Team:Freiburg Bioware/testpage

From 2010.igem.org

(Difference between revisions)

Latest revision as of 12:06, 6 September 2010

banner

6. Labday 03.05.2010

Theoretical cloning

Investigators: Adrian, Hanna, Bea, Patrick, Chris W.

There are several matters to do in theoretical cloning. The modularization/modification of the stratagene plasmids and the enzymes. :

1. Cap-Gen:

delete the PstI-restriction site
insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)
add prefix & suffix
disable binding of Heparan Sulphat Proteoglycan

2. Rep-Gen:

delete EcoRI (2x) and PstI (2x)

3. ITRs:

NotI and PstI (in sequence?) flank the ITRs: its the question if we can/must delete them?
where exactly starts and ends the sequence (Patrick)?
it should be checked up if there is a possibility to use all of the three ITRs.
we blasted the ITR (left) of the MCS vektor (Stratagene). we got a 92% "Coverage" with the AAV2 genom (to 100%). from the alignment (Stratagene ITR with ITR of the AAV2 genom) we got:

You can see, that the ITR sequence beginns 4 bp after the PstI restriction site. thereupon we did a secundary structure analyse (www.dinamelt.bioinfo.rpi.edu), with the following structurewe got:
Media:Freiburg10_AAV2ITR(left)nachBlast.pdf
conclusion: the big loop of the secondary structure dosent change if we delete the PstI restriction site (cf. with other uploadet secondary structures), it should be considered that we can't add random bp that could affect the secundary structure.
To do: which bp, which sequence could/can be insertet? cf. the genome of AAV2

4. MCS:

replacement through the iGEM-MCS
where is the beginning and ending of the MCS in the Vector? ß-globin function and sequence (search for literature and patents, which are denoted in the AAV-Helper-Free-System Manual)
in this context it would be also important to find out where the beta-Globulin-Intron exactly starts or rather we can cut out the MCS.

5. enzymes:

Thymidinkinase: find informations. TK30 (Bea), SR39 (Hanna)
Cytosindeaminase: find informations (Adrian)

in addition we downloadet, addet and anotated the sequence of the pHelper plasmid of stratagene in Geneious (see "Constructs").

insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)

7. Labday 07.05.2010

Protocolls

Investigators: Anissa, Kerstin

adaption and extension of the standart prorcolls (Cloning for Pro's)
we startet to create a protokoll-mask for the praktical-cloning (short version for labwork)

8. Labday 10.05.2010

Stock solutions

Investigators: Adrian, Chris W., Chris L., Bea, Achim, Patrick, Hanna, (Sven)

The following stock solutions were prepared:
1. Antibiotics:

Ampicillin: 2 g Ampicillin were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at -20°C.
Chloramphenicol: 0.5 g Chloramphenicol were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at the -20°C.
Kanamycin: 1 g Kanamycin was dissolved in 20 mL multipore-H2O, sterilized by filtration and filled into 2 mL tubes and stored at the -20°C.
Tetracyclin: 0.5 g Tetracyclin were dissolved in 20 mL ethanol (70%) and filled into 2 mL tubes. The tubes were wrapped with aluminium foil (light sensitive!) and stored at -20°C.

2. ITPG solution (1 M):

~ 4.766 g ITPG were dissolved in 20 mL multipore-H2O, sterilized by filtration, filled in 2 mL tubes and stored at -20°C.

3. DYT (5 litres)

80 g Bactotrypton, 50 g Bactoyeast, 25 g NaCl were weight out.
2 L multipore-H2O were added
after mixing, multipore-H2O was added -> endvolume 5 litres
medium was filled into flask and was autoclaved

4. Glycerol:

Glycerol was filled into a flask and was then autoclaved

To do: register at Mr. Gene!!!

9. Labday 17.05.2010

β-Globin

Investigators: Bea, Chris W., Patrick, Hanna (and instructors)

We blasted the sequence of the β-globin and additional nukleotides „vorne und hintendran“. We found only 70% coverage with the human β-globin-intron add. some parts of the exon 3. For this reason we think that the pAAV_MCS annotation of the β-Globin-intron of Stratagene is too generously.
In addition the alignment of the human ß-globin showed that only parts of the intron 2 (5’) and exon 3 are integratet into the vector. We assume that the informations from Stratagene are not total correctly ( intron flanket by the splicedonors and the acceptor-sequence). We blasted the sequence between the CMV-promoter and the origin beginning of the ß-globin intron. We found a 98,8% coverage with a synthetic CMV-promoterconstruct ( 1 nucleotide difference). Literature: „Diverse plasmid DNA vectors by directed molecular evolution of cytomegalovirus promoters. (Wright A. et al.)“
→The question arises if we can omit the ß-globin (because the exact function is unknown). For this we should contact various Companys (GeneArt, DNA2.0, Mr. Gene,…) to get more information. In addition we could test the expression with and without ß-globin.

10. Labortag 18.05.2010

pCMV_mVenus_YFP

Investigator: Bea, Chris W., Patrick, Hanna, Anissa, Kerstin, Adrian (und Instructors)

Theoretical cloning with Geneious of pCMV-MCS + pGA14_mVenus_YFP --> pCMV_mVenus_YFP

Enzyme set: RFC 25 (iGEM)
digest pGA14_mVenus_YFP (insert) with XbaI and PstI: mVenus_YFP_cut_XbaI+PstI
digest pCMV_MCS (vector) with XbaI and PstI: pCMV_MCS_cut_XbaI+PstI
ligate mVenus_YFP_cut_XbaI+PstI with pCMV_MCS_cut_XbaI+PstI

11. Labortag 19.05.2010

Cloning of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP

Investigators: Adrian, Bea, Chris W., Hanna, Patrick

Digestion

plasmid: insert: pGA14_mVenus_YFP; number: P1 production date: ____ origin: ____
plasmid: vector: pCMV_MCS; number: P2 production date: ____ origin: ____
new vector name: pCMV_mVenus_YFP
buffer used:3 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme PstI(no.Lab:___)
DNA concentration (vector): 375 ng/µl ; DNA concentration (insert): 476 ng/µl

components	V (pGA_mVenus_YFP)/ µl	V(pCMV_MCS) / µl
DNA	4	2,7
BSA (10x)	2	2
Buffer 3 (10x)	2	2
Enzyme: XbaI (no.Lab:___)	1,5	1,5
Enzyme: PstI (no.Lab:___)	1	1
H2O	9,5	10,8
Total volume	20	20

Incubation: 1 h at 37°C

1% Agarose gel and Gel extraction

prepare 1% agarose gel, run gel for 45 minutes(119 V)
cut out insert and vector
perform gel extraction following standard protocol provided by Qiagen

Ligation

Measure DNA-concentration with Nanodrop
c(mVenus_YFP) = 16,8 ng/µL
c(pCMV_MCS) = 22,8 ng/µL
Calculation of volume needed for ligation:
c(mVenus_YFP) = 3,66 µL
c(pCMV_MCS) = 5,34 µL

Transformation

Transformation has been followed the standard protocol Media:Freiburg10_Cloning Protocol.pdf

12. Labortag 20.05.2010

Picking clones

Investigators: Adrian, Bea

3 approaches from each plate

13. Labortag 21.05.2010: CMV-Promoter

Theoretical cloning: (Volker, Hanna)

The CMV promoter (mainly the regulatory region) was further characterized: For this purpose U.S. patent no. 5,385,839 was used. Media:Freiburg10_Patent_US5385839A.pdf
Further on the CMV promoter sequence was blasted. The results delivered a 98% query coverage with the "Human herpesvirus 5 strain Toledo, complete genome" (accession no.: GU937742.1). Interestingly the maximal identity was just 99%. This can be explained due to a nucleotide deletion and a C-T transition (red circles), which were also marked in Geneious.

To do: find "+1"-location (transcription start); which transcription factors bind to the regulatory region of the CMV promoter?

LB medium was prepared: (Patrick and Chris W.)

10 g Bacto-Tryptone, 5 g Bacto-Yeast, 10 g NaCl were mixed in 500 mL milipore-H2O.
Volume was adjusted to 1 L with milipore-H2O.
100 mL flasks were each filled with 50 mL medium.
0.75 g agar was added to each flask.
LB was sterilized by autoclaving and is now stored at room temperature.

Plasmid Mini-Prep according to the standard protocol

investigator: Adrian, Kira, Anna, Chris W., Patrick
Measure DNA-concentration with Nanodrop

	P3 (pCMV_mVenus_YFP)	P4 (pCMV_mVenus_YFP)	P5 (pCMV_mVenus_YFP)
concentration (ng/µl)	457	470,8	477,29

14. Labortag 25.05.2010

Cloning of pCMV_mVenus_YFP + pAAV_MCS

Investigators: Kira, Anna, Volker, Jessica

plasmid: insert: pCMV_mVenus_YFP; number: P5 production date: 21.05.2010 origin: ____

plasmid: vector: pAAV_MCS; number: P? production date: ____ origin: ____

new vector name: pAAV_mVenus_YFP

1st try:

buffer used:3 ; Restriction-enzymes used: Enzyme NotI (no. Lab:46)

DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl

components	V (pCMV_mVenus_YFP)/ µl	V(pAAV_MCS) / µl
DNA	4.2	3.5
BSA (10x)	3	3
Buffer 3 (10x)	3	3
Enzyme: NotI (no.Lab:46)	1	1
H2O	15.3	15.3
Total volume	26.4	25.8

Incubation: 1 1/2 h at 37°C
note: too little water was added

1% Agarose gel

1% agarose gel was prepared, gel ran for 45 minutes(119 V)

2nd try:

buffer used:4 ; Restriction-enzymes used: Enzyme NotI (no. Lab:159)

DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl

components	V (pCMV_mVenus_YFP)/ µl	V(pAAV_MCS) / µl
DNA	4.2	3.5
BSA (10x)	3	3
Buffer 4 (10x)	3	3
Enzyme: NotI (no.Lab:159)	1,5	1,5
H2O	18,3	19
Total volume	30	30

Incubation: 1 1/2 h at 37°C
1% Agarose gel

1% agarose gel was repared, gel ran for 45 minutes(119 V)
Results: unexpected sizes of fragments (see protocol), try again next day with an ethidium bromid gel

Production of chemical competent E.coli

Investigators: Patrick and Jessica

competent E.coli XL-1-blue and competent E.coli BL21 produced according to the standard-protocoll Media:production of competent E.coli.pdf

Design of MCS-Oligos

Investigators: Bea, Adrian, Hanna, Sven

In order to replace the multiple cloning site of the pAAV_MCS vector from Stratagene by RFC25, two oligos were designed. After their hybridization the overhangs correspond to ClaI- and BglII restriction sites. A digestion with BglII and ClaI will be performed with pAAV-MCS and then will be ligated with the designed oligos.
The oligos (see link) were ordered at Sigma-Aldrich. Estimated shipment: 31.05.2010 .

