-E0840: XbaI, PstI
+=====Gel Extraction=====
+{| class="experiments"
+!Name||Concentration
+|-
+|J23105 (RPU0.3) [SP]||20ng / 10&micro;L
+|-
+|rrS<sub>&Delta;TMD1</sub>-E0840||100ng / 1&micro;L
+|}
+=====Ligation=====
+{| class="experiments"
+!colspan="2"| Vector ||conspan="2"| Insert || Ligation High || Total || Incubation
+|-
+|J23105 (RPU0.3) [SP]||1 &micro;L||rrS<sub>&Delta;TMD1</sub>-E0840 [XP]||1||2||4||30min
+|-
+|}
+=====Transformation=====
+{| class="experiments"
+!Name||Competent Cell||Product of Ligation
+|-
+|J23105 (RPU0.3)-rrS<sub>&Delta;TMD1</sub>-E0840||50 &micro;L||4||
+|-
+|}
+====Tuesday, September 7 <span class="by">By: Wataru, Ken</span>====
+=====Insert Check=====
+[[Image:KyotoExp100907-1.png|300px|right]]
+We did colony PCR, and three colonies were inserted rrS<sub>&Delta;TMD1</sub>-E0840. So we succeeded in making J23105 (RPU0.3)-rrS<sub>&Delta;TMD1</sub>-E0840.
+====Thirsday, September 9 <span class="by">By: Wataru, Ken</span>====
+=====Culture=====
+Culture pSB4K5 and SRRz<sub>Sam7</sub>
+====Friday, September 10 <span class="by">By: Wataru, Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|pSB4K5||48.8
+|-
+|SRRz<sub>Sam7</sub>||33.4
+|}
+=====Mutagenesis=====
+We lost SRRz-B0015, so we decided to retry point mutation.
+{| class="experiments"
+!Name||MgS04||dNTP||10xBuffer||Template||KOD||MilliQ||Total
+|-
+|SRRz (1)||3||5||5||1.5||1||34||50
+|-
+|SRRz (2)||3||5||5||1.5||1||34||50
+|-
+|Control||3||5||5||1.5||1||34||50
+|}
+{| class="experiments"
+|94&#x2103;||1min||
+|-
+|94&#x2103;||5s||rowspan="3"|25 cycles
+|-
+|55&#x2103;||30s
+|-
+|68&#x2103;||3min 40s
+|-
+|4&#x2103;||Forever||
+|}
+After digestion by DpnI, Ligation and Transformation.
+====Sunday, September 12 <span class="by">By: Wataru</span>====
+=====Culture=====
+Culture SRRz (1), (2), (3) from original plate.
+====Monday, September 13 <span class="by">By: Wataru, Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|SRRz (1)||61.3 ng/&micro;L
+|-
+|SRRz (2)||59.3
+|-
+|SRRz (3)||69.3
+|}
+=====Sequence Analysis=====
+* SRRz (1), (2), (3)
+SRRz (1), (2), (3) are correct.
+=====Restriction Digestion=====
+* J23105 (RPU0.3)-rrS<sub>&Delta;TMD1</sub>-E0840: EcoRI, SpeI
+* R0011: EcoRI, XbaI
+=====Ligation=====
+J23105 (RPU0.3)-rrS<sub>&Delta;TMD1</sub>-E0840 [ES] + R0011 [EX]
+=====Transformation=====
+====Tuesday, September 14 <span class="by">By: Ken, Wataru</span>====
+=====Colony PCR=====
+We did Colony PCR, and we succeeded in making J23105 (RPU0.3)-rrS<sub>&Delta;TMD1</sub>-E0840-R0011
+=====Sequence Analysis=====
+From the product of Colony PCR.
+* J23105 (RPU0.3)-rrS<sub>&Delta;TMD1</sub>-E0840-R0011
+J23105 (RPU0.3)-rrS<sub>&Delta;TMD1</sub>-E0840-R0011 is correct.
+====Tuesday, September 30 <span class="by">By: Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|LTC (1)||84.6 ng/&micro;L
+|-
+|LTC (2)||97.6
+|-
+|LTC (3)||127.4
+|-
+|LTC (4)||85.4
+|-
+|LTC (5)||70.0
+|}
+====Friday, October 1 <span class="by">By: Ken</span>====
+=====Sequence Analysis=====
+Analyzed LTC 1-5. The sequencing on each sample was in success.  The results of sequencing with VF2 were desirable, but, on the other, only one of those with VR was desirable, the others were found bad sequencing.  We decided to use LTC 2.
+====Saturday, October 2 <span class="by">By: Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|SRRz-low||162.3 ng/&micro;L
