Team:Freiburg Bioware/testpage

From 2010.igem.org

(Difference between revisions)
Line 122: Line 122:
<div class="box_right">
<div class="box_right">
</html>
</html>
-
==Juli==
+
-
===46.Labortag 01.07.2010===
+
==Archiv==
 +
*[[März 2010]]
 +
*[[April 2010]]
 +
*[[Mai 2010]]
 +
*[[Juni 2010]]
 +
*[[Juli 2010]]
 +
*[[August 2010]]
 +
*[[September 2010]]
 +
*[[Oktober 2010]]
 +
*[[November 2010]]
 +
*[[Dezember 2010]]
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>qPCR</b></p>====
+
==== 18. Labortag 01.06.2010:  Modifying MCS of pAAV_MCS vector====
-
 
+
-
<p><b>Investigators: Hanna, Chris W. (guided by Sven)</b></p><br>
+
-
 
+
-
Protocol will be inserted :)
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Thawing HT1080 cells</b></p>====
+
-
 
+
-
<p><b>Investigators: Adrian, Bea, Patrick</b></p><br>
+
-
 
+
-
<ul>
+
-
<li>HT1080 cells were thawd following standard protocols</li>
+
-
<li>HT1080 passage 3</li>
+
-
<li>Incubation at 37°C</li>
+
-
</ul>
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Investigation of the Kleinschmidt sequencing</b></p>====
+
-
 
+
-
<p><b>Investigator: Volker</b></p><br>
+
-
 
+
-
The sequence data from VM_2_30.06.-CMV-F and VM_3_30.06.-CMV-F arrived and showed as expected a homologous region with the ORFs of the corresponding VPs.<br>
+
-
 
+
-
The process of VPex1, VPex2 and VPex3 sequencing is nearly finished. For further progress the oligos that prime at different locations in the Rap/Cap ORFs are required.
+
-
The actual progress of the sequencing is shown in the image on the right side:
+
-
 
+
-
*For the sequencing of VPex1 and VPex2 one further read will be required to achieve a continuous contig.
+
-
*The sequencing of VPex3 is completed but contains two point mutations.
+
-
 
+
-
The investigation of the point mutations revealed that the:
+
-
*first mutation (TAC=>TAT) is silent and codes for Tyrosine. The original codon TAC has a codon usage of 58% in Homo sapiens and 25% in E. coli where as the new codon TAT has a codon usage of 42% in H. sapiens and 75% in E. coli. There for this mutation could be an optimisation of the sequence for an approach to express the VP in E.coli.
+
-
*second mutation (CCG=>CCA) is silent and codes for Proline. The original codon CCG has a codon usage of 11% in H. sapiens and 77% in E.coli weher as the new codon CCA has a codon usage of 27% in H. sapiens and 15%. This mutation would lead to an optimiced expression in human cells.
+
-
Therefor the combination of these two "optimized" codon does not make any sense in this combination.
+
-
 
+
-
  <br><br><br><br><br><br>
+
-
 
+
-
[[File:Freiburg_Progress in the VPex seq.png|1200px|Progess of the sequencing of the VPex constructs provided by PD Dr. Kleinschmidt (DKFZ)]]
+
-
 
+
-
===47.Labortag 02.07.2010===
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Fluoroscence Pictures of Transduction 3</b></p>====
+
-
 
+
-
<p><b>Investigators: Chris W, Patrick</b></p><br>
+
-
 
+
-
total celldeath! <br>
+
-
Looks like we should not transduce 3x10^5 cells with 1000 µl (or more) of our viral solution because almost all cells died in all approaches and the medium indicator was yellow.
+
-
So we can not say if resuspendig the cells with the viral soultion is a useful alteration of the standart protocol.
+
<br>
<br>
-
<p style="font-size:12px; font-weight: bold; color: red;">@Chris and Patrick: The cells which has not been resuspended died aswell??  yes (Patrick) ... so u think the volume (1000µL) of the viral stock solution  is too high and cell death is not caused by the "rough" reuspension?  yes (Patrick)  ... Could u maybe upload some pictures even though it did not work, but to documentate it properly!! thx Bea ... No, already thrown away and we could not take good pictures because of very thick bunches of dead cells, results confirmed by Sven (Patrick)  </p> <br>
+
Investigators: Anissa, Adrian, Bea, Chris W., Hanna, Patrick, Volker, Sven <br>
-
 