File:Freiburg10 Oligos MCS RFC25 for pAAV.pdf

15. Labortag 26.05.2010

Oligos (PstI + MCS)

Investigators: Bea, Hanna, Jessica

Repeat cloning of pAAV-MCS + pCMV_mVenus_YFP --> Goal: pAAV_mVenus_YFP
Cloning did not work (see lab day 25.05.2010) either with NotI or with NotI-HF. Gel did not show any proper band at the expected size.
There will be used EtBr instead of gelred in the agarose gel and the incubation time of digestion will be prolonged. Further details are followed.
NOTE: There are three restriction sites of NotI in the pCMV-mVenus_YFP. If cloning with NotI, the polyA hGH signal will be deleted. therefore cloning with NotI is not possible .

Test digestion of pCMV-mVenusYFP with PstI and MluI
Digestion

experiment date: 26.05.2010
plasmid: pCMV_mVenus_YFP; number: P5; production date: 21.05.2010/ pCMV-MSC; number: P2; production date:
buffer used: 3/4; Restriction-enzymes used: Enzyme PstI (no. Lab:48) and Enyzme MluI (no. Lab:40) / NotI HF (no. Lab:159)
DNA concentration plasmid: P5 477,3 ng/µl / P2 550ng/µl

components	V (pCMV_mVenus_YFP)/ µl	V(pCMV_MCS) / µl
DNA	4,2	3,6
BSA (10x)	2	2
Buffer 3 (10x)	2	2
Enzyme: PstI/NotI HF (no.Lab:48/159)	1	2
Enzyme: MluI (no.Lab:40)	1	-
H2O	9,8	10,4
Total volume	20	20

Incubation: 1 h at 37°C
1% Agarose gel
1% agarose gel was repared, gel ran for 45 minutes(119 V)
Results: Test digestion of pCMV_MCS with NotI delivered plausibel results (expected fragment size: ~ 27 kbp and 17 kbp). Unfortunately the digestion of pCMV_mVenus_YFP with PstI and MluI resulted in one 2.9 kbp and one 1.2 kbp fragment, which didn't correspond to the expected fragment sizes of 19 kbp and 33 kbp - but to fragment sizes of pCMV_MCS without mVenus_YFP!
Ordering oligos:(Sigma-Aldrich)
(Bea)
Oligos have been ordered for modifying the ITRs. Deletion of PstI restriction site in ITR.

right ITR of pAAV_MCS
oligos ordered:
fwd: 5´- gcgcagctgcctgcaCGGGCGCCTGATGCGG -3´ 77 °C, 31 bp
rev: 5´- CCGCATCAGGCGCCCGTGCAGGCAGCTGCGC -3´

leftITR of pAAV_MCS
oligos ordered:
fwd: 5´- CCTTTTGCTCACATGTCGTGCAGGCAGCTGCGCG -3´ 74 °C, 34 bp
rev: 5´- CGCGCAGCTGCCTGCACGACATGTGAGCAAAAGG -3´

For further details see link
http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/4/44/Freiburg10_Oligos_ITR_mutagenesis_for_pAAV_delete_PstI.pdf

Test-Trafo of chemical competent E.coli cells
(Hanna)
The competent E.coli XL-1-blue and competent E.coli BL21 which were prepared the day before were test-transformed with pUC18 - following the standard protocol. Cells were plated on agar plates containing ampicillin and stored over night at 37°C. Further on two control plates containing ampicillin or kanamycin were prepared. Non-transformed cells were plated on them and also stored over night at 37°C.

16. Labortag 27.05.2010

Cell counting

Investigator: Patrick, Adrian, Chris W. Christian L.

Meeting

cell counting:

BL21 + PUC18 Trafo 54*4 = 216
XL1B + PUC18 Trafo 30*4 = 120

digitalization of recipe-cards (Christian L.)

17. Labortag 31.05.2010

pAAV_RC R585A and R588A transistions

In order to alter the tropism of AAV2 several modifications have to be performed. First of all the binding to Heparan Sulfate Proteoglycan has to be disrupted. This can be done by R585A and R588A transistions:

