Team:Aberdeen Scotland/Parts

From 2010.igem.org

(Difference between revisions)
(Prototype team page)
 
(31 intermediate revisions not shown)
Line 1: Line 1:
-
<!-- *** What falls between these lines is the Alert Box!  You can remove it from your pages once you have read and understood the alert *** -->
+
{{:Team:Aberdeen_Scotland/css}}
-
 
+
{{:Team:Aberdeen_Scotland/Title}}
<html>
<html>
-
<div id="box" style="width: 700px; margin-left: 137px; padding: 5px; border: 3px solid #000; background-color: #fe2b33;">
+
<h1>Parts Submitted to the Registry</h1>
-
<div id="template" style="text-align: center; font-weight: bold; font-size: large; color: #f6f6f6; padding: 5px;">
+
-
This is a template page. READ THESE INSTRUCTIONS.
+
-
</div>
+
-
<div id="instructions" style="text-align: center; font-weight: normal; font-size: small; color: #f6f6f6; padding: 5px;">
+
-
You are provided with this team page template with which to start the iGEM season.  You may choose to personalize it to fit your team but keep the same "look." Or you may choose to take your team wiki to a different level and design your own wiki.  You can find some examples <a href="https://2008.igem.org/Help:Template/Examples">HERE</a>.
+
-
</div>
+
-
<div id="warning" style="text-align: center; font-weight: bold; font-size: small; color: #f6f6f6; padding: 5px;">
+
-
You <strong>MUST</strong> have a team description page, a project abstract, a complete project description, a lab notebook, and a safety page.  PLEASE keep all of your pages within your teams namespace. 
+
-
</div>
+
-
</div>
+
</html>
</html>
-
<!-- *** End of the alert box *** -->
+
== '''[http://partsregistry.org/Part:BBa_K385002  Part:BBa_K385002]:    Phage MS2 coat protein''' ==
 +
'''Length''':    414 bp
 +
'''Part type''': coding
-
{|align="justify"
 
-
|You can write a background of your team here.  Give us a background of your team, the members, etc.  Or tell us more about something of your choosing.
 
-
|[[Image:Aberdeen_Scotland_logo.png|200px|right|frame]]
 
-
|-
 
-
|
 
-
''Tell us more about your project.  Give us background.  Use this is the abstract of your project.  Be descriptive but concise (1-2 paragraphs)''
 
-
|[[Image:Aberdeen_Scotland_team.png|right|frame|Your team picture]]
 
-
|-
 
-
|
 
-
|align="center"|[[Team:Aberdeen_Scotland | Team Example]]
 
-
|}
 
-
<!--- The Mission, Experiments --->
+
'''Part information'''
-
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
+
This sequence encodes the MS2 coat protein from phage MS2. It has the property of being able to bind RNA stem loops in a sequence-specific manner. The sequence of the MS2 stem loops is provided in part number BBa_K385000. The coding sequence is supplied without a stop codon, so that it can be used as part of an N-terminal fusion. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385002 Sequence analysis] has been confirmed.
-
!align="center"|[[Team:Aberdeen_Scotland|Home]]
+
-
!align="center"|[[Team:Aberdeen_Scotland/Team|Team]]
+
-
!align="center"|[https://igem.org/Team.cgi?year=2010&team_name=Aberdeen_Scotland Official Team Profile]
+
-
!align="center"|[[Team:Aberdeen_Scotland/Project|Project]]
+
-
!align="center"|[[Team:Aberdeen_Scotland/Parts|Parts Submitted to the Registry]]
+
-
!align="center"|[[Team:Aberdeen_Scotland/Modeling|Modeling]]
+
-
!align="center"|[[Team:Aberdeen_Scotland/Notebook|Notebook]]
+
-
!align="center"|[[Team:Aberdeen_Scotland/Safety|Safety]]
+
-
|}
+
 +
'''Sequence'''
-
===Parts===
+
Atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctgaatggatcagctctaactcgcgttcacaggcttacaaagtaacctg
 +
tagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggtgcctaaagtggcaacccagactgttggtggagtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattc
 +
caattttcgctactaattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctacggtgacggtgctggtttaattaac
-
New for iGEM 2010 is the ''groupparts'' tag.  This tag will generate a table with all of the parts that your team adds to your team sandbox.  Note that if you want to document a part you need to document it on the [http://partsregistry.org Registry], not on your team wiki.
 