+|-
+|CTL||60.8 ng/&micro;L
+|}
+=====Restriction Digestion=====
+*LTC (EcoRI-SpeI)
+*CTL (EcoRI-SpeI)
+*SRRz low (EcoRI-XbaI)
+====Sunday, October 3 <span class="by">By: Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|SRRz-low||237.3 ng/&micro;L
+|-
+|CTL||138.8
+|-
+|LTC||441.2
+|-
+|CT||252.1
+|}
+=====Restriction Digestion=====
+{| class="experiments"
+!Name||Template||10xbuffer||100xbuffer||EcoRI||XbaI||SpeI||CIAP||Water||Total
+|-
+|SRRz-low||7||4||0.4||0.3||0.3||-||1||27||40
+|-
+|CTL||10||4||0.4||0.3||-||0.3||-||25||40
+|-
+|LTC||4||4||0.4||0.3||-||0.3||-||31||40
+|}
+=====Concentration(after purification)=====
+{| class="experiments"
+!Name||Concentration
+|-
+|SRRz-low(E-X)||36.9 ng/&micro;L
+|-
+|CTL(E-S)||25.0
+|-
+|LTC(E-S)||64.3
+|}
+=====Ligation and Transformation=====
+Ligation and transformation of CTL-SRRz(CTLS) and LTC-SRRz(LTCS).
+{| class="experiments"
+!Name||Colony
+|-
+|CTLS||Some colonies
+|-
+|LTCS||Some colonies
+|}
+====Monday, October 4 <span class="by">By: Ken</span>====
+=====Making culture=====
+Cultured CTLS and LTCS with LB-Kan(+/- IPTG).
+====Tuesday, October 5 <span class="by">By: Ken</span>====
+=====Results of Screening=====
+The propagation wasn't observed on some samples on CTLS cultured with M9-Kan +IPTG. It meant that the construction of CTLS was in success.
+However, the growth was observed on all of samples of LTCS. So, we decided to retry the construction of LTCS.
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|LT||387.1 ng/&micro;L
+|}
+=====Making culture=====
+Cultured CTLS.
+====Wednesday, October 6 <span class="by">By: Ken</span>====
+===== =====
+====Thursday, October 7 <span class="by">By: Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|S<sub>&Delta;TMD1</sub>||84.1 ng/&micro;L
+|-
+|lac-SRRz||172.5
+|}
+=====Restriction Digestion=====
+{| class="experiments"
+!Name||Template||10xbuffer||100xbuffer||EcoRI||PstI||Water||Total
+|-
+|LT||4||4||0.4||0.4||0.4||30.8||40
+|-
+|CT||6||4||0.4||0.4||0.4||28.8||40
+|-
+|CTL||11||4||0.4||0.4||0.4||23.8||40
+|-
+|LTC||4||4||0.4||0.4||0.4||30.8||40
+|-
+|SRRz||7||4||0.4||0.4||0.4||27.8||40
+|-
+|S<sub>&Delta;TMD1</sub>||17||4||0.4||0.4||0.4||17.8||40
+|}
+=====Concentration after purification=====
+{| class="experiments"
+!Name||Concentration
+|-
+|LT||107.9 ng/&micro;L
+|-
+|CT||56.9
+|-
+|CTL||37.1
+|-
+|LTC||101.9
+|-
+|SRRz||55.7
+|-
+|S<sub>&Delta;TMD1</sub>||102.9
+|}
+====Friday, October 8 <span class="by">By: Ken</span>====
+=====Screening=====
+Screened lac-SRRz 1-7(LB-Tc with IPTG 1.5mM). Except for sample 4, the propagation could be observed.  So, we decided to use sample 4.
+=====Restriction Digestion of pSB1C3=====
+{| class="experiments"
+!Template||10xbuffer||100xbuffer||EcoRI||PstI||Water||Total
+|-
+|5||4||0.4||0.4||0.4||28.4
+|}
+=====Concentration after purification=====
+{| class="experiments"
+!Name||Concentration
+|-
+|pSB1C3(E-P)||16.1 ng/&micro;L
+|}
+=====Ligation and Transformation=====
+Inserted LTC, CTL, T, SRRz, LT or CT to pSB1C3.
+{| class="experiments"
+!Name||Colony
+|-
+|LTC||Some colonies
+|-
+|CTL||No colony
+|-
+|T||Some colonies
+|-
+|SRRz||Some colonies
+|-
+|LT||Some colonies
+|-
+|CT||Some colonies
+|}
+====Saturday, October 9 <span class="by">By: Ken</span>====