@@ Line 122: / Line 122: @@
 <div class="box_right">
 </html>
-==September==
+===6. Labday 03.05.2010===
-===107. labday 01.09.2010===
-====<p style="font-size:15px; background-color:#66bbff;"><b>Loop insertion BioBricks: Sequencing results</b></p>====
-<b>Investigator: Achim, Anna <br /></b>
-<p style="font-size:13px; color:#66bbff;">Comment: Sequencing results of Loop insertion BioBricks from 31.08.10; the following clones were sent for sequencing: </p>
-<br />
-*2: 453 BAP: No Insert
-[[File:Freiburg10 453 bap.JPG|400px]]
-*3:453 His: Insert okay
-[[File:Freiburg10 453 his.JPG|400px]]
-*5: 453 RGD: Mutation in 453 upstream region
-[[File:Freiburg10 453 rgd.JPG|400px]]
-*7: 587 BAP: Mutation in Bap insert
-[[File:Freiburg10 587 bap.JPG|400px]]
-*9:587 His: Insert okay
-[[File:Freiburg10 587 his.JPG|400px]]
-*11:587 KO BAP : Insert okay
-[[File:Freiburg10 587 KO bap.JPG|400px]]
-*13:587 KO empty : Insert okay
-[[File:Freiburg10 587 KO empty.JPG|400px]]
-*16: 587 KO his: Mutation in 587 KO
-[[File:Freiburg10 587 ko his.JPG|400px]]
-*17: 587 KO rgd: No insert
-[[File:Freiburg10 587 KO rgd.JPG|400px]]
-*19 :587 RGD: Insert okay
-[[File:Freiburg10 587 rgd.JPG|400px]]
-*25: 587 Z34C: Mutation in downstream 587 region
-[[File:Freiburg10 587 z34c.JPG|400px]]
-<b>Mini-Preps:<br /></b>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Theoretical cloning</b></p>====
-New Mini-Preps of the samples with no/mutated insert were prepared. The following clones were used:
+<p><b>Investigators: Adrian, Hanna, Bea, Patrick, Chris W. </b></p><br>
-{| border="1"
-|align="left" | '''Components''' ||align="left"| '''453 BAP''' ||align="left"| '''587 BAP''' ||align="left"| '''453 RGD'''||align="left"| '''587 KO RGD'''||align="left"| '''587 KO HIS'''||align="left"| '''453 Z34C'''||align="left"| '''587 Z34C'''||align="left"| '''587 KO Z34C'''||align="left"| '''587 KO Z34C SPACER'''
+There are several matters to do in theoretical cloning. The modularization/modification of the stratagene plasmids and the enzymes. :<br>
-|-
+<br>
-| align="left" | Clone||align="left"|1.3 + 1.4 ||align="left"|2.3 + 2.4 ||align="left"|4.3 + 4.4 ||align="left"|6.3 + 6.4 ||align="left"|9.3 + 9.4 ||align="left"|11.3 + 11.4||align="left"|12.2 + 12.4  ||align="left"| 13.2 + 13.4 ||align="left"| 14.3 + 14.4
+. Cap-Gen:
-|-
+* delete the PstI-restriction site
-|}
+* insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)
+* add prefix & suffix
+* disable binding of Heparan Sulphat Proteoglycan
+<br>
+. Rep-Gen:
+* delete EcoRI (2x) and PstI (2x)
+<br>
+. ITRs:
+* NotI and PstI (in sequence?) flank the ITRs: its the question if we can/must delete them?
+* where exactly starts and ends the sequence (Patrick)?
+* it should be checked up if there is a possibility to use all of the three ITRs.
+* we blasted the ITR (left) of the MCS vektor (Stratagene). we got a 92% "Coverage" with the AAV2 genom (to 100%). from the  alignment (Stratagene ITR with ITR of the AAV2 genom) we got:<br>
+ [[File:Freiburg10 ITR(left)-Stratagene vs. ITR AAV2.jpg|500x500px|]]
+You can see, that the ITR sequence beginns 4 bp after the PstI restriction site. thereupon we did a secundary structure analyse (www.dinamelt.bioinfo.rpi.edu), with the following structurewe got: <br>
+[[Media:Freiburg10_AAV2ITR(left)nachBlast.pdf]] <br>
+conclusion: the big loop of the secondary structure dosent change if we delete the PstI restriction site (cf. with other uploadet secondary structures), it should be considered that we can't add random bp that could affect the secundary structure. <br>
+<b>To do: which bp, which sequence could/can be insertet? cf. the genome of AAV2</b> <br>
+<br>
+. MCS:
+* replacement through the iGEM-MCS
+* where is the beginning and ending of the MCS in the Vector? ß-globin function and sequence (search for literature and patents, which are denoted in the AAV-Helper-Free-System Manual)
+* in this context it would be also important to find out where the beta-Globulin-Intron exactly starts or rather we can cut out the MCS.
+<br>
+. enzymes:
+* Thymidinkinase: find informations. TK30 (Bea), SR39 (Hanna)
+* Cytosindeaminase: find informations (Adrian)
+<br>
+in addition we downloadet, addet and anotated the sequence of the pHelper plasmid of stratagene in Geneious (see "Constructs").
-<br />
-<p style="font-size:13px; color:#66bbff;"><b>
-Comment:</b> Samples 1.3, 2.3, 4.3, 6.3, 9.3, 11.3, 12.2, 13.2, 14.3 were sent for sequencing.  For sequencing results go to labday 02.09.10. </p>.
-====<p style="font-size:15px; background-color:#66bbff;"><b>Design of primers for pAAV_RC</b></p>====
+insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)
-<b>Investigator: Bea <br /></b>
-<p style="font-size:13px; color:#66bbff;">Primers for different cloning strategies of the synthesized cap gene into pAAV_Rc have been designed.</p>
-<ol>
-<li>The first primers are mutagenesis primers which delete the KpnI recognition site at position 3968. These primers can (or should be used) be used if cloning with BspMI/BfuI (isochizomer) does not cut the pAAV_RC efficiently. Instead of using this enzyme we can use XcmI to subclone the cap gene with performing a site-directed mutagenesis afterwards with designed primers. </li>
-<li>The second idea is to design oligoduplexes (hybridized oligos) which contain the recognition site for BspMI. In Gormley et al (2002) the idea was to add oligodupexes with the recognition site for BspMI and therefore provide the "second recognition site" in trans. </li>
-</ol>
-<b>Next step:</b> Check primers and order them today! Designed primers are stored in my Workingfolder under paav_rc and a word document was created whcih can be found under Oligos --> primers for different strategies...
-<br/>
-<br/>
-====<p style="font-size:15px; background-color:#ff00ff;"><b>Sequencing results of pSB1C3_Zegfr:1907_Linker</b></p>====
+===7. Labday 07.05.2010===
-<b>Investigator: Hanna<br /></b>
-<br/>
-<p><font color="#00ff00;"><b>Comment:</b> Sequencing results looked all well. One bp was missing in the theoretical sequence of SEG suffix - but is correct in the actual sequence.</font></p>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Protocolls</b></p>====
-<br/>
-<b><u>pSB1Cr_Zegfr:1907_LongLinker:</u></b> <br/>
-[[File:PSB1C3 Zegfr1907 LongLinker.JPG|700px]]
-<br/>
-<b><u>pSB1Cr_Zegfr:1907_SEG:</u></b><br/>
+<p><b>Investigators: Anissa, Kerstin </b></p><br>
-[[File:PSB1C3 Zegfr1907 SEG.JPG|700px]]
-<br/>
-<b><u>pSB1Cr_Zegfr:1907_MiddleLinker:</u></b><br/>
+* adaption and extension of the standart prorcolls (Cloning for Pro's)
-[[File:PSB1C3 Zegfr1907 MiddleLinker.JPG|700px]]
+* we startet to create a protokoll-mask for the praktical-cloning (short version for labwork)
-<br/>
-<b><u>pSB1Cr_Zegfr:1907_ShortLinker:</u></b><br/>
+===8. Labday 10.05.2010 ===
-[[File:PSB1C3 Zegfr1907 ShortLinker.JPG|700px]]
-<br/>
-These constructs will be cloned into pCerulean for N-terminal fusion to VP2.
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Stock solutions</b></p>====
-<!--insert this text wherever you want. copy from here until "STOP"-->
-<html>
-<br />
-<a href="#top">go to the top ;)</a>
-</html>
-<!--"STOP"-->
-====<p style="font-size:15px; background-color:#66bbff;"><b>Trafo evalutaion and Inoculation</b></p>====
-<b>Investigator: Kira</b>
-<br/>
-The plate with transformed CD-biobrick contains around 40 colonies. 4 of them will be inoculated into LB and incubated @37 C over-night.
-<!--insert this text wherever you want. copy from here until "STOP"-->
-<html>
-<br />
-<a href="#top">go to the top ;)</a>
-</html>
-<!--"STOP"-->
-====<p style="font-size:15px; background-color:#66bbff;"><b>Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273)</b></p>====
+<p><b>Investigators: Adrian, Chris W., Chris L., Bea, Achim, Patrick, Hanna, (Sven)</b></p><br>
+The following stock solutions were prepared: <br>
+. Antibiotics:
+* Ampicillin: 2 g Ampicillin were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at -20°C.
+* Chloramphenicol: 0.5 g Chloramphenicol were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at the -20°C.
+* Kanamycin: 1 g Kanamycin was dissolved in 20 mL multipore-H2O, sterilized by filtration and filled into 2 mL tubes and stored at the -20°C.
+* Tetracyclin: 0.5 g Tetracyclin were dissolved in 20 mL ethanol (70%) and filled into 2 mL tubes. The tubes were wrapped with aluminium foil (light sensitive!) and stored at -20°C.
+. ITPG solution (1 M):
+* ~ 4.766 g ITPG were dissolved in 20 mL multipore-H2O, sterilized by filtration, filled in 2 mL tubes and stored at -20°C.
+. DYT (5 litres)
+* 80 g Bactotrypton, 50 g Bactoyeast, 25 g NaCl were weight out.
+* 2 L multipore-H2O were added
+* after mixing, multipore-H2O was added -> endvolume 5 litres
+* medium was filled into flask and was autoclaved
+. Glycerol:
+* Glycerol was filled into a flask and was then autoclaved
-<b>Investigator: Patrick</b>
+'''To do: register at Mr. Gene!!!'''
-The two Ligations were performed according to the standard protocol:<br>
-µl T4 DNA ligase, 1 µl 10x Buffer, 4,6 µl vector (P273), 3,34 µl Insert (P276, upper and lower band).<br>
-Incubation time: 50 minutes.
-During the transformation i forgot to put the cells into the 37°C shaker so i incubated them afterwards again for 45 minutes at 37 °C on a shaker.
-The mutual conles will be picked tomorrow to inoculate 10 ml DYT following a mini-prep on 03.09.2010
-====<p style="font-size:15px; background-color:#66bbff;"><b>Transfection, Seeding AAV293 and HT1080</b></p>====
-<b> Investigator: Kerstin </b>
-*Transfection: 10 plates, same treatment (10µg of RC (P357), pHelper (P356)and mVenus (P263), following the standard protocol)
-*Seeding HT1080 for transduction with virus from 21.08.2010 (10µg of RC, pHelper, TKGMK; pH=7,10)
-*Seeding AAV293 for transfection with plasmids without HgH or beta-globin (verifying functionality)