-
<groupparts>iGEM010 Aberdeen_Scotland</groupparts>
+
'''Design Notes'''
 +
 
 +
We omitted the stop codon so this part could be used in a protein fusion construct, with the MS2 protein forming the N-terminal domain. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)
 +
 
 +
 
 +
'''Source '''
 +
[http://www.ncbi.nlm.nih.gov/nuccore/V00642.1 see NCBI sequence ]
 +
 
 +
== '''[http://partsregistry.org/Part:BBa_K385003  Part:BBa_K385003]:    Phage lambda N-peptide ==
 +
 
 +
'''Length''':    90 bp
 +
 
 +
'''Part type''': coding
 +
 
 +
 
 +
'''Part information'''
 +
 
 +
N-peptide from phage lambda. This protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385005 Part:BBa_K385005]) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385003 Sequence analysis] has been confirmed.
 +
 
 +
 
 +
'''Sequence'''
 +
 
 +
atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaac
 +
 
 +
 
 +
'''Applications'''
 +
 
 +
The Aberdeen 2010 iGEM team has no direct experience of using [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003], but the closely related part [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]. consisting of a tandem repeat of the N-peptide, allowed the functional expression of a downstream GFP reporter.
 +
 +
 
 +
'''Design Notes'''
 +
 
 +
The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)
 +
 
 +
 
 +
'''Source '''
 +
Phage lambda genome
 +
 
 +
== '''[http://partsregistry.org/Part:BBa_K385004  Part:BBa_K385004]:    Phage lambda N-peptide, tandem repeat  ==
 +
 
 +
'''Length''':    177 bp
 +
 
 +
'''Part type''': coding
 +
 
 +
 
 +
'''Part information'''
 +
 
 +
Two copies of the N-peptide from phage lambda, arranged as a tandem repeat. The N-peptide protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. Tandem repeats of the N-peptide were cloned in this BioBrick so as to optimise binding opportunities to the target mRNA stem loop.  [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa%20K385004 confirmed sequence]
 +
 
 +
 
 +
'''Sequence'''
 +
 
 +
atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaacgacgctcaaa
 +
cccgtagaagagagagaagagccgaaaagcaagctcaatggaaggccgctaacggtgatggcgccggcttgattaat
 +
 
 +
 
 +
'''Applications'''
 +
 
 +
The N-peptide tandem repeat reading frame was fused in-frame to GFP to make a translational fusion. It was placed under control of the yeast GAL1 promoter (BBa_J63006), and transformed into yeast Saccharomyces cerevisiae in the single copy shuttle vector pRS415.
 +
The transformants were grown overnight in synthetic defined medium containing 2% w/v galactose, and observed using a fluorescence microscope optimised for GFP visualisation (Figure 1).
 +
 
 +
[[Image:PRS415_FLU.jpg|center|800 px]]
 +
 +
A control culture of the same transformant was grown using glucose as the carbon source; these conditions do not activate the GAL promoter. The results (Figure 2) show no GFP fluorescence.
 +
Overall the results indicate that the N-peptide can be successfully expressed as a protein fusion with other standard parts.
 +
 
 +
 
 +
'''Design Notes'''
 +
 
 +
The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of each of the tandem N-peptide repeats, to allow the N-peptide to be separated from each other, and any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)
 +
 
 +
'''Source '''
 +
Phage lambda genome
 +
 
 +
== '''[http://partsregistry.org/Part:BBa_K385005  Part:BBa_K385005]:    B-box sequence encoding a regulatory mRNA stem loop  ==
 +
 
 +
'''Length''': 56 bp
 +
 
 +
'''Part type''': Regulatory
 +
 
 +
 
 +
'''Part information'''
 +
 
 +
This part encodes a sequence that is capable of forming a stem loop in the mRNA. Moreover, this stem loop is bound in a sequence and structure-specific manner by the N-peptide sequence (see part numbers [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]). The mRNA stem sequence is derived from phage lambda, and forms part of a transcriptional termination attenuation system. This stem loop encoding sequence can be used as part of a eukaryote gene expression control strategy. Insertion of this stem loop into the 5' untranslated region (5'UTR) of a target gene (i.e. between the transcript start site and the AUG translation initiation site) will allow this mRNA to be actively translated in the absence of the N-peptide sequence. However, expression of the N-peptide in trans will allow N-peptide binding to the B-box stem, causing translational attenuation by inhibition of ribosome scanning along the 5'UTR.
 +
 
 +
 
 +
'''Sequence'''
 +
 
 +
attatctacttaagggccctgaagaagggcccttaagaacacaaaattcgagacat
 +
 
 +
 
 +
'''Source '''
 +
Phage lambda genome
 +
<html>
 +
<br><br>
 +
<hr>
 +
<table class="nav">
 +
<tr>
 +
<td>
 +
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Protocols"><img src="https://static.igem.org/mediawiki/2010/8/8e/Left_arrow.png">&nbsp;&nbsp;Return to Protocols</a>
 +
</td>
 +
<td align="right">
 +
<a href="https://2010.igem.org/Team:Aberdeen_Scotland/Modeling">Continue to the Modelling Summary&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/3/36/Right_arrow.png"></a>
 +
</td>
 +
</tr>
 +
</table>
 +
</html>
 +
{{:Team:Aberdeen_Scotland/Footer}}