+=====Making culture=====
+Cultured LTC, T, SRRz, LT, and CT with LB (Cp/Amp+).
+=====Restriction digestion of LTC and SRRz-low=====
+{| class="experiments"
+!Name||Template||10xbuffer||100xbuffer||EcoRI||SpeI||Water||Total
+|-
+|LTC||3.5||4||0.4||0.6||0.6||30.9||40
+|-
+|SRRz-low||4||4||0.4||0.6||0.6||30.4||40
+|}
+=====Ligation and Transformation of LTCS=====
+{| class="experiments"
+!Name||Colony
+|-
+|LTCS||Many colonies
+|-
+|control||few colonies
+|}
+Used Top 10.
+====Sunday, October 10 <span class="by">By: Ken</span>====
+=====Screening=====
+Screened LTC, T, SRRz, LT, and CT. Except for LT1, the propagation could not be observed on each sample with LB (Amp+).
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|LTC1||210.6 ng/&micro;L
+|-
+|T2||193.2
+|-
+|SRRz3||208.9
+|-
+|LT2||195.7
+|-
+|CT1||219.9
+|-
+|CTLS4-2||231.0
+|-
+|LTCS1||50.6
+|}
+=====Restriction Digestion of LTC, T, SRRz, LT, CT, and CTLS=====
+{| class="experiments"
+!Template||10xBuffer||100xBuffer||EcoRI||PstI||MilliQ||Incubation
+|-
+|2 &micro;L||1||0.1||0.2||0.2||6.5||60min
+|}
+=====Electrophoreis=====
+[[Image:KyotoExp101010-1.png|300px|right]]
+* Lane 1, 8: Lambda, 100bp Marker
+* Lane 2-7: LTC, T, SRRz, LT, CT, CTLS
+We could observe that the each part was correctly inserted to the pSB1C3.
+=====Retry - Transformation of CTL (pSB1C3) and LTCS=====
+Used KRX.
+=====Deletion PCR of T2=====
+{| class="experiments"
+!Name||Template||2xBuffer||dNTPs||MgSO4||Primer1||Primer2||Primer3||KOD-FX||MilliQ||Total
+|-
+|GFP-Deletion1, 2||0.25 &micro;L||25||10||3||1.5||-||1.5||1||8.75||50
+|-
+|GFP-DT-Deletion1, 2||0.25 &micro;L||25||10||3||-||1.5||1.5||1||8.75||50
+|}
+{| class="experiments"
+|94&#x2103;||2min||
+|-
+|98&#x2103;||10s||rowspan="3"|30 cycles
+|-
+|59&#x2103;||30s
+|-
+|68&#x2103;||3.5min
+|-
+|4&#x2103;||Hold||
+|}
+Primer:
+# ccaggcatcaaataaaacgaaaggctc
+# tactagtagcggccgctgc
+# ctctagtattattgatttctaccatcttctactcc
+====Monday, October 11 <span class="by">By: Ken</span>====
+=====Restriction Digestion, Electrophoresis, Ligation and Transformation of PCR products=====
+{| class="experiments"
+!Template||DpnI||Incubation
+|-
+|25 &micro;L||1||60min
+|}
+[[Image:KyotoExp101011-1.png|300px|right]]
+{| class="electrophoresis"
+!Lane||Name
+|-
+|1,6||Lambda, 100bp Marker
+|-
+|2||GFP-Deletion1
+|-
+|3||GFP-Deletion2
+|-
+|4||GFP-DT-Deletion1
+|-
+|5||GFP-DT-Deletion2
+|}
+Deletion PCR was well performed.
+{| class="experiments"
+!Template||Ligation High||T4 Kinase||Incubation
+|-
+|9 &micro;L||5||1||90min
+|}
+{| class="experiments"
+!Name||Colony
+|-
+|S<sub>&Delta;TMD1</sub>-dT||Many colonies
+|-
+|S<sub>&Delta;TMD1</sub>||Many colonies
+|}
+*Competent Cell: TOP10
+=====Sequence=====
+Sequenced LTC1, T2, SRRz3, LT2, CT1, CTLS4-2 and LTCS1.
+{| class="experiments"
+!Template||5xBuffer||Primer||Big Dye||MilliQ||Total
+|-
+|(200ng)||2 &micro;L||1||0.5||6.5||10
+|}
+Primer:
+# VF2
+# VR
+# aggtgatgcaacatacggaaaacttacc
+# tgctgggattacacatggcatggatg
+# ttcctcgatatgctggcgtggtc
+Used Primer 1 or 2 to each sample, and Primer 3, 4, or 5 only to CTLS4-2 and LTCS1.
+{| class="experiments"
+|96&#x2103;||1min||
+|-
+|96&#x2103;||10s||rowspan="3"|40 cycles
+|-
+|50&#x2103;||5s
+|-
+|60&#x2103;||2min 5s
+|-
+|4&#x2103;||Hold||
+|}