-====<p style="font-size:15px; background-color:#66bbff;"><b>Cloning of Z<sub>EGFR</sub>:1907_Middle-Linker,Z<sub>EGFR</sub>:1907_Short-Linker, Z<sub>EGFR</sub>:1907_SEG-Linker and Z<sub>EGFR</sub>:1907_Long-Linker into pCerulean</b></p>====
-<b>Investigator: Stefan </b>
-<p style="font-size:13px; color:red;"><b>Comment</b>:</p>
-<br/>
-'''Digestion:'''
-{| border="1"
-| components   || align="right" |Vector (P273) || align="right" |Z<sub>EGFR</sub>:1907_Middle-Linker (P290) || align="right" |Z<sub>EGFR</sub>:1907_Short-Linker (P292) || align="right" |Z<sub>EGFR</sub>:1907_SEG-Linker (P296) || align="right" |Z<sub>EGFR</sub>:1907_Long-Linker (P298)
-|-
-| DNA  ||  align="right" |3,8 ||  align="right" | 8,8 ||  align="right" | 10,2 ||  align="right" | 9,2 ||  align="right" | 8,7
-|-
-| BSA (10x) ||  align="right" |2||  align="right" | 2||  align="right" | 2||  align="right" | 2||  align="right" | 2
-|-
-| Buffer 4 (10x)||  align="right" |2 ||  align="right" | 2 ||  align="right" | 2||  align="right" | 2||  align="right" | 2
-|-
-|XbaI ||  align="right" |1 ||  align="right" |1||  align="right" |1||  align="right" |1||  align="right" |1
-|-
-|PstI  ||  align="right" |1||  align="right" |1||  align="right" |1||  align="right" |1||  align="right" |1
-|-
-|H<sub>2</sub>O||  align="right" |10,2 ||  align="right" | 5,2||  align="right" | 3,8||  align="right" | 4,8||  align="right" | 5,3
-|-
-|'''Total volume '''||  align="right" |20||  align="right" | 20||  align="right" | 20||  align="right" | 20||  align="right" | 20
-|}
 <br>
-,5 g Agarose,50 ml TAE (1%), 3 µl GELRED , at 115 Volt, running time: 50 minutes
+===9. Labday 17.05.2010===
-<br />
-<br />
-<br />
-<br />
-[[File:Freiburg10 pCerulean affi linker.jpg|500px|]]
-<br />
-<br />
-<br />
-<br />
-<br />
-'''Gelextraction:'''<br />
+====<p style="font-size:15px; background-color:#66bbFF;"><b>β-Globin</b></p>====
-The gelextraction was performed according to the standard protocol. DNA concentration of the extracts:
+<p><b>Investigators: Bea, Chris W., Patrick, Hanna (and instructors)</b></p><br>
-* P273: c= 3,1 ng/µl
-* P290: c= 3,2 ng/µl
-* P292: c= 1,8 ng/µl
-* P296: c= 3,0 ng/µl
-* P298: c= 3,2 ng/µl
 <br>
-'''T4 Ligation:'''<br />
+We blasted the sequence of the β-globin and additional nukleotides „vorne und hintendran“.
+We found only 70% coverage with the human β-globin-intron add. some parts of the exon 3.
-The  Ligation was performed as following:<br />
+For this reason we think that the pAAV_MCS annotation of the β-Globin-intron of Stratagene is too generously.<br>
-<p style="font-size:13px; color:red;"><b>Comment</b>: No sufficent vector concentration, therefore 5 µl of vector was used for every approach. </p>
+In addition the alignment of the human ß-globin showed that only parts of the intron 2 (5’) and exon 3 are integratet into the vector.
-* Vector Volume: 5 µl
+We assume that the informations from Stratagene are not total correctly ( intron flanket by the splicedonors and the acceptor-sequence).
-* Insert Volume: 3 µl
+We blasted the sequence between the CMV-promoter and the origin beginning of the ß-globin intron.
+We found a 98,8% coverage with a synthetic CMV-promoterconstruct ( 1 nucleotide difference).
+Literature: „Diverse plasmid DNA vectors by directed  molecular evolution of cytomegalovirus promoters. (Wright A. et al.)“<br>
+→The question arises if we can omit the ß-globin (because the exact function is unknown).
+For this we should contact various Companys (GeneArt, DNA2.0, Mr. Gene,…) to get more information.
+In addition we could test the expression with and without ß-globin.
 <br>
-* 1µl T4-Ligase buffer (10x)
-* 8µl (Vector + Insert) mix
-* 1µl T4-Ligase
-<br> Incubating for 40 minutes.
-<br>
+===10. Labortag 18.05.2010===
-'''Transformation:'''<br />
-Trafo was performed according to the standard protocol (BL21). The cells were plated on a agar plate with chloramphenicol
+====<p style="font-size:15px; background-color:#66bbFF;"><b>pCMV_mVenus_YFP</b></p>====
-<br>
-===108. labday 02.09.2010===
+<p><b>Investigator: Bea, Chris W., Patrick, Hanna, Anissa, Kerstin, Adrian (und Instructors)</b></p>
-====<p style="font-size:15px; background-color:#66bbff;"><b>Sequencing of loop insertions BioBricks: 2nd round</b></p>====
-<b>Investigator: Achim, Anna <br /></b>
-<br />
-We analyzed the new sequencing results and found two correct sequences:
-*587 BAP clone 2.3
-*453 RGD clone 4.3
-The other samples didn't contain any inserts or had wrong insertions. Apparently, the vector tends to religate easily. A possible reason for the religation of the incompatible ends is the overnight ligation at 18°C. We sent preps of the remaining 7 ligations for sequencing and will prep new clones or repeat the ligation tomorrow, depending on the new sequences.
-<p style="font-size:13px; color:#66bbff;"><b>
-Comment:</b> Clones 1.4, 6.4, 9.4, 11.4, 12.4, 13.4, 14.4 were sent for sequencing.  For sequencing results go to labday 03.09.10. </p>.
-====<p style="font-size:15px; background-color:#66bbff;"><b>Mini-preps of pSB1C3_SV40 and pCerulean_VP1_NLS</b></p>====
-<b>Investigator: Bea (Chris L) <br /></b>
-<br />
-Mini-Prep was performed according to the standard protocol
-<br />
-<li>P363 = pSB1C3_SV40 clone 1 = 277,70 ng/µl
-<li>P364 = pSB1C3_SV40 clone 2 = 265,01 ng/µl
-<li>P365 = pCerulean_VP1up_NLS (1) clone 1 = 473,14 ng/µl
-<li>P366 = pCerulean_VP1up_NLS (1) clone 2 = 455,88 ng/µl
-<li>P367 = pCerulean_VP1up_NLS (1) clone 3 = 482,86 ng/µl
-<li>P368 = pCerulean_VP1up_NLS (2) clone 1 = 438,52 ng/µl
-<li>P369 = pCerulean_VP1up_NLS (2) clone 2 = 478,00 ng/µl
-<li>P370 = pCerulean_VP1up_NLS (2) clone 3 = 419,00 ng/µl
-<br />
-Construct were digested with XbaI and PstI for 45 minutes at 37°C. The loading plan on the 1% agarose gel looks like this:
-<br />
-<br />
-_M_  ___ _363_  ___  _364_  _365_  _366_  _367_  _368_  _369_  _370_  ___
-<br />
-<br />
-<b>Results:</b>
-P365 was sent for sequencing because test digestion looks goos. In contrast to the SV40 appraoch. This needs to be repeated tomorrow.<br />
+Theoretical cloning with Geneious of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP</b>
 <ul>
-<li>Plasmid: pCerulean_VP1up_NLS</li>
+<li>Enzyme set: RFC 25 (iGEM)
-<li>Plasmid number: P365</li>
+<li> digest pGA14_mVenus_YFP (insert) with XbaI and PstI: mVenus_YFP_cut_XbaI+PstI
-<li>Tube name: SB1</li>
+<li> digest pCMV_MCS (vector) with XbaI and PstI: pCMV_MCS_cut_XbaI+PstI
-<li>Primer used: CMV-F</li>
+<li> ligate mVenus_YFP_cut_XbaI+PstI with pCMV_MCS_cut_XbaI+PstI
+<br>
+ [[File:Freiburg10 pCMV MCS mVenus YFP.png|500x500px|]]
 </ul>
-====<p style="font-size:15px; background-color:#ff00ff;"><b>Mini-Prep and test digestion of pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker</b></p>====
+===11. Labortag 19.05.2010===
-<b>Investigator: Hanna <br /></b>
-<br/>
-<p style="color:#ff00ff;"><b>Comment:</b> Zegfr:1907 (Affibody) and the His-Tag which was coupled to the middle linker were cloned into pCerulean. 3 clones of each construct were picked yesterday. </p>
-<br/>
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Plasmid Mini-Prep</p>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP</b></p>====
-*new vector name: pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker
-<br />
-<b><u>Glycerol Stocks</u></b> <br/>
-<b>1. pCerulean_Zegfr:1907</b>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3'''
-|-
-| align="left" | '''Bacteria strain''' ||align="left"| XL1b ||align="left"| XL1b  ||align="left"| XL1b
-|-
-| align="left" | '''Plasmidname''' ||align="left"| pCerulean_Zegfr:1907 ||align="left"| pCerulean_Zegfr:1907 ||align="left"| pCerulean_Zegfr:1907
-|-
-| align="left" | '''Date''' ||align="left"| 2.9.10 ||align="left"| 2.9.10 ||align="left"| 2.9.10
-|-
-| align="left" | '''given glycerol-stock no.''' ||align="left"| B275 ||align="left"| B276 ||align="left"| B277
-|-
-| align="left" | '''given plasmid no.''' ||align="left"| P371 ||align="left"| P372 ||align="left"| P373
-|}
-<br />
-<b>2. pCerulean_6xHis_MiddleLinker</b>
-{| border="1"
-| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3'''
-|-
-| align="left" | '''Bacteria strain''' ||align="left"| XL1b ||align="left"| XL1b  ||align="left"| XL1b
-|-
-| align="left" | '''Plasmidname''' ||align="left"| pCerulean_6xHis_MiddleLinker ||align="left"| pCerulean_6xHis_MiddleLinker ||align="left"| pCerulean_6xHis_MiddleLinker
-|-
-| align="left" | '''Date''' ||align="left"| 2.9.10 ||align="left"| 2.9.10 ||align="left"| 2.9.10
-|-
-| align="left" | '''given glycerol-stock no.''' ||align="left"| B278 ||align="left"| B279 ||align="left"| B280
-|-
-| align="left" | '''given plasmid no.''' ||align="left"| P374 ||align="left"| P375 ||align="left"| P376
-|}
-<br />
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Test digestion</p>
-*buffer used: 4; Restriction-enzymes used: Enzyme 1 PstI-HF ; Enzyme 2 EcoRI-HF
-*Plasmid
-**Given Plasmid-Number: 371; DNA concentration: 381.3 ng/µL;
-**Given Plasmid-Number: 372; DNA concentration: 377.5 ng/µL;
-**Given Plasmid-Number: 373; DNA concentration: 409.7 ng/µL;
-**Given Plasmid-Number: 374; DNA concentration: 404.2 ng/µL;
-**Given Plasmid-Number: 375; DNA concentration: 366.1 ng/µL;
-**Given Plasmid-Number: 376; DNA concentration: 375.0 ng/µL;
-<br />
-'''Comments:''':)
-<br />
-<br />
-<b>Pipetting scheme for each test digestion:</b>
-{| border="1"
-| align="left" | <b>Components</b> ||align="left"| <b>Volume/µL</b>
-|-
-| align="left" | DNA ||align="left"| 2.7
-|-
-| align="left" | BSA (10x) ||align="left"| 1
-|-
-| align="left" | Buffer no. 4 (10x) ||align="left"| 1
-|-
-| align="left" | EcoRI-HF ||align="left"| 0.5
-|-
-| align="left" | PstI-HF ||align="left"| 0.5
-|-
-| align="left" | H<sub>2</sub>O ||align="left"| 4.3
-|-
-| align="left" | <b>Total volume</b> ||align="left"| <b>10</b>