+
'''Oligos received from Sigma-Aldrich''' <br>
-
[[Media:Freiburg10 Massacre.jpg]]
+
(right ITR of pAAV_MCS, left ITR of pAAV_MCS and MCS RFC25 for pAAV)
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Seeding and Splitting HEK</b></p>====
+
-
 
+
-
<p><b>Investigators: Johannes, Kira, Patrick, Chris W</b></p><br>
+
-
 
+
-
 
+
-
* 4 Petri dishes (each 10ml DMEM, 1,5*10^6 cells) and one 75 cell culture bottle (20ml DMEM, 1,5*10^6 cells). The cell density was not sufficient so we could not seed 3x10^6 in the 10 cm dishes as planed initially.
+
-
* New DMEM Medium was made (10% FCS,). We received a Sodium-Pyruvat stock solution (100x).
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>New ologos/primers arrived</b></p>====
+
-
 
+
-
<p><b>Investigator: Patrick</b></p><br>
+
-
 
+
-
ST00147058: long pITR right for, labeled with number 31 <br>
+
-
ST00147059: long pITR right rev, labeled with number 32 <br>
+
-
ST00147606: long pITR left for, labeled with number 33 <br>
+
-
ST00147061: long pITR lef rev, labeled with number 34 <br>
+
-
 
+
-
An additional 1:10 working dilution was made with each oligo.
+
-
 
+
-
<p style="font-size:12px; font-weight: bold; color: red;"> @ Achim: plz write it down into our oligo excel sheet. </p>
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Annotation of the 453 insertion site</b></p>====
+
-
[[File:Freiburg_The 453 integration site.png|1200px|right|thumb|The integration site between G453 and T454]]
+
-
<p><b>Investigators: Patrick & Volker</b></p><br>
+
-
 
+
-
The 453 insertion site is acoording to [Boucas et al., 2009] a promising alternative to the 585/588 integration site.
+
-
The Peptides were integrated between the 453 Glycine and the 454 Threonine. This risidues were annotated in the gene maps (Genious) and visualized in the 3D structure (PyMOL).
+
-
<br><br>infos from the paper<br><br>
+
-
<br><br>infos from the paper<br><br>
+
-
<br><br>infos from the paper<br><br>
+
-
<br><br>infos from the paper<br><br>
+
-
 
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Searching new restriction sites in the 585/588 WT loop</b></p>====
+
-
 
+
-
<p><b>Investigator: Volker</b></p><br>
+
-
 
+
-
The sequence of the major site for peptide integration into the capsid proteins was extracted from the viral sequence and pasted into the program [https://www.dna20.com/ DNA 2.0]. In an first atempt the 4 amino acids that form the loop (5' - RGNR - 3') were used with the two flanking amino acids from the wild type sequence on each side.
+
-
The goal of this theoretical investigation is to use alternative codons to insert restriction sites into the wild type loop to make later cloning easier.
+
-
This was repeated in an second atempt with five flanking amino acids but did not reveal additional useful restriction sites.
+
-
 
+
-
Informations for the restriction enzymes were looked up in the [http://www.neb.com/nebecomm/products/category1.asp?#2 NEB Product catalogue].
+
-
 
+
-
[[File:Freiburg_Search for restriction sites in the 585_588 loop WT sequence.png|1100px|right|thumb|Search for restriction sites in the 585/588 WT loop  sequence]]
+
-
 