+Except for CTLS4-2 and LTCS1 with Primer2, the sequencing of each sample were well performed. And LCT1, T2, LT2, and CT1 were confirmed that the sequence were correct. There was, however, deletion of some base pairs on lactose promoter [R0011]. of CTLS402.
+* Result: AATTGTGAGCGGATAACAAGATACTGAGCACA
+* BBa_R0011: AATTGTGAGCGGATAACAATTGACATTGTGAGCGGATAACAAGATACTGAGCACA
+There is repeated sequence on lactose promoter and the one was deleted. So, we supposed that the homologous recombination was occureed. From this result, we could say that the function check of CTLS was failed because SRRz gene wasn't induced by IPTG.
+=====Making culture of LTCS and CTL=====
+====Tuesday, October 12 <span class="by">By: Ken</span>====
+=====Screening of CTL=====
+The propagation could not be observed with LB-Amp and could be observed with LB-Cp. It meant that the part, CTL, was correctly inserted to the plasmid, pSB1C3.
+=====Making culture=====
+Cultured two samples on each part: S<sub>&Delta;TMD1</sub>-dT and S<sub>&Delta;TMD1</sub>. Named T1,3,4 and 6.
+====Wednesday, October 13 <span class="by">By: Ken</span>====
+===== =====
+====Thursday, October 14 <span class="by">By: Ken</span>====
+=====Retry of the construction of CTLS=====
+====Friday, October 15 <span class="by">By: Ken</span>====
+=====Screening of CTLS=====
+Cultured CTLS with M9+IPTG. And the propagation couldn't be observed on one sample.
+We decided to use this sample.
+=====Sequence Analysis=====
+We did the sequencing on ML, MS, CTLS, T4 and CTL. The sequencing of T4 and CTL were in success and the others were failed. The results of CTL was desirable, but that of T4 was bad sequence and there was a mutation on PstI site. Including the last time sequencing, we could say that the deletion of GFP-terminator from S<sub>&Delta;TMD1</sub>-GFP was failed. So, we decided to retry the deletion PCR.
+====Sunday, October 17 <span class="by">By: Ken</span>====
+=====Retry of deletion PCR of T2=====
+We used PCR to delete GFP and terminator[E0840] from S<sub>&Delta;TMD1</sub>-E0840.
+{| class="experiments"
+!Name||Template||2xBuffer||dNTPs||Primer(fwd)||Primer(rev)||KOD-FX||MilliQ||Total
+|-
+|GFP-DT-Deletion1, 2||0.25 &micro;L||25||10||1.5||1.5||1||10.75||50
+|}
+{| class="experiments"
+|94&#x2103;||2min||
+|-
+|98&#x2103;||10s||rowspan="2"|30 cycles
+|-
+|68&#x2103;||3.5min
+|-
+|4&#x2103;||Hold||
+|}
+After the PCR, digestion by DpnI(37C/60min).
+=====Electrophoresis=====
+[[Image:KyotoExp101017-1.png|300px|right]]
+*Lane 1,2,5,6: Lambda, 100bp Maker
+*Lane 3,4 PCR products[T'1,T'2]
+PCR was in success.
+=====Ligation=====
+Ligation PCR products.
+====Monday, October 18 <span class="by">By: Ken</span>====
+=====Transformation=====
+Transformed T'1 and T'2.
+{| class="experiments"
+!Name||Colony
+|-
+|T'1||Some colonies
+|-
+|T'2||Some colonies
+|}
+====Thursday, October 21 <span class="by">By: Ken</span>====
+=====Making Culture=====
+Cultured two samples on each plate, T'1 and T'2. Named dele1-4. And also cultured lac-SRRz.
+====Friday, Ocotber 22 <span class="by">By: Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|dele1||117.9 ng/&micro;L
+|-
+|dele2||130.8
+|-
+|dele3||108.7
+|-
+|dele4||176.0
+|-
+|lac-SRRz||67.2
+|}
+====Saturday, October 23 <span class="by">By: Ken</span>====
+=====Sequence Analysis=====
+We used VF2 on dele1-4 and lac-SRRz and VR on lac-SRRz.