-|}
-<br />
-*Incubation: 55 minutes
+<p><b>Investigators: Adrian, Bea, Chris W., Hanna, Patrick</b></p>
-<br />
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Agarose-Gel:</p>
-<br />
-.875 g Agarose, 50 mL TAE (1.75 %), 3 µL EthBr, at 115 Volt, running time: 35 minutes
-<br />
-<br />
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
-!Sample
-!Sample/µl]
-!Loading dye (6x)/µl
-!Expected size
-|--
-|pCerulean_Zegfr:1907 clone 1
-|10 µl
-|2 µl
-|231 bp
-|--
-|pCerulean_Zegfr:1907 clone 2
-|10 µl
-|2 µl
-|231 bp
-|--
-|pCerulean_Zegfr:1907 clone 3
-|10 µl
-|2 µl
-|231 bp
-|--
-|pCerulean_6xHis_MiddleLinker clone 1
-|10 µl
-|2 µl
-|105 bp
-|--
-|pCerulean_6xHis_MiddleLinker clone 2
-|10 µl
-|2 µl
-|105 bp
-|--
-|pCerulean_6xHis_MiddleLinker clone 3
-|10 µl
-|2 µl
-|105 bp
-|--
-|}
+<b>Digestion</b>
-{| align=right
-|}
-<br />
-*Marker: GeneRuler ladder mix
-{| border="1"
-|
-!Marker /µL
-!Sample P371 /µl
-!Sample P372 /µl
-!Sample P373 /µl
-!Sample P374 /µl
-!Sample P375 /µl
-!Sample P376 /µl
-|-
-!Lane
-|5
-|12
-|12
-|12
-|12
-|12
-|12
-|-
-|}
-<br />
-'''Comments:''' Test digestion looked well: <br/>
-<br/>
-[[File:Freiburg10 pCerulean Zegfr1907andpCerulean 6xHis ML.png|700px]]
-<br/>
-Clone 1 of each construct were sent for sequencing (P371 and P374 = HW1 and HW2). Used primer: GATC_std_CMV-F.
-<br/>
-====<p style="font-size:15px; background-color:#66bbff;"> Midi-Prep of pSB1C3_lITR_CMV_mVenus_hGH_rITR clone1 & pSB1C3_lITR_CMV_beta-globin_mVenus_rITR clone1</p>====
-'''Investigators: Chris W. <br>
-<p style="font-size:13px; color:#003399;"> Midi-Preps of pSB1C3_lITR_CMV_mVenus_hGH_rITR clone1=P377 and pSB1C3_lITR_CMV_beta-globin_mVenus_rITR clone1=P378</p>
-The Midi-Preps were performed according to the standard protocol yielding the following concentrations:
-{| border="1"
-| plasmid-no. || align="right" |P377|| align="right" |P378
-|-
-| concentration (ng/µl)|| align="right" |325,04 || align="right" |561,15
-|-
-|}
 <br>
-====<p style="font-size:15px; background-color:#66bbff;"><b>Mini-Prep and test digestion of the CD biobricks</b></p>====
+<ul>
-<b>Investigator: Kira <br /></b>
+<li>plasmid: insert: pGA14_mVenus_YFP; number: P1 production date: ____ origin: ____ </li>
+<li>plasmid: vector: pCMV_MCS; number: P2 production date: ____ origin: ____ </li>
-[[File:mistake.png|thumb|right|200px]]
+<li>new vector name: pCMV_mVenus_YFP <br></li>
-[[File:Cartoons48.jpg|thumb|right|200px|Ohne Worte *lach*]]
+<li>buffer used:3 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme PstI(no.Lab:___)</li>
-Wh did you digest with eco and ndeI?? is there a spechía reasonn for it?? if the coonstruct was in the rfc standard  could digest it with the igem standard enzymes??
+<li>DNA concentration (vector): 375 ng/µl ; DNA concentration (insert): 476 ng/µl</li>
 {| border="1"
-| components   || align="right" |sample /µl
+| components   || align="right" | V (pGA_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl
 |-
-| DNA  ||  align="right" | 2,5
+| DNA  ||  align="right" | 4||align="right"|2,7
 |-
-| BSA (100x) ||  align="right" | 0
+| BSA (10x) ||  align="right" |2||align="right"|2
 |-
-| Buffer ___4_ (10x)||  align="right" | 1,5
+| Buffer 3 (10x)||  align="right" |2||align="right"|2
 |-
-|Enzyme NdeI (no.Lab:___)||  align="right" | 0,5
+|Enzyme: XbaI (no.Lab:___)||  align="right" |1,5||align="right"|1,5
 |-
-|Enzyme EcoRI (no.Lab:___)||  align="right" |0,5
+|Enzyme: PstI (no.Lab:___)||  align="right" |1||align="right"|1
 |-
-|H<sub>2</sub>O||  align="right" |10
+|H2O||  align="right" |9,5||align="right"|10,8
 |-
-|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | |15
+|'''Total volume'''||  align="right" |<b>20</b>||align="right"|<b>20</b>
 |}
-<li> Incubation: 1 h
+<li> Incubation: 1 h at 37°C</li>
-<br />
+</ul>
-<br />
-[[File:Freiburg10 test digestion of CD.jpg|500px|]]
+<b>1% Agarose gel and Gel extraction</b>
-<br />
+<ul>
-<br />
+<li>prepare 1% agarose gel, run gel for 45 minutes(119 V)</li>
+<li>cut out insert and vector</li>
+<li>perform gel extraction following standard protocol provided by Qiagen</li>
+</ul>
-Sample 1 was sent for sequencing
+<b>Ligation</b>
-<br/>
-===109. labday 03.09.2010===
+<ul>
-====<p style="font-size:15px; background-color:#ff00ff;"><b>Miniprep and test digestion of pSB1C3_lITR_pTERT_ßglobin_mVenus_hGH_rITR</b></p>====
+<li>Measure DNA-concentration with Nanodrop </li>
-<b>Investigator: Achim <br /></b>
+<li>c(mVenus_YFP) = 16,8 ng/µL</li>
-<br/>
+<li>c(pCMV_MCS) = 22,8 ng/µL</li>
-Comment: The test digestion did not show the expected fragments of 2000 and 2500 bp. the photo was exposed too long to see distinct bands. Digestion will be repeated.
+<li>Calculation of volume needed for ligation:
+<li>c(mVenus_YFP) = 3,66 µL</li>
+<li>c(pCMV_MCS) = 5,34 µL</li></li>
+</ul>
-[[File:AA1.png|100px]]
+<b>Transformation</b>
-<br/>
+<ul>
+<li>Transformation has been followed the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]] </li>
+</ul>
-====<p style="font-size:15px; background-color:#ff00ff;"><b>Sequencing results</b></p>====
+===12. Labortag 20.05.2010===
-<b>Investigator: Hanna <br /></b>
-<br/>
-<b>Comment:</b> pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker were cloned and sent for sequencing yesterday.
-<br/>
-<b>1. pCerulean_Zegfr:1907:</b> Sequencing looked well.
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Picking clones</b></p>====
-<br/>
-[[File:Freiburg10 pCerulean Zegfr1907 seq.JPG|700px]]
-<br/>
-<b>2. pCerulean_6xHis_MiddleLinker:</b> Sequencing looked also well.
+<p><b>Investigators: Adrian, Bea</b></p>
-[[File:Freiburg10 pCeruelan 6xHis MiddleLinker seq.JPG|700px]]
+<ul><br/>
-<br/>
+Clones were picked according to the standard protocol.
+*3 approaches from each plate</li>
+</ul>
-====<p style="font-size:15px; background-color:#ff00ff;"><b>Cloning of pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker</b></p>====
+====13. Labortag 21.05.2010: CMV-Promoter====
-<b>Investigator: Hanna <br /></b>
-<br/>
-<p style="color:#ff00ff;"><b>Comment:</b> For N-terminal fusion to VP2, the Affibody - fused to different kinds of linkers - will be cloned into the expression plasmid pCerulean. For imaging CFP, which was fused to the middle linker, will be cloned into pCerulean. </p> <br/>
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Practical Cloning:</p>
-*plasmid:
-**Vector: name: pCerulean number: P273
-**Insert: name: pSB1C3_Zegfr:1907_LongLinker (P298), pSB1C3_Zegfr:1907_MiddleLinker (P290), pSB1C3_Zegfr:1907_SEG (P296), pSB1C3_Zegfr:1907_ShortLinker (P292), pSB1C3_CFP_MiddleLinker (P276)
-*new vector name: pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker
-*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 EcoRI-HF ; Enzyme 2 PstI-HF
-*DNA concentration (vector): 419.5 ng/µL ; DNA concentration (insert): P298 229.7 ng/µL, P290 227.4 ng/µl; P296 218.7 ng/µL; P292 196.6 ng/µL; P276 207.7  ng/µL
-<br />
-'''Comments:''' No.
-<br />
-<br />
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Digestion</p>
-{| border="1"
-| components   || align="right" |volume of pCerulean /µl || align="right" |volume of Zegfr:1907_MiddleLinker /µl || align="right"|volume of CFP_MiddleLinker /µL
-|-
-| DNA  ||  align="right" | 8.3 ||  align="right" | 7.6 ||  align="right" | 4.8
-|-
-| BSA (10x) ||  align="right" | - ||  align="right" | - ||  align="right" | -
-|-
-| Buffer 4 (10x)||  align="right" | 2 ||  align="right" | 2 ||  align="right" | 2
-|-
-|Enzyme 1 EcoRI-HF||  align="right" | 1 ||  align="right" | 1 ||  align="right" | 1
-|-
-|Enzyme 2 PstI-HF||  align="right" | 1 ||  align="right" | 1 ||  align="right" | 1
-|-
-|H<sub>2</sub>O||  align="right" | 7.7 ||  align="right" | 8.4 ||  align="right" | 11.2
-|-
-|'''Total volume'''||  align="right" | 20 ||  align="right" | 20 ||  align="right" | 20
-|}
-*Incubation: 1.5 h
-<br /><br />
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Agarose-Gel:</p>
-<br />
-.8 g Agarose, 50 TAE (1.5 %), 5 µL EthBr, at 70 Volt, running time: ~ 1 hour
-<br />
-<br />
-{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
-!Sample
-!Sample/µl]
-!Loading dye (6x)/µl
-!Expected size 1
-|--
-|P273
-|20 µl
-|4 µl
-|3922 bp
-|--
-|P298
-|20 µl
-|4 µl
-|273 bp
-|--
-|P290
-|20 µl
-|4 µl
-|261 bp
-|--
-|P296
-|20 µl
-|4 µl
-|345 bp
-|--
-|P292
-|20 µl
-|4 µl
-|249 bp
-|--
-|P276
-|20 µl
-|4 µl
-|801 bp
-|--
-|}
-{| align=right
-|}
-<br />
-*Marker: GeneRuler ladder mix
-{| border="1"
-|
-!Marker
-!Sample P273 /µl
-!Sample P276 /µl
-!Sample P290 /µl
-!Sample P292 /µl
-!Sample P296 /µl
-!Sample P298 /µl
-|-
-!Lane
-|5
-|24
-|24
-|24
-|24
-|24
-|24
-|-
-|}
-<br />
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Gel extraction</p>
-<br />
-Gel measurement:
-<br />
-{| border="1"
-| align="left" | '''Sample'''
-| align="left" | '''Volume'''
-| align="left" | '''Concentration'''
-|-
-| align="left" | P273
-| align="left" | 20
-| align="left" | 115.45 ng/µL
-|-
-| align="left" | P276
-| align="left" | 20
-| align="left" | 9.91 ng/µL
-|-
-| align="left" | P298
-| align="left" | 20
-| align="left" | 5.07 ng/µL
-|-
-| align="left" | P296
-| align="left" | 20
-| align="left" | 9.03 ng/µL
-|-
-| align="left" | P290
-| align="left" | 20
-| align="left" | 10.31 ng/µL
-|-
-| align="left" | P292
-| align="left" | 20
-| align="left" | 20.78 ng/µL
-|}
-<br /><br />
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Ligation</p>
-<br />
-<b>1. PCerulean_Zegfr:1907_LongLinker</b>
-{| border="1"
-| align="left" |  ||align="left"| '''P298''' ||align="left"| '''P273'''
-|-
-| align="left" | '''Volume/µl''' ||align="left"| 6.61 ||align="left"| 1.39
-|}
-<br />
-<b>2. PCerulean_Zegfr:1907_MiddleLinker</b>
-{| border="1"
-| align="left" |  ||align="left"| '''P290''' ||align="left"| '''P273'''
-|-
-| align="left" | '''Volume/µl''' ||align="left"| 5.53 ||align="left"| 2.47
-|}