+
-
The three restriction sites are:
+
-
 
+
-
'''BbvI restriction site:'''
+
-
Recognized sequence:<br>
+
-
5'- GCAGC(N)8^ -3'<br>
+
-
3'- CGTCG(N)12^ -3'<br>
+
-
Sites found in pAAV_RC at position:<br>
+
-
* 17 times in the ORFs of Rep & Cap => can't be used
+
-
 
+
-
'''BstEII restriction site:'''
+
-
Recognized sequence: <br>
+
-
5'- G^GTNACC -3'<br>
+
-
3'- CCANTG^G -5'<br>
+
-
* There is only one BstEII restriction site in the vector that we want to use to insert the fragment (x-x)
+
-
* The cutting site could be removed => theoretically useful restriction site.
+
-
* Location fits nearly perfect because peptids ae usually integrated before the R585.
+
-
 
+
-
 
+
-
'''PstI restriction site'''
+
-
Recognized sequence:<br>
+
-
5'- CTGC^AG -3'<br>
+
-
3'- G^ACGTC -5'<br>
+
-
*PStI is part of the iGEM standard and can't be used for this purpose.
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Searching new restriction sites in the 585/588 KO loop</b></p>====
+
-
[[File:Freiburg_Search for restriction sites in the 585_588 KO loop sequence.png|400px|right|thumb|Search for restriction sites in the 585/588 KO loop  sequence]]
+
-
<p><b>Investigator: Volker</b></p><br>
+
-
 
+
-
'''PstI restriction site'''
+
-
Recognized sequence:<br>
+
-
5'- CTGC^AG -3'<br>
+
-
3'- G^ACGTC -5'<br>
+
-
*PStI is part of the iGEM standard and can't be used for this purpose.
+
-
 
+
-
Summary: There is no codon combination availible to encode the promising BstEII restriction site in this R585A_R588A_KO sequence.<br>
+
-
 
+
-
<br><br>
+
-
<br><br>
+
-
<br><br>
+
-
<br><br>
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Searching new restriction sites in the 453 loop</b></p>====
+
-
[[File:Freiburg_Search for restriction sites in the 453 loop sequence.png|800px|right|thumb|Search for restriction sites in the 453 loop  sequence]]
+
-
<p><b>Investigator: Volker</b></p><br>
+
-
 
+
-
'''KpnI restriction site'''
+
-
Recognized sequence:<br>
+
-
5'- GGTAC^C -3'<br>
+
-
3'- C^CATGG -5'<br>
+
-
Sites found in pAAV_RC at position:<br>
+
-
*1721 and 3973
+
-
*first restriction site could be replace without problem becauce it lies in the region that will be synthesized to replace the three iGEM restriction sites in the Rep ORF.
+
-
*Restriction site is potentially useful
+
-
 
+
-
'''AvaI restriction site'''
+
-
Recognized sequence:<br>
+
-
5'- C^YCGRG -3'<br>
+
-
3'- GRGCY^C -5'<br>
+
-
Sites found in pAAV_RC at position:<br>
+
-
* six times in the ORFs of Rep and Cap => can't be used
+
-
 
+
-
'''DraIII restriction site'''
+
-
Recognized sequence:<br>
+
-
5'- TTT^AAA -3'<br>
+
-
3'- AAA^TTT -5'<br>
+
-
Sites found in pAAV_RC at position:<br>
+
-
*1181 (Rep ORF)
+
-
*2893 (Cap ORF)
+
-
*4463 (short after the Cap ORF)
+
-
*4930 (f1 ORI)
+
-
 
+
-
 
+
-
'''AvaII restriction site'''
+
-
Recognized sequence:<br>
+
-
5'- G^GWCC -3'<br>
+
-
3'- CCWG^G -5'<br>
+
-
Sites found in pAAV_RC at position:<br>
+
-
* eight times in the ORFs of Rep and Cap => can't be used
+
-
 
+
-
Summary:
+
-
The KpnI restriction site seems to be a good possibility to make the 453 insertion site ready for easy integration of peptides.<br>
+
-
Especially the position where the cut is performed is ideal for our purpose because peptides are usually integrated after the Glycine 453 as described for example in [Boucas et al.; 2009].
+
-
 