+The sequencing of lac-SRRz with VR was failed, the others were in success.
+The results were desirable on dele1,3,4 and lac-SRRz.
+=====Deletion PCR of lac-SRRz=====
+We used deletion PCR to get lac-S<sub>&Delta;TMD1</sub>RRz.
+{| class="experiments"
+!Name||Template||2xBuffer||dNTPs||Primer1||Primer2||KOD||MilliQ||Total
+|-
+|lac-S<sub>&Delta;TMD1</sub>RRz (1)||0.8||25||10||1.5||1.5||1||10.2||50
+|-
+|lac-S<sub>&Delta;TMD1</sub>RRz (2)||0.8||25||10||1.5||1.5||1||10.2||50
+|-
+|control||0.8||25||10||1.5||1.5||0||11.2||50
+|}
+{| class="experiments"
+|94&#x2103;||2min||
+|-
+|98&#x2103;||10s||rowspan="2"|30 cycles
+|-
+|68&#x2103;||5min
+|-
+|4&#x2103;||Hold||
+|}
+After the PCR, done restriction digestion by DpnI(37&#x2103;/60min).
+=====Electrophoresis=====
+[[Image:KyotoExp101023-1.png|300px|right]]
+*Lane 1,8,2,7: Lambda, 100bp Maker
+*Lane3,4: lac-S<sub>&Delta;TMD1</sub>RRz (1,2)
+*Lane5: control
+=====Ligation and Transformation=====
+{| class="experiments"
+!Name||Colony
+|-
+|lac-S<sub>&Delta;TMD1</sub>RRz(1)||some colonies
+|-
+|lac-S<sub>&Delta;TMD1</sub>RRz(2)||some colonies
+|-
+|control||no colony
+|}
+Used KRX.
+====Sunday, October 24 <span class="by">By: Ken</span>====
+=====Making Culture=====
+Cultured CTLS, Lysisbox and three samples of lac-S<sub>&Delta;TMD1</sub>RRz with LB-Tc(IPTG 0 or 1mM).
+====Monday, October 25 <span class="by">By: Ken</span>====
+=====Miniprep=====
+{| class="experiments"
+!Name||Concentration
+|-
+|CTLS||62.9 ng/&micro;L
+|-
+|Lysisbox||31.9
+|-
+|lac-S<sub>&Delta;TMD1</sub>RRz 1||140.9
+|-
+|lac-S<sub>&Delta;TMD1</sub>RRz 2||71.6
+|}
+The propagation was not observed on lac-S<sub>&Delta;TMD1</sub>RRz 3 with LB (IPTG 1mM).
+It meant this sample might be lac-SRRz. We decided not to use this.
+=====PCR=====
+We used PCR on CTLS and Lysisbox to change its own constitutive promoter to another.
+{| class="experiments"
+!Name||Template||2xBuffer||dNTPs||Primer1||Primer2||Primer3||Primer4||KOD-FX||MilliQ||Total
+|-
+|C'TLS(1)||0.8 &micro;L||25||10||1.5||1.5||-||-||1||10.2||50
+|-
+|C'TLS(2)||0.8 &micro;L||25||10||1.5||1.5||-||-||1||10.2||50
+|-
+|Lysisbox'(1)||1.5 &micro;L||25||10||-||-||1.5||1.5||1||9.5||50
+|-
+|Lysisbox'(2)||1.5 &micro;L||25||10||-||-||1.5||1.5||1||9.5||50
+|}
+{| class="experiments"
+|94&#x2103;||2min||
+|-
+|98&#x2103;||10s||rowspan="2"|30 cycles
+|-
+|68&#x2103;||6min 20s
+|-
+|4&#x2103;||Hold||
+|}
+Primer
+# aggtacagtgctagctactagaggagc
+# aggactgagctagccgtcaactc
+# aggtattatgctagctactagaggagc
+# aggactgagctagctgtaaactctag
+=====Electrophoresis=====
+[[Image:KyotoExp101025-1.png|300px|right]]
+*Lane 1,8,2,7: Lambda, 100bp Maker
+*Lane 3,4: C'TLS(1,2)
+*Lane 5,6: Lysisbox'(1,2)
+Two bands were observed on lane 5 and 6. We decided to do gel extraction.
+=====Ligation=====
+We did ligation of C'TLS(1,2).
+====Tuesday, October 26 <span class="by">By: Ken</span>====
+=====Gel Extraction of Lysisbox'=====
+{| class="experiments"
+!Name||Concentration
 |-
-|SRRz (2) [EP]||110.0
+|Lysisbox'(1)||33.6 ng/&micro;L
 |-
-|<partinfo>B0015</partinfo>||25.5
+|Lysisbox'(2)||43.4 ng/&micro;L
 |}
-=====[[Team:Kyoto/Protocols#Ligation|Ligation]] and [[Team:Kyoto/Protocols#Transformation]]=====
+=====Ligation=====
+We did ligation of Lysisbox'(1,2).
+=====Transformaiton=====
+Transformed C'TLS(1,2) and Lysisbox'(1,2).
 ----