-<br />
-<b>3. PCerulean_Zegfr:1907_SEG</b>
-{| border="1"
-| align="left" |  ||align="left"| '''P296''' ||align="left"| '''P273'''
-|-
-| align="left" | '''Volume/µl''' ||align="left"| 6.17 ||align="left"| 1.83
-|}
-<br />
-<b>4. PCerulean_Zegfr:1907_ShortLinker</b>
-{| border="1"
-| align="left" |  ||align="left"| '''P292''' ||align="left"| '''P273'''
-|-
-| align="left" | '''Volume/µl''' ||align="left"| 4.11 ||align="left"| 3.89
-|}
-<br />
-<b>5. PCerulean_CFP_MiddleLinker</b>
-{| border="1"
-| align="left" |  ||align="left"| '''P276''' ||align="left"| '''P273'''
-|-
-| align="left" | '''Volume/µl''' ||align="left"| 7.02 ||align="left"| 0.98
-|}
-<br />
-<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Trafo</p>
-<br />
-Trafo was performed following the standard protocol. Used cells: XL1b, DNA amount: 2.5 µL of each ligation reaction. Plates were stored @ 37°C room over night.
-<br/>
-====<p style="font-size:15px; background-color:#66bbff;"><b>Harvest viral particles, Seeding HT1080 cells</b></p>====
-<b>Investigator: Adrian, Kerstin <br /></b>
-*Harvest viral particles of Transfection from 31.08.2010 (six approaches: 10µg of RC (2x P326 and 2x P325 and 2x Stratagene), pHelper and GOI (P262))
-*Seeding HT1080 cells
-====<p style="font-size:15px; background-color:#66bbff;"><b>Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273)</b></p>====
-Investigator: Patrick
-<br />
-The Miniprep was performed according to the standard protocol.
-Labelling:
-*P381: pCerulean_middlelinker clone 1 upper band : 526,0 ng/µl
-*P382: pCerulean_middlelinker clone 2 upper band : 522,0 ng/µl
-*P383: pCerulean_middlelinker clone 3 upper band : 463,0 ng/µl
-*P384: pCerulean_middlelinker clone 1 lower band : 465,0 ng/µl
-*P385: pCerulean_middlelinker clone 2 lower band : 500,0 ng/µl
-*P386: pCerulean_middlelinker clone 3 lower band : 524,0 ng/µl
-[[File:Cartoons48.jpg|thumb|right| Öhm Patrick: Hier ist der Grund, warum das Experiment "wiederholt" wurde: Falsche Beschrieftung hier, als auch in der Excel Tabelle ;) "Finde den Fehler!" :P]]
 <br>
+<b>Theoretical cloning:</b> (Volker, Hanna)
-see also http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/index.php/August_2010#Cloning_CFP_middlelinker_.28from_pSB1C3_CFP_middlelinker.2C_P276.29_into_pCerulean_.28P273.29
+* The CMV promoter (mainly the regulatory region) was further characterized: For this purpose U.S. patent no. 5,385,839 was used. [[Media:Freiburg10_Patent_US5385839A.pdf]]
-[[File:Mistake.png|thumb|right|400px| ;-) bitte ausfüllen]]
+* Further on the CMV promoter sequence was blasted. The results delivered a 98% query coverage with the "Human herpesvirus 5 strain Toledo, complete genome" (accession no.: GU937742.1). Interestingly the maximal identity was just 99%. This can be explained due to a nucleotide deletion and a C-T transition (red circles), which were also marked in Geneious.
-Testdigestion: 7 µl DNA sample, 1 µl Buffer 4 (10x), 1 µl BSA, 0,5 µl Xba, 0,5 µl PstI-HF
+[[File:Freiburg10_CMV-Alignment.jpg|500x500px|]]
 <br>
-Expected size of the fragments: 786 & 2053bp
+[[File:Freiburg10 CMV.jpg|800x800px|]]
 <br>
-There seems to be something wrong.
+'''To do''': find "+1"-location (transcription start); which transcription factors bind to the regulatory region of the CMV promoter?
 <br>
+<br>
+'''LB medium''' was prepared: (Patrick and Chris W.)
+* 10 g Bacto-Tryptone, 5 g Bacto-Yeast, 10 g NaCl were mixed in 500 mL milipore-H2O.
+* Volume was adjusted to 1 L with milipore-H2O.
+* 100 mL flasks were each filled with 50 mL medium.
+* 0.75 g agar was added to each flask.
+* LB was sterilized by autoclaving and is now stored at room temperature.
+<br>
+<br>
+<b>Plasmid Mini-Prep according to the standard protocol</b>
-[[File:Freiburg10_pat20100903.jpg‎|400px]]
+<ul>
+<li>investigator: Adrian, Kira, Anna, Chris W., Patrick</li>
-Sent for sequencing: P381 & P385
+<li>Measure DNA-concentration with Nanodrop</li>
-Labelling: P381-CMV_rev & P385-CMV_rev <br>
+</ul>
-Used primer: O21 : CMV_reverse_qPCR
-====<p style="font-size:15px; background-color:#66bbff;"><b>Cloning of pSB1C3_leftITR_pTert and pSB1C3_mGMK with pSB1C3_leftITR_CMV</b></p>====
-<b>Investigator: Chris L. <br /></b>
-*Vector: name: pSB1C3_leftITR_pTERT clone 1 '''P256''' c=179,2 ng/µl
-*Vector: name: pSB1C3_leftITR_CMV '''P188''' c=231,6 ng/µl
-*Insert: name: pSB1C3_mGMK '''P195''' c=258,6 ng/µl
-*new vector name: pSB1C3_leftITR_CMV_GMK
-*new vector name: pSB1C3_leftITR_pTERT_GMK
-*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 PstI ; Enzyme 2 SpeI ; Enzyme 3 XbaI
-<br />
 {| border="1"
-| '''components'''   || align="right" |'''P195''' || align="right" |'''P256 /µl''' || align="right" |'''P188 /µl'''
+| || align="right" | P3 (pCMV_mVenus_YFP)   ||align="right"| P4 (pCMV_mVenus_YFP)  ||align="right"| P5 (pCMV_mVenus_YFP)
 |-
-| DNA  ||  align="right" | 7,7 ||  align="right" | 11,2 ||  align="right" | 8,6
+| concentration (ng/µl)||  align="right" | 457||align="right"|470,8||  align="right" | 477,29
-|-
-| BSA (10x) ||  align="right" | 2 ||  align="right" | 2 ||  align="right" | 2
-|-
-| Buffer 4 (10x)||  align="right" |2 ||  align="right" |2 ||  align="right" |2
-|-
-|Enzyme SpeI ||  align="right" |1 ||  align="right" |1 ||  align="right" |0
-|-
-|Enzyme XbaI ||  align="right" |0 ||  align="right" |0 ||  align="right" |1
-|-
-|Enzyme PstI ||  align="right" |1 ||  align="right" |1 ||  align="right" |1
-|-
-|H2O||  align="right" | 6,3 ||  align="right" | 2,8 ||  align="right" | 5,4
-|-
-|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | 20||  align="right" |20 ||  align="right" |20
 |}
-<br />
+===14. Labortag 25.05.2010===
-,5 g Agarose,50 ml TAE (1%), 3 µl GELRED , at 130 Volt, running time:45
-<br />
-<br>
-'''Results''': <br>
-[[File:Freiburg10 pSB1C3 lITR pTERT and pSB1C3 lITR CMV with GMK Insert.jpg|550px]] <br>
-<br />
-*c(Insert)= 15,37 ng/µl; size: 627 bp <br />
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV_mVenus_YFP + pAAV_MCS</b></p>====
-*c(Vector)= 50,84 ng/µl; size: 2869 bp
-*c(Vector)= 75,64 ng/µl; size: 2672 bp
-<br />
-*Ligation of PCR products and vector:
+<p><b>Investigators: Kira, Anna, Volker, Jessica</b></p>
-For the Ligation 1µl T4 buffer (10x) and 1µl T4 ligase were used. Incubation time: 45 min
+<br>
-<br />
-{| border="1"
-| ''' '''   || align="right" |'''pSB1C3_leftITR_CMV + GMK /µl'''|| align="right" |''' pSB1C3_leftITR_pTERT + GMK'''
-|-
-| Vector || align="right" |5,48 ||  align="right" | 6,21
-|-
-| Insert || align="right" |2,52 ||  align="right" | 1,79
-|-
-|}
-<br />
-*Transformation:
+<li>plasmid: insert: pCMV_mVenus_YFP; number: P5 production date: 21.05.2010 origin: ____
+<li>plasmid: vector: pAAV_MCS; number: P? production date: ____ origin: ____
+<li>new vector name: pAAV_mVenus_YFP <br>
-The transformation was done following the standard protocol using XL1 blue cells.<br />
+<br>
-<br />
+'''1st try:
-====<p style="font-size:15px; background-color:#66bbff;"><b>Sequence analysis of pCerulean_VP1up</b></p>====
+<li>buffer used:3 ; Restriction-enzymes used: Enzyme NotI (no. Lab:46)
-<b>Investigator: Bea<br /></b>
+<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl
-<p style="font-size:13px; color:#66bbff;">The assembled pCerulean_VP1up which serves as the first construct in the VP1 insertion cloning assembly was sent for sequencing. </p>
-<ul>
-<li>Plasmid used: P365</li>
-<li>Primer used: CMV-F</li>
-<li>Tube name: SB1</li>
-<li>Folder (Geneious): N-terminal Targeting --> pCerulean_VP1up_NLS</li>
-</ul>
-<br />
-<gallery widths=900px heights=300px>
-Image:Freiburg 10 SeqAnalysis of pCerulean VP1up NLS 03.09.2010.jpg
-</gallery>
-<br />
-====<p style="font-size:15px; background-color:#66bbff;"><b>pCerulean_VP1up_NLS_Targeting molecule</b></p>====
-<b>Investigator: Bea<br /></b>
-<p style="font-size:13px; color:#66bbff;">Comment: For preparing the next step in the VP1 insertion, different targeting molecules will be fused to the construct pCerulean_VP1up_NLS. </p>
-<ol>
-<li>The first construct is the Affibody Z<sub>EGF-R:1907</sub> which was already cloned into the standard iGEM plasmid and can be sued for target tumor cells overexpressing the EGF receptor.</li>
-<li>The second construct is the mVenus (Yellow fluorescent protein) which can be used for imaging experiments</li>
-<li>Another motif will be the His-tag. Since the His-tag is very small, the oligos will be hybridized and directly ligated into the pCerulean backbone.</li>
-</ol>
-<br />
-<b>Digestion of vector:</b>
-<ul>
-<li>Plasmid used: pCerulean_VP1up_NLS (P365) c=470 ng/µL</li>
-<li>Add BSA</li>
-<li>AgeI-HF and SpeI-HF were used</li>
-</ul>
-<br/>
-<b>Protocol of the digestion of the vector:</b>
 {| border="1"
-| align="left" | '''Components''' ||align="left"| <b>v<sub>pCerulean_VP1up_NLS</sub></b>/µL
+| components   || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl
 |-
-| align="left" | DNA   ||align="left"| 3
+| DNA  ||  align="right" | 4.2||align="right"|3.5
 |-
-| align="left" | BSA (100x) ||align="left"| 2,5
+| BSA (10x) ||  align="right" |3||align="right"|3
 |-
-| align="left" | Buffer no. 4 (10x) ||align="left"| 2,5
+| Buffer 3 (10x)||  align="right" |3||align="right"|3
 |-
-| align="left" | Enzyme 1 AgeI ||align="left"| 1
+|Enzyme: NotI (no.Lab:46)||  align="right" |1||align="right"|1
 |-
-| align="left" | Enzyme 2 SpeI HF ||align="left"| 1
+|H2O||  align="right" |15.3||align="right"|15.3
 |-
-| align="left" | H<sub>2</sub>O ||align="left"| 15
+|'''Total volume'''||  align="right" |<b>26.4</b>||align="right"|<b>25.8</b>
-|-
-| align="left" | '''Total volume''' ||align="left"| <b>25</b>
 |}
-<br />
-<ul>
-<li>Incubation of the sample at 37°C</li>
-<li>Incubation for 120 minutes</li>
-</ul>
-<br />
-The Targeting molecules were digested with different enzmyes than the vector for providing the ability to assemble the different constructs together without creating new restriction site but to delete them. This works by fusing NgoMIv and AgeI together.