+
-
===48.Labortag 03.07.2010===
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Planing the gene synthesis to replace the three restriction sites in the rep ORF</b></p>====
+
-
 
+
-
<p><b>Investigator: Volker</b></p>
+
-
 
+
-
The construct pAAV_RC that we have bougth from Stratagene will be a central part of our Virus construction kit and therefor it has to be cleared from restriction sites that are used in the iGEM-standard. <br>
+
-
There are five iGEM restriction sites in the pAAV-RC:<br>
+
-
*PstI at position (310)
+
-
*EcoRI at position (1578)
+
-
*PstI at position (1773)
+
-
*EcoRI at position (1796)
+
-
*PstI at position (4073)
+
-
 
+
-
The relative location to each other and other planed modifications in this sequence make it reasonable to replace the PstI (310) and PStI (4073) with site directed mutagenesis and to order a synthesis of the region with the three other restriction sites.<br>
+
-
 
+
-
The primers for the site directed mutagenesis were designed:<br>
+
-
 
+
-
'''Designed Primer: SDM PstI (310)'''<br>
+
-
 
+
-
*PstI at position (310)<br>
+
-
**Recognized sequence: 5'- CTGC^AG -3'<br>
+
-
**The codon 5'- CTG - 3' will be replaced by 5'- CTC -3'<br>
+
-
**Both codons encode Leucine. The condon usage in ''H. sapiens'' decreases from 36% to 20%  <br>
+
-
 
+
-
5'- CTGACCGTGGCCGAGAAGCT'''C'''CAGCGCGACTTTCTGACGGA - 3'<br>
+
-
 
+
-
 
+
-
'''Designed Primer: SDM PstI (4073)'''<br>
+
-
 
+
-
**Recognized sequence: 5'- CTGC^AG -3'<br>
+
-
**The codon 5'- CTG - 3' will be replaced by 5'- CTC -3'<br>
+
-
**Both codons encode Leucine. The condon usage in ''H. sapiens'' decreases from 36% to 20%  <br>
+
-
 
+
-
5'- CGTGGAGATCGAGTGGGAGCT'''C'''CAGAAGGAAAACAGCAAACGCTGG -3'<br>
+
-
 
+
-
[[File:Freiburg_RFC 25 restriction sites in the rep ORF.png|1100px|right|thumb|Restriction sites of the RFC25 standard located in the Rep ORF shown in dark blue and single cuting restriction endunucleases shown in light blue ]]
+
-
 
+
-
The region with the three restriction sites that are located near to each other is show in the picture above. The restriction sites indicated in light blue are single cutters and can therefor be use to clone the synthesized fragment into the original sequence of pAAV-RC.<br>
+
-
For this purpose the restriction sites BstBI (1435) and SwaI (2004) will be used because they are availible in the lab stock and have 100% fidelity in one of the NEB buffers.<br>
+
-
The required construct with four flanking base pairs on each side will be 583 bp long.<br>
+
-
 
+
-
 
+
-
*EcoRI at position (1578)<br>
+
-
**Recognized sequence: 5'- G^AATTC -3'<br>
+
-
**The codon 5'- GAA -3' will be replaced by 5'- GAG -3'<br>
+
-
**Both codons encode Glutamic acid. The codon usage in ''H.sapiens'' increases from 41% to 59%. <br>
+
-
 
+
-
*PstI at position (1773)<br>
+
-
**Recognized sequence: 5'- CTGC^AG -3'<br>
+
-
**The codon 5'- TGC - 3' will be replaced by 5'- TGT -3'<br>
+
-
**Both codons encode Cysteine. The condon usage in ''H. sapiens'' decreases from 58% to 42%  <br>
+
-
 
+
-
*EcoRI at position (1796)
+
-
**Recognized sequence: 5'- G^AATTC -3'<br>
+
-
**The codon 5'- AAT -3' will be replaced by 5'- AAC -3'<br>
+
-
**Both codons encode for Asparagine. The codon usage in ''H. sapiens'' increases from 44% to 56%.<br>
+
-
 