Name	Template	10xbuffer	100xbuffer	EcoRI	XbaI 1	XbaI 2	SpeI	PstI 1	PstI 2	Water	Total
1	3	1	0.1	0.2	-	-	-	-	-	5.7	10
2	3	1	0.1	-	0.2	-	-	-	-	5.7	10
3	3	1	0.1	-	-	0.2	-	-	-	5.7	10
4	3	1	0.1	-	-	-	0.2	-	-	5.7	10
5	3	1	0.1	-	-	-	-	0.2	-	5.7	10
6	3	1	0.1	-	-	-	-	-	0.2	5.7	10
N	3	1	0.1	-	-	-	-	-	-	5.9	10

Name	Template	10xbuffer	100xbuffer	EcoRI	XbaI 1	XbaI 2	SpeI	PstI 1	PstI 2	Water	Total
1	3	1	0.1	0.2	-	-	-	-	-	5.7	10
2	3	1	0.1	-	0.2	-	-	-	-	5.7	10
3	3	1	0.1	-	-	0.2	-	-	-	5.7	10
4	3	1	0.1	-	-	-	0.2	-	-	5.7	10
5	3	1	0.1	-	-	-	-	0.2	-	5.7	10
6	3	1	0.1	-	-	-	-	-	0.2	5.7	10
N	3	1	0.1	-	-	-	-	-	-	5.9	10