-<br />
-<br />
-<b>Digestion of the targeting molecules </b>
-<ul>
-<li>Plasmids used:</li>
-<ol>
-<li>pSB1C3_zEGF-R:1907 (P284) c=146 ng/µL</li>
-<li>pGA14_mVenus(P60) c=280 ng/µL</li>
-</ol>
-<li>Add BSA</li>
-<li>NgoMIV and SpeI-HF were used</li>
-</ul>
-<br/>
-{| border="1"
-| align="left" | '''Components''' ||align="left"| <b>v<sub>ZEGFR (P284)</sub></b>/µL ||align="left"| <b>v<sub>pGA_mVenus (P60)</sub></b>/µL
-|-
-| align="left" | DNA   ||align="left"| 13 µl||align="left"| 7 µl
-|-
-| align="left" | BSA (10x) ||align="left"| 2,5 µl||align="left"| 2,5 µl
-|-
-| align="left" | Buffer no. 4 (10x) ||align="left"| 2,5 µl||align="left"| 2,5 µl
-|-
-| align="left" | Enzyme 1 NgoMIV- ||align="left"| 1,0 µl||align="left"| 1,0 µl
-|-
-| align="left" | Enzyme 2 AgeI HF ||align="left"| 1,0 µl||align="left"| 1,0 µl
-|-
-| align="left" | H<sub>2</sub>O ||align="left"| 15 µl||align="left"| 15 µl
-|-
-| align="left" | '''Total volume''' ||align="left"| <b>25</b> ||align="left"| <b>25</b>
-|}
-<ul>
-<li>Incubation of the sample at 37°C</li>
-<li>Incubation for 90 minutes</li>
-</ul>
-<br />
-After incubation the samples were loaded on a 1% agarose gel. The obtained gel (after running the gel for 15 minutes) can be seen below.
-<br />
-<gallery widths=400px heights=400px>
-Image: Freiburg10 pCerulean VP1up NLS TargetingMolecule.jpg
-</gallery>
-<br />
-<b>Results: </b>The boxes mark fragments which ere cut out of the gel. The left lane (pCerulean) looks a bit strange, because Marker was added after the digestion reaction instead of Loading dye.
-<br />
-<br />
-<p style="font-size:13px; color:#33bbff;">Parallel, for assembling the His-Tag to the construct pCerulean_VP1up_NLS, oligos for the His-Tag in the RFC25 standard (provided by Gerrit) were hybridized and can directly be ligated in the digested vector. This strategy was used because of the smal size of the His-Tag which cannot be separated easily by the agarose gel. </p>
-<br />
-<b>Hybridization of the His-Oligos</b>
-<ul>
-<li>10µL oligo1 (1:10)</li>
-<li>10µL oligo2 (1:10)</li>
-<li>4µL 100mM Tris-Cl pH 8 </li>
-<li>10µL 5mM MgCl<sub>2</sub></li>
-<li>8µL H<sub>2</sub>O</li>
-</ul>
-The used programm for the hybridization:
-<ul>
-<li>99°C 7´</li>
-<li>99°C 1´</li>
-<li>-1°C R=0,3°/s </li>
-<li>Goto 2 rep 74</li>
-<li>Hold 4°C</li>
-</ul>
-<br/>
-After the gel extraction of a T4 ligation was performed.
-<ul>
-<p style="font-size:13px; color:#cc3300;">Affibody Z<sub>EGF-R:1907</sub>:</p>
-v<sub>Cerulean_VP1up_NLS</sub> = 5,82µL<br />
-v<sub>ZEGF-R:1907</sub> = 2,18µL <br />
-<br />
-<p style="font-size:13px; color:#cc3300;">mVenus Z:</p>
-v<sub>Cerulean_VP1up_NLS</sub> = 4,04µL<br />
-v<sub>mVenus</sub> = 3,96 µL<br />
-<br />
-<p style="font-size:13px; color:#cc3300;">6xHisTag:</p>
-v<sub>Cerulean_VP1up_NLS</sub> = 0,2µL<br />
-v<sub>6xHisTag</sub> = 7,98µL <br />
-</ul>
-<br />
-<b>Next steps:</b> Picking clones of the trafo plates (containing Kanamycin) and perform the Mini-Prep. The obtaining constructs finally will be fused to the VP2/3 protein which results in the final construct for the VP1 targeting approach.
-<br/>
-<br/>
-====<p style="font-size:15px; background-color:#66bbff;"><b>3rd Repetition of Mini-Preps and test digestion for Loop insertion BioBricks</b></p>====
-<b>Investigator: Achim, Anna<br /></b>
-Sequencing results of Loop insertion BioBricks from 02.09.10; the following clones looked well:
-*pSB1C3_587_KO_RGD_clone6.4<br>
-*PSB1C3_587_KO_His_clone9.4
+<li> Incubation: 1 1/2 h at 37°C
 <br>
-<p style="font-size:13px; color:#003399;"><b>Update</b>: 9 of the 14 ViralBricks looked well (sequencing results from 01. - 03.09.). Two new clones of the remaining constructs were prepared and test digested. </p>
+'''note: too little water was added
-<b>Test digestion:</b>
 <br>
-{| border="1"
+<br>
-| components ||Volume for each sample /µl
+% Agarose gel
-|-
+<br>
-| DNA  || 10
+<li>1% agarose gel was prepared, gel ran for 45 minutes(119 V)
-|-
+<br>
-| BSA (10x) ||1,5
+<br>
-|-
+'''2nd try:'''
-| Buffer 4 (10x) ||1,5
-|-
-|Enzyme EcoRI HF ||0,5
-|-
-|Enzyme NotI HF ||0,5
-|-
-|H2O || 1
-|-
-|'''Total volume /µl'''||15
-|}
-<br />
-{| border="1"
-|align="left" | '''Components''' ||align="left"| '''453 BAP''' ||align="left"| '''453 Z34C'''||align="left"| '''587 Z34C'''||align="left"| '''587 KO Z34C'''||align="left"| '''587 KO Z34C SPACER'''
-|-
-| align="left" | Clone||align="left"|1.5 + 1.6 ||align="left"|11.5 + 11.6 ||align="left"|12.5 + 12.6  ||align="left"|13.5 + 13.6||align="left"| 14.5 + 14.6
-|-
-|}
-<br/>
-Incubation time: 1 h, Incubation temperature: 37°
-<br/>
-<b>Preparation of gel:</b><br/>
-g Agarose, 100 ml TAE (1%), 6 µl GELRED , at 115 Volt, running time: 45 minutes
-<br />
-<br/>
-[[File:3.9.10 AA.png|400px]]
-<br />
-<br/>
-<b>Expected fragment sizes /bp:</b> <br/>
-pSB1C3: 2051 bp<br/>
-BAP: ~150<br/>
-Z34C: ~ 200<br/>
-<br/>
-<p style="font-size:13px; color:#003399;"><b>Comment</b>: The following clones were sent for sequencing: 1.6, 12.6 ,13.6 and 14.5.<br/> To do: Retrafo of clone6.4 and clone9.4 and preparation of glycerol stocks. </p>
-====<p style="font-size:15px; background-color:#66bbff;"><b>Cloning of Cap into pAAV_RC_ins-rep: preparation for SDM</b></p>====
+<li>buffer used:4 ; Restriction-enzymes used: Enzyme NotI (no. Lab:159)
-<b>Investigator: Stefan </b>
+<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl
-<p style="font-size:13px; color:red;"><b>Comment</b>: Cloning Cap into pAAV still does not work as planned. As another approach Cap can be cut using BsiWI and XcmI and performing a SDM in the part of Cap not cloned into pAAV. Primers are ordered and should arrive on monday to proceed.</p>
-<br/>
-'''Digestion:'''
 {| border="1"
-| components   || align="right" |pMA_RepCap Vector_SDM_InsPvuII (P211) || align="right" |pAAV_RC_ins-rep (P250)
+| components   || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl
 |-
-| DNA  ||  align="right" |7,9 ||  align="right" | 2,1
+| DNA  ||  align="right" | 4.2||align="right"|3.5
 |-
-| Buffer 2 (10x)||  align="right" |2 ||  align="right" | 2
+| BSA (10x) ||  align="right" |3||align="right"|3
 |-
-|XcmI ||  align="right" |1 ||  align="right" |1
+| Buffer 4 (10x)||  align="right" |3||align="right"|3
 |-
-|BsiWI  ||  align="right" |1||  align="right" |1
+|Enzyme: NotI (no.Lab:159)||  align="right" |1,5||align="right"|1,5
 |-
-|H<sub>2</sub>O||  align="right" |8,1 ||  align="right" | 13,9
+|H2O||  align="right" |18,3||align="right"|19
 |-
-|'''Total volume '''||  align="right" |20||  align="right" | 20
+|'''Total volume'''||  align="right" |<b>30</b>||align="right"|<b>30</b>
 |}
-<br />
-<p style="font-size:13px; color:red;"><b>Comment</b>:Digestion was performed using two steps, first incubating for 1 hour at 37 °C, afterwards for 1,5 hours at 55 °C.</p><br />
-<br />
-'''Gel:''' <br />
+<li> Incubation: 1 1/2 h at 37°C
-,5 g Agarose,50 ml TAE (1%), 5 µl EtBr , at 115 Volt, running time: 50 minutes
-<br />
-<br />
-<br />
-<br />
-[[File:Freiburg10 pCerulean pMA pAAV.png|500px|]]
-<br />
-<br />
-<br />
-<br />
-<br />
-'''Gelextraction:'''<br />
-The gelextraction was performed according to the standard protocol. DNA concentration of the extracts:
-* pMA_RepCap Vector_SDM_InsPvuII (P211): c= 6,26 ng/µl
-* pAAV_RC_ins-rep (P250): c= 13,72 ng/µl
 <br>
-'''Quick Ligation:'''<br />
+% Agarose gel
-<p style="font-size:13px; color:red;"><b>Comment</b>: XcmI produces only 1 base overhang, therefore Quickligase was used for ligation and incubation time increased.</p>
+<br>
-The  Ligation was performed as following:<br />
+<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)
-* Vector Volume: 4,59 µl
-* Insert Volume: 4,41 µl
 <br>
-* 10 µl QuickLigase buffer (2x)
-* 9 µl (Vector + Insert) mix
-* 1 µl QuickLigase
-<br> Incubating for 60 minutes.
+<font color=#FF00FF>Results: unexpected sizes of fragments (see protocol), try again next day with an ethidium bromid gel</font>
 <br>
-'''Transformation:'''<br />
+<br>
+<br>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Production of chemical competent E.coli</b></p>====
-Trafo was performed according to the standard protocol (XL1b). The cells were plated on a agar plate with ampicilin.
+<p><b>Investigators: Patrick and Jessica</b></p>
+<br>
+competent E.coli XL-1-blue and competent E.coli BL21 produced according to the standard-protocoll [[Media:production of competent E.coli.pdf]]<br>
+<br>
 <br>
-===110. labday 04.09.2010===
-====<p style="font-size:15px; background-color:#66bbff;"><b>Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273): Sequencing results of P381 and P385</b></p>====
-Investigator:Patrick
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Design of MCS-Oligos</b></p>====
+<p><b>Investigators: Bea, Adrian, Hanna, Sven</b></p>
+<br>
+In order to replace the multiple cloning site of the pAAV_MCS vector from Stratagene by RFC25, two oligos were designed. After their hybridization the overhangs correspond to ClaI- and BglII restriction sites. A digestion with BglII and ClaI will be performed with pAAV-MCS and then will be ligated with the designed oligos.<br>
+The oligos (see link) were ordered at Sigma-Aldrich. Estimated shipment: 31.05.2010 .<br>
-Sequencing results of P381 & P385 Labelling: P381-CMV_rev & P385-CMV_rev:
-A wrong primer was used so there are no relevant sequence data yet.
-On sunday i will sent these clones again for sequencing. Primer: GATC_std_CMV-F
-[[Image:Freiburg10_Kopfkratzen.gif|thumb|400px|Ha ich war schneller als Bea beim "Kopfkratzen-setzen" *lol*]]
+[[File:Freiburg10 Oligos MCS RFC25 for pAAV.pdf]]
-'''Hiermit verspreche ich dass es noch jede Menge Kopfkratzer, Laboraufsichtswichtel und pinke Panter geben wird (Patrick)'''