+
-
This are all the restriction sites in the ORFs for the Rep and Cap proteins. In the backbone of the pAAV_RC there are more restriction sites in the iGEM standard. These restriction sites should not cause any problems when the insert in cloned into a standard iGEM vector.
+
-
An other interesting question is what has been changed in the regulatory region p5. This will be important to determine the sequence that is required for the functional expression of the pAAV-RC.
+
-
 
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Modification of the Cap genes</b></p>====
+
-
 
+
-
<p><b>Investigator: Volker</b></p>
+
-
 
+
-
The HSPG-binding-motif can be knocked out by the two mutations R585A and R588A.
+
-
 
+
-
The sequence 5'-CTC CAG AGA GGC AAC AGA CAA -3' codes in the pAAV-RC construct for the amino acids LQRGNRQ.<br>
+
-
In order to achieve the recommanded mutation the sequence has to be changed to: 5'-CTC CAG GCT GGC AAC GCT CAA -3'<br> which codes for LQAGNAQ.<br>
+
-
 
+
-
The problem is that in this R585A R588A KO version there is no possible codon usage to encode a BstEII restriction site that would make it possible to integrate peptides in an easy fashion.<br>
+
-
An R585A R588L KO version would contain the BstEII restriction site and could be a possible alternative to the R585A R588A KO version.
+
-
 
+
-
Questions to adress on monday:
+
-
*Is the proposed R585A_R588L_KO mutation possible?
+
-
*Are iGEM standard vectors availible that do not contain KpnI and BstEII?
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cellculture</b></p>====
+
-
 
+
-
<p><b>Investigators: Patrick, Chris W.</b></p>
+
-
 
+
-
HT1080 cells were split.
+
-
Deviations from the standart protocol: The cells were centrifuged with 2000 G instead of 200 G. Then the cells were put into the incubator for 4 hours and then examined again. It seems that most of them survived this mistake.
+
-
 
+
-
The 293 cells were checked for cell density. They will be >70% confluent tomorrow and therefore transfected.
+
-
 
+
-
===49.Labortag 04.07.2010: Transfection nr.3===
+
-
 
+
-
Investigators: Chris W, Patrick
+
-
 
+
-
Transfektion with P41 was performed according standart protocol.
+
-
Two transfektions where carried out with 10µg (3,33 µg each plasmid) DNA and the other two with 20µg DNA (6,66 µg each plasmid).
+
-
 
+
-
===50.Labortag 05.07.2010:Repetition of ITR restriction site modification via PC, Splitting HT and HEK cells, Preparation of HT1080 3x6er dishes for Transduction, Preparation of 6x10cm  cellculture dishes HEK293 ===
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of pAAV_iGEM-mVenus-YFP</u></p>
+
-
Hanna <br>
+
-
Alignment of sequenced hGH region with pAAV_iGEM_mVenus-YFP delivered following picture:<br>
+
-
[[File:Freiburg10 hGHsequencing.JPG|900px|]] <br>
+
-
There seemed to be a nucleotide insertion. But by having a closer look, we recognized that Geneious mis-interpreted the signal at this point. Further on we could validate that YFP was also successfully cloned into this clone. Unfortunately the sequencing of the gene of interest didn't work - neither with the forward, nor with the reverse primer. Their sequences were checked on the order form: Everything OK! <br>
+
-
'''To do: Repeat sequencing of GOI!'''
+
<br>
<br>
-
 