Team:Kyoto/Notebook1

From 2010.igem.org

Latest revision as of 02:17, 28 October 2010

Contents

Notebook1

Construction

Tuesday, July 20 By: Wataru, Tomo, Yuki, Kazuya, Ken, Makoto

Transformation

Wednesday, July 21 By: Wataru, Ken, Makoto, Takuya Y.

Culture at 37℃ from 07/21 20:50 to 07/22 17:00 and Making Master Plate

Transformation

PCR for SRRz and S

Thursday, July 22 By: Wataru

Electrophoresis (40min) of the PCR Products

Miniprep

Culture from 07/22 17:00 to 07/23 10:00 and Making Master Plates of pSB4K5 and B0015

Friday, July 23 By: Wataru, Tomo, Makoto

Miniprep

PCR Purification

PCR for SRRz

Restriction Digestion and Electrophoresis (35min) to check function of our Restriction Enzyme

Restriction Digestion and Ligation to insert S gene to E0840

Monday, July 26 By: Wataru, Tomonori, Makoto

Electrophoresis of PCR Products

PCR Purification

Transformation

Culture of pSB4K5, E0840, and B0015

Tuesday, July 27 By: Wataru, Tomo, Kazuya, Ken, Naoi

Colony PCR of SSam7-E0840 (Electrophoresis for 35min)

Miniprep

Restriction Digestion

Ligation

Transformation

Wednesday, July 28 By:

Miniprep

Deletion PCR to delete a functional domain of S gene

Restriction Digestion to check the function of DpnI

Electrophoresis for 35min

Thursday, July 29 By:

Restriction Digestion

Ligation and Phosphorylation

Transformation

Monday, August 2 By: Wataru, Ken

Miniprep

PCR of E0240

Electrophoresis

PCR Purification

Restriction Digestion for inserting E0240 to pSB4K5 by 3A assembly

PCR Purification

Error PCR

Restriction Digestion of SSam7,ΔTMD1-E0840 by DpnI

Transformation

Tuesday, August 3 By:

Culture

Miniprep

Restriction Digestion

PCR Purification

Ethanol Precipitation

Ligation

PCR of I20260

PCR Purification

Restriction Digestion

PCR Purification

Ligation

Transformation

Thursday, August 5 By:

Culture and Master Plates

Sequence

Friday, August 6

Miniprep

Restriction Digestion

Electrophoresis

Error PCR (Retry)

Transformation

Monday, August 9 By: Wataru, Tomonori, Ken, Takuya

Miniprep

Transfotrmation

Restriction Eigestion and Ethanol Precipitation

Ligation and Transformation

Tuesday, August 10 By: Wataru, Tomonori, Ken, Fumitaka

Colony PCR of S_Sam7-E0840 (Electrophoresis for 35min)

Restriction Digestion of S_Sam7,ΔTMD1-E0840 by DpnI

Miniprep of S_Sam7,ΔTMD1-E0840

Point mutation PCR of S_Sam7,ΔTMD1-E0840

Making Culture and Master Plate of S_ΔTMD1-E0840

Screening PCR of SRRz_Sam7-B0015

Deletion PCR of S_ΔTMD1-E0840 (2-2)

Retry of deletion PCR of S_ΔTMD1-E0840

Gel Extraction of R0011-rrS_ΔTMD1-E0840 (Electrophoresis for 45min)

Purification of J23105 (RPU0.3) and R0011-rrS_ΔTMD1-E0840

Screenig PCR of R0011-rrS_ΔTMD1-E0840-J23105 (RPU0.3)

Name	Template	10xbuffer	100xbuffer	EcoRI	XbaI 1	XbaI 2	SpeI	PstI 1	PstI 2	Water	Total
1	3	1	0.1	0.2	-	-	-	-	-	5.7	10
2	3	1	0.1	-	0.2	-	-	-	-	5.7	10
3	3	1	0.1	-	-	0.2	-	-	-	5.7	10
4	3	1	0.1	-	-	-	0.2	-	-	5.7	10
5	3	1	0.1	-	-	-	-	0.2	-	5.7	10
6	3	1	0.1	-	-	-	-	-	0.2	5.7	10
N	3	1	0.1	-	-	-	-	-	-	5.9	10