+===15. Labortag 26.05.2010===
-<br><br><br><br>
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Oligos (PstI + MCS)</b></p>====
-<br><br><br><br>
-====<p style="font-size:15px; background-color:#66bbff;"><b>Harvest viral particles, Transduction</b></p>====
+<p><b>Investigators: Bea, Hanna, Jessica</b></p>
-<b> Investigator:Kerstin, Adrian </b>
+<ul>
+<li>Repeat cloning of pAAV-MCS + pCMV_mVenus_YFP --> <b>Goal: pAAV_mVenus_YFP</b><br>
-*Harvest viral paricles from one plate of transfection from 01.09.2010 (10 plates, same treatment (10µg of each plasmid P357, P263, P356))
-*Transduction:
-#  1x 6-well: 0,5ml of virus from 01.09.2010 (testing R/C P326)
-#  1x 6-well: 0,5ml of virus from 01.09.2010 (testing R/C P325)
-#  4x 6-well: 10x 0,5ml and 4x 1ml of virus from 01.09.2010 (stratagene R/C)
-#  4x 6-well: 10x 0,5ml and 4x 1ml of virus from 04.09.2010 (10 plates same treatment)
-#  6x 6-well: 0,5ml of virus from 21.08.2010 (TKGMK; 18x pH 7,10 and 6x pH 7,12)
-====<p style="font-size:15px; background-color:#66bbff;"><b>Repetition of Hybridisation and Cloning for Loop insertion BioBricks</b></p>====
+Cloning did not work (see lab day 25.05.2010) either with NotI or with NotI-HF. Gel did not show any proper band at the expected size. <br>
+ There will be used EtBr instead of gelred in the agarose gel and the incubation time of digestion will be prolonged. Further details are followed. <br>
-<b>Investigator: Achim, Anna<br /></b>
+NOTE: There are three restriction sites of NotI in the pCMV-mVenus_YFP. If cloning with NotI, the polyA hGH signal will be deleted. therefore cloning with NotI is '''not''' possible .
-*Samples:
-: 453_BAP
 <br>
-: 453_Z34C<br>
-: 587_Z34C<br>
-: 587_KO_Z34C<br>
-: 587_KO_Z34C_Spacer<br>
 <br>
-<p style="font-size:13px; color:#003399;"><b>Comment</b>: New approaches of the Hybridisation and Fill-in reactions were done because it didn't work the first time. A possible reason is that the klenow enzyme wasn't inactivated. In addition, the conditions for ligation will be improved. Also the ligation of 453_BAP was done again.</p>
+<li>Test digestion of pCMV-mVenusYFP with PstI and MluI <br>
-<b>Digestion:</b>
+<b>Digestion</b>
 <br>
+<ul>
+<li>experiment date: 26.05.2010 </li>
+<li>plasmid: pCMV_mVenus_YFP; number: P5; production date: 21.05.2010/ pCMV-MSC; number: P2; production date:  </li>
+<li>buffer used: 3/4; Restriction-enzymes used: Enzyme PstI (no. Lab:48) and Enyzme MluI (no. Lab:40) / NotI HF (no. Lab:159) </li>
+<li>DNA concentration plasmid: P5 477,3 ng/µl / P2 550ng/µl </li>
 {| border="1"
-| components ||Volume Vector 587  ||Volume Vector 453 || Sample 11  || Sample 12 || Sample 13 || Sample 14
+| components   || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl
 |-
-| DNA  || 3,7 || 3,7|| 6 || 6 || 6 || 6
+| DNA  ||  align="right" | 4,2||align="right"|3,6
 |-
-| BSA (10x) ||-|| -|| -|| -|| -|| -
+| BSA (10x) ||  align="right" |2||align="right"|2
 |-
-| Buffer 4 (10x) ||2|| 2 || 2|| 2|| 2|| 2
+| Buffer 3 (10x)||  align="right" |2||align="right"|2
 |-
-|Enzyme 1° ||Bam || Ssp || Ssp || Bam || Bam || Bam
+|Enzyme: PstI/NotI HF (no.Lab:48/159)||  align="right" |1||align="right"|2
 |-
-|Enzyme 2° ||Pvu|| Sal|| Sal || Pvu || Pvu || Pvu
+|Enzyme: MluI (no.Lab:40)||  align="right" |1||align="right"|-
 |-
-|H2O || 12,3 || 12,3 || 10 || 10 || 10 || 10
+|H2O||  align="right" |9,8||align="right"|10,4
 |-
-|'''Total volume /µl'''||20
+|'''Total volume'''||  align="right" |<b>20</b>||align="right"|<b>20</b>
 |}
-<br />
+<br>
+<li> Incubation: 1 h at 37°C
-° 1 µl each
+<br>
+% Agarose gel
+<br>
+<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)
+<br>
+Results: Test digestion of pCMV_MCS with NotI delivered plausibel results (expected fragment size: ~ 27 kbp and 17 kbp).
+Unfortunately the digestion of pCMV_mVenus_YFP with PstI and MluI resulted in one 2.9 kbp and one 1.2 kbp fragment, which didn't correspond to the expected fragment sizes of 19 kbp and 33 kbp - but to fragment sizes of pCMV_MCS without mVenus_YFP!
+<br>
+<br>
+<br>
+<li>'''Ordering oligos:'''(Sigma-Aldrich) <br>
+(Bea)<br>
+Oligos have been ordered for modifying the ITRs. Deletion of PstI restriction site in ITR. <br>
-<b>Preparation of gel:</b><br/>
+<br>
-g Agarose, 100 ml TAE (1%), 6 µl GELRED , at 115 Volt, running time: 50 minutes
+'''right ITR of pAAV_MCS''' <br>
-====<p style="font-size:15px; background-color:#66bbff;"><b>Repetition: Prepatation for SDM: cloning of Cap into pAAV</b></p>====
+oligos ordered:<br>
-Investigator: Stefan
+fwd:	5´- gcgcagctgcctgcaCGGGCGCCTGATGCGG -3´ 77 °C, 31 bp <br>
+rev:    5´- CCGCATCAGGCGCCCGTGCAGGCAGCTGCGC -3´ <br>
+<br>
-[[Image:Freiburg10_Kopfkratzen.gif|thumb|right|Schönen Abend dir noch]]
+'''leftITR of pAAV_MCS'''<br>
-<p style="font-size:13px; color:red;"><b>Comment</b>: On yesterday's plates nothing grew. Because gelex and ligation products were stored in coldroom, new ligation and trafo approaches were performed. </p>
+oligos ordered:<br>
-<br/>
+fwd:	5´- CCTTTTGCTCACATGTCGTGCAGGCAGCTGCGCG -3´ 74 °C, 34 bp <br>
+rev:	5´- CGCGCAGCTGCCTGCACGACATGTGAGCAAAAGG -3´<br>
+<br>
+For further details see link <br>
-<br />
+http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/4/44/Freiburg10_Oligos_ITR_mutagenesis_for_pAAV_delete_PstI.pdf
-'''Ligation approaches:'''<br />
+</li>
-* ligation with Quick Ligase (as performed yesterday)
+<br>
-* ligation with T4 Ligase
-<br />
-<br />
-'''Transformation approaches:'''<br />
-* Quick Ligase (approach from yesterday):
-** 2 µl of ligation product
-** 4 µl of ligation product<br />
-<br />
-* Quick Ligase (new approach):
-** 2 µl of ligation product
-** 4 µl of ligation product<br />
-<br />
-* T4 Ligase:
-** 2 µl of ligation product
-** 4 µl of ligation product<br />
-<br />
-'''Transformation:'''<br />
-Trafo of each approach was performed according to the standard protocol (XL1b). The cells were plated on a agar plate with ampicilin.
+'''Test-Trafo of chemical competent E.coli cells''' <br>
+(Hanna)
 <br>
+The competent E.coli XL-1-blue and competent E.coli BL21 which were prepared the day before were test-transformed with pUC18 - following the standard protocol. Cells were plated on agar plates containing ampicillin and stored over night at 37°C.
+Further on two control plates containing ampicillin or kanamycin were prepared. Non-transformed cells were plated on them and also stored over night at 37°C.
+<br>
+<br>
+</ul>
+</ul>
+===16. Labortag 27.05.2010===
-====<p style="font-size:15px; background-color:#66bbff;"><b>Ligation and trafo of the modified Cap insert , the Viral Bricks 1, 11, 12, 13 and 14</b></p>====
+====<p style="font-size:15px; background-color:#66bbFF;"><b>Cell counting</b></p>====
-<b>Investigator: Volker<br /></b>
+<p><b>Investigator: Patrick, Adrian, Chris W. Christian L.</b></p>
+* Meeting
-<p style="font-size:15px; font-weight: bold; color: blue;">Ligation</p>
+cell counting:
-<br />
+<br>
-{| border="1"
+* BL21 + PUC18 Trafo 54*4 = 216
+* XL1B + PUC18 Trafo 30*4 = 120
-|'''Construct'''
+digitalization of recipe-cards (Christian L.)
-|'''Vector (µl)'''
+<br>
-|'''Insert(µl)'''
-|-
-|'''ViralBrick 1 in 453'''
-| 7.91
-| 0.09
-|-
-|'''ViralBrick 11 in 453'''
-| 6.17
-| 1.83
-|-
-|'''ViralBrick 12 in 587'''
-| 6.15
-| 1.85
-|-
-|'''ViralBrick 13 in 587'''
-| 5.3
-| 2.7
-|-
-|'''ViralBrick 14 in 587'''
-| 4.46
-| 3.54
-|-
-|'''p211 in pAAV-RC'''
-| 5.52
-| 3.54
-|-
-|'''p211 in pAAV-RC'''
-| 5.52
-| 3.54
-|-
-|}
-<br />
-====<p style="font-size:15px; background-color:#66bbff;"><b>Preparation of PBS Buffer</b></p>====
-Investigator: Volker
-Two liters of PBS buffer were prepared for the column purification of the viral particles. The following protocol was used:
+===17. Labortag 31.05.2010===
-*dissolve the following in 800ml ddH<sub>2</sub>O:
-**8g of NaCl
-**0.2g of KCl
-**1.44g of Na<sub>2</sub>HP0<sub>$</sub> (1.69 because of the crystal water in the reagent)
-**0.24 g of KH<sub>2</sub>PO<sub>4</sub>
-*adjust to pH 7.4
-*adjust to 1000ml
-*steril filtrate the solution
-===111. labday 05.09.2010===
+====<p style="font-size:15px; background-color:#66bbFF;"><b>pAAV_RC R585A and R588A transistions</b></p>====
-====<p style="font-size:15px; background-color:#66bbff;"><b>Mini-prep of glycerol stock pMA_RepCap Vector_SDM_InsPvuII clone 1 (B182)</b></p>====
-<b>Investigator: Stefan<br /></b>
-<br />
-Glycerol stock: Because glycerol stock B182 was not mixed before putting into -80 °C freezer the cells died. Therefore a new glycerol stock was prepared and labled B302.
-Mini-Prep was performed according to the standard protocol. Two preps were prepared:
-<br />
-<li>P363 = pMA_RepCap Vector_SDM_InsPvuII clone 1 (1) = 215,6 ng/µl
-<li>P364 = pMA_RepCap Vector_SDM_InsPvuII clone 1 (2) = 230,5 ng/µl
-<br />
-====<p style="font-size:15px; background-color:#ff00ff;"><b>Picking clones of pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker</b></p>====
+In order to alter the tropism of AAV2 several modifications have to be performed.
-<b>Investigator: Hanna<br /></b>
+First of all the binding to Heparan Sulfate Proteoglycan has to be disrupted. This can be done by R585A and R588A transistions:
-<br/>
+[[File:Freiburg10 R585A R588A.jpg|800px|]]
-clones of each construct (1. pCerulean_Zegfr:1907_ShortLinker, 2. pCerulean_Zegfr:1907_MiddleLinker, 3. pCerulean_Zegfr:1907_LongLinker, 4. pCerulean_Zegfr:1907_SEG and 5. pCerulean_CFP_MiddleLinker) were picked.
-<br/>
-<br/>
-<b>To do tomorrow (6.9.):</b> Mini-Preps and Test digestion (with EcoRI and PstI).
-===112. labday 06.09.2010===
-====<p style="font-size:15px; background-color:#66bbff;"><b>Production of Ampicilin and Chloramphenicol</b></p>====
-<b>Investigator: Jessica<br /></b>
-<br />
-* 10ml ethanol (70%) containing 1g Amp in 60µl aliquots
-* 10ml ethanol (70%) containing 0,25g Cm in 60 µl aliquots
 <html>
 </div>
 </html>