Latest revision as of 15:57, 27 October 2010

University of Aberdeen - ayeSwitch - iGEM 2010

Parts Submitted to the Registry

Contents

[http://partsregistry.org/Part:BBa_K385002 Part:BBa_K385002]: Phage MS2 coat protein

Length: 414 bp

Part type: coding


Part information

This sequence encodes the MS2 coat protein from phage MS2. It has the property of being able to bind RNA stem loops in a sequence-specific manner. The sequence of the MS2 stem loops is provided in part number BBa_K385000. The coding sequence is supplied without a stop codon, so that it can be used as part of an N-terminal fusion. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385002 Sequence analysis] has been confirmed.


Sequence

Atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctgaatggatcagctctaactcgcgttcacaggcttacaaagtaacctg tagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggtgcctaaagtggcaacccagactgttggtggagtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattc caattttcgctactaattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctacggtgacggtgctggtttaattaac


Design Notes

We omitted the stop codon so this part could be used in a protein fusion construct, with the MS2 protein forming the N-terminal domain. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)


Source [http://www.ncbi.nlm.nih.gov/nuccore/V00642.1 see NCBI sequence ]

[http://partsregistry.org/Part:BBa_K385003 Part:BBa_K385003]: Phage lambda N-peptide

Length: 90 bp

Part type: coding


Part information

N-peptide from phage lambda. This protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385005 Part:BBa_K385005]) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa_K385003 Sequence analysis] has been confirmed.


Sequence

atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaac


Applications

The Aberdeen 2010 iGEM team has no direct experience of using [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003], but the closely related part [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]. consisting of a tandem repeat of the N-peptide, allowed the functional expression of a downstream GFP reporter.


Design Notes

The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of the sequence, to allow the N-peptide to be separated from any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)


Source Phage lambda genome

[http://partsregistry.org/Part:BBa_K385004 Part:BBa_K385004]: Phage lambda N-peptide, tandem repeat

Length: 177 bp

Part type: coding


Part information

Two copies of the N-peptide from phage lambda, arranged as a tandem repeat. The N-peptide protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. Tandem repeats of the N-peptide were cloned in this BioBrick so as to optimise binding opportunities to the target mRNA stem loop. [http://partsregistry.org/cgi/partsdb/dna.cgi?part_name=BBa%20K385004 confirmed sequence]


Sequence

atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaacgacgctcaaa cccgtagaagagagagaagagccgaaaagcaagctcaatggaaggccgctaacggtgatggcgccggcttgattaat


Applications

The N-peptide tandem repeat reading frame was fused in-frame to GFP to make a translational fusion. It was placed under control of the yeast GAL1 promoter (BBa_J63006), and transformed into yeast Saccharomyces cerevisiae in the single copy shuttle vector pRS415. The transformants were grown overnight in synthetic defined medium containing 2% w/v galactose, and observed using a fluorescence microscope optimised for GFP visualisation (Figure 1).

PRS415 FLU.jpg

A control culture of the same transformant was grown using glucose as the carbon source; these conditions do not activate the GAL promoter. The results (Figure 2) show no GFP fluorescence. Overall the results indicate that the N-peptide can be successfully expressed as a protein fusion with other standard parts.


Design Notes

The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of each of the tandem N-peptide repeats, to allow the N-peptide to be separated from each other, and any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC)

Source Phage lambda genome

[http://partsregistry.org/Part:BBa_K385005 Part:BBa_K385005]: B-box sequence encoding a regulatory mRNA stem loop

Length: 56 bp

Part type: Regulatory


Part information

This part encodes a sequence that is capable of forming a stem loop in the mRNA. Moreover, this stem loop is bound in a sequence and structure-specific manner by the N-peptide sequence (see part numbers [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385003 BBa_K385003] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K385004 BBa_K385004]). The mRNA stem sequence is derived from phage lambda, and forms part of a transcriptional termination attenuation system. This stem loop encoding sequence can be used as part of a eukaryote gene expression control strategy. Insertion of this stem loop into the 5' untranslated region (5'UTR) of a target gene (i.e. between the transcript start site and the AUG translation initiation site) will allow this mRNA to be actively translated in the absence of the N-peptide sequence. However, expression of the N-peptide in trans will allow N-peptide binding to the B-box stem, causing translational attenuation by inhibition of ribosome scanning along the 5'UTR.


Sequence

attatctacttaagggccctgaagaagggcccttaagaacacaaaattcgagacat


Source Phage lambda genome



Back to the Top