+
*Hybrization of received oligos: MCS RFC25 for pAAV (forward) and MCS RFC25 for pAAV (reverse)
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Dirty and fancy method for ITR BioBrick production</u></p>
+
*Centrifuge tubes prior to open tubes (13.000 rpm, 30 sec)
-
Hanna <br>
+
**MCS RFC25 for pAAV (forward): Add 92µL Millipore H<sub>2</sub>O (Volume on obtained sheet)
-
A new strategy for ITR BioBrick production was figured out. This method does NOT require any PCR steps! :) <br>
+
**MCS RFC25 for pAAV (reverse): Add 394 µL Millipore H<sub>2</sub>O (Volume on obtained sheet)
-
We want to take advantage of the fact, that the ITRs are flanked by NotI and PstI. <br>
+
*Vortex the resuspended DNA
-
"Short version" of the strategy: <br>
+
*Make aliquots of both Oligos (1:10): 10 µL Oligo + 90 µLH<sub>2</sub>O (final volume usually 100 µl)
-
* Digestion of pAAV_MCS with AlwNI. Result: one large fragment (2982 bp) with right ITR; one small fragment (1674 bp) with left ITR.
+
*Mix together(into PCR-tube):
-
* Separate fragments via gel run.
+
-
* Digest them with NotI and PstI.
+
-
* Präfix and suffix oligos were designed. They need to be hybridized and ligated to the left and right ITR with several intermediate steps (subcloning into pSB1C3 etc.). The oligos posess compatible overhangs to the PstI and NotI restriction sites of the ITR but do not generate new restriction sites after ligation!
+
-
* For detailed instruction, check up here: [[File:Freiburg10 ITRBioBrick dirty fancy.pdf]]
+
<br>
<br>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Beta-globin BioBrick production:</u></p>
 
-
Hanna <br>
 
-
The beta-globin sequence (pAAV_MCS) contains no iGEM-restriction sites. Therefore we decided NOT to order the sequence, but to perform a PCR with RFC10 overhang primers: <br>
 
-
[[File:Freiburg10 beta-globin for.JPG|600px|]] <br>
 
-
[[File:Freiburg10 beta-globin rev.JPG|600px|]] <br>
 
-
<br>
 
-
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>hGH BioBrick production:</u></p>
 
-
Hanna <br>
 
-
The hGH sequence (pAAV_MCS) contains no iGEM-restriction sites. Therefore we decided NOT to order the sequence, but to perform a PCR with RFC10 overhang primers: <br>
 
-
[[File:Freiburg10_hGH_for.JPG|600px|]] <br>
 
-
[[File:Freiburg10_hGH_for.JPG|600px|]] <br>
 
-
<br>
 
-
 
-
====Splitting HT and HEK cells====
 
-
 
-
*Investigators: Adrian, Bea
 
-
*HEK Cells: over 100% confluent!!!
 
-
*HT-cells: over 90%  confluent!!!
 
-
 
-
====Preparation of HT1080 3x6er dishes for Transduction====
 
-
*Investigators: Adrian, Bea
 
-
* 3x 6well dishes got prepared with 3ml DMEM and 300.000 cells (0,0375ml of our Cell-falcon)
 
-
* Transduction on 6.7.2010
 
-
 
-
====Preparation of 6x10cm  petri dishes HEK293====
 
-
* Investigator: Adrian
 
-
* 6x 10cm petri dishes with 10ml with 3.000.000 cells (0,344ml of cell-falcon)
 
-
* Transfection on 7.7.2010
 
-
 
-
==== '''Repetition of ITR restriction site modification via PCR''' ====
 
-
 
-
<li> experiment date: 5.7.2010
 
-
<li> name of investigator: Achim, Chris
 
-
*Because the previous attempt to replace the PSTI and NOTI restriction sites in the ITRs with the IGEM standard were unsucessful, new, longer primers were designed an ordered.
 
-
*a new pcr reaction with higher annealing temperatures was prepared:
 
-
 
-
<br>
 
{| border="1"
{| border="1"
-
| components  || align="right" |v(pAAV_fragment left ITR, 0% DMSO) /µl || align="right" |v(pAAV_fragment left ITR, 10% DMSO) /µl|| align="right" |v(pAAV_fragment right ITR, 0% DMSO) /µl || align="right" |v(pAAV_fragment right ITR, 10% DMSO) /µl||align="right"|positive control from Gerrit: XBL PMA DBSA (106 bp)
+
| align="right" | '''Volume/µL''' ||align="right"| '''solution'''
-
|-
+
-
| 10xThermoPol buffer||  align="right" | 5||  align="right" | 5||  align="right" | 5||  align="right" | 5||  align="right" | 5
+
-
|-
+
-
| dNTP mix ||  align="right" |1 ||  align="right" |1 ||  align="right" |1 ||  align="right" |1 ||  align="right" |1
+
-
|-
+
-
| Primer for||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5
+
-
|-
+
-
| Primer rev||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5
+
-
|-
+
-
|DNA Template||  align="right" | 0,513 ||  align="right" | 0,513||  align="right" | 0,415||  align="right" | 0,415|| align="right" | 0,345
+
|-
|-
-
|MgSO4||  align="right" | 1|| align="right" | 1||  align="right" | 1||  align="right" | 1||  align="right" | 1
+
|  align="right" | 10 (1:10)||align="right"|Oligo 1: MCS RFC25 for pAAV (forward)
|-
|-
-
|DMSO||  align="right" | 0|| align="right" | 5||  align="right" | 0||  align="right" | 5||  align="right" | 0
+
|  align="right" |10||align="right"|Oligo 2: MCS RFC25 for pAAV (reverse)
|-
|-
-
|Vent Polymerase||  align="right" | 0,5|| align="right" | 0,5||  align="right" | 0,5||  align="right" | 0,5||  align="right" | 0,5
+
|  align="right" |4||align="right"| 100mM TrisHCl pH8
|-
|-
-
|H2O||  align="right" | 38,99|| align="right" | 33,99||  align="right" | 39,09||  align="right" | 34,09||  align="right" | 39,16
+
|  align="right" |8||align="right"|5mM MgCl2
|-
|-
-
|Volume total||  align="right" | 50|| align="right" | 50||  align="right" | 50||  align="right" | 50||  align="right" | 50
+
|  align="right" |8||align="right"| H20
|}
|}
<br>
<br>
-
PCR program:
+
* Program: ORIGAMI 1 modified for long oligos:
 +
** 1    99°C    7’
 +
** 2    99°C    1’
 +
** -1°C  R=0.3 °/s
 +
** Goto 2 rep 74
 +
** Hold 4°C
 +
<br>
 +
*While hybridization of oligos is performed, digestion of pAAV_MCS vector can be conducted <br>
 +
following standard protocol for cloning.
 +
<br>
 +
*Title: Ligation MCS_Oligo with pAAV_MCS
 +
*Plasmid: pAAV_MCS
 +
*Buffer used: 3
 +
*BSA: Yes
 +
*Measure DNA-concentration with Nanodrop
 +
*DNA-Concentration:260 ng/uL
 +
*Restriction-enzyms used: http://www.neb.com/nebecomm/DoubleDigestCalculator.asp
 +
Enzyme1 (Nr. Lab: 152): ClaI
 +
Enzyme2 (Nr. Lab: 15): BglII   
 +
<br>
 +
*Digestion components :
{| border="1"
{| border="1"
-
|Cycles||Temperature||Time
+
| '''components'''  || align="right" | '''pAAV_MCS'''
-
|-
+
-
|||95°C||3"
+
-
|-
+
-
|||95°C||30"
+
|-
|-
-
|10x||62+-2°C||22"
+
| DNA  || align="right" | 4
|-
|-
-
|||72°C||12"
+
| BSA (10x) || align="right" |3
|-
|-
-
|||95°C||30"
+
| Buffer 3 (10x)|| align="right" |3
|-
|-
-
|15x||66+/-2°C||22"
+
|Enzyme: ClaI (no.Lab:152)|| align="right" |2
|-
|-
-
|||72°C||12"
+
|Enzyme: BglII (no.Lab:15)|| align="right" |1
|-
|-
-
|1x||72°C||5'
+
|H<sub>2</sub>O|| align="right" |17
|-
|-
-
|Hold 4°C
+
|'''Total volume'''||  align="right" |<b>30</b>
|}
|}
-
 
+
*Incubate for 1,5 h at 37°C
<br>
<br>
-
<li> The PCR was run
+
*1% Agarose gel
-
<li> 2% agarose gel was prepared. Running the gel at 110 V for 45 minutes.
+
**1% agarose gel was prepared, gel ran for 45 minutes( first: 90V, after 15 minutes: 115 V)
-
<li> No bands were observed on the gel -> pcr didn't work. <br>
+
-
Possible reasons: *Old Vent polymerase -> New polymerase ordered
+
-
*Mg concentration could be optimized
+
-
*Template okay? Template will be loaded on gel as well next time
+
<br>
<br>
-
 
+
*Amount of loading dye added
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Search for restriction sites in the sequence LQA/RGQA/RQA</u></p>
+
-
Investigator: Volker<br>
+
-
 
+
-
The idea to use a R588L mutation instead of the R588A that is published in the literature was discussed with the supervisers. It was proposed to search for other amino acid exchanges that alter the loop less drastically. For this reason the mutation N587Q was examined for possible restriction sites.
+
-
[[File:Freiburg_Search for restriction sites in the 585_588 KO  loop sequence.png|400px|left|thumb|Search for restriction sites in the 585/588 KO loop  sequence]]
+
-
 
+
-
<p style="clear:both;"><li> :) </p>
+
-
 
+
-
==== '''Results sequencing alignment of GMK_TK30''' ====
+
-
Investigator: Bea
+
-
<br>
+
-
'''Result''': The obtained sequencing results indicate that the DNA we received from Amor contains the GMK_TK30 fusion enzyme, but tk30 contains some restriction sites.
+
-
 
+
-
<br>
+
-
[[File:Freiburg10_Sequence_alignment_GMK_TK30_page1.jpg|500px|left|thumb|Sequence alignment of GMK_TK30]]
+
-
[[File:Freiburg10_Sequence_alignment_GMK_TK30_page2.jpg|520px|right|thumb|Sequence alignment of GMK_TK30]]
+
-
[[File:Freiburg10_Sequence_alignment_GMK_TK30_page3.jpg|500px|left|thumb|Sequence alignment of GMK_TK30]]
+
-
[[File:Freiburg10_Sequence_alignment_GMK_TK30_page4.jpg|520px|right|thumb|Sequence alignment of GMK_TK30]]
+
-
<br>
+
-
 
+
-
<p style="clear:both;"><li>To do (06.07.2010): Order primers for BioBrick Fusionenzyme and order genes of GMK and TK (wtTK, TK30, sr39????)</li>
+
-
<li> remove iGEM restriction sites</p>
+
-
<br>
+
-
 
+
-
===51.Labortag 6.07.2010: Harvesting AAVs from 4 10cm dishes, Transduction of 3x6er dishes ===
+
-
Investigators: Adrian, Anna, Bea, Kerstin
+
-
 
+
-
We want to investigate which of the following approaches yields a better transduction efficiency.
+
-
*Half of the transfected cells were exposed 3 cycles of thawing and freezing and then centrifuged (15 ml falcon, 2100G). The supernatant was transfered into a new 15 ml falcon and used for transduction.
+
-
*The other half was centrifuged at 300 G for 5min . The supernatant was transfered into another 15 ml falcon and the pellet was resuspended with 5 ml of DMEM. The content of these two falcons was also exposed to 3 cycles of thawing and freezing and then used for transduction.
+
-
 
+
-
 
+
-
* We have got 2 10 cm cellculture dishes with 10µg and 2 dishes with 20µg DNA used for transfection.
+
-
 
+
-
Approach with standart protocol (one dish with 10 and the other with 20µg Plasmids)(2100 G and 3 cycles of freezing and thawing)
+
-
 
+
-
 
+
-
Deviations from the standart protocol:
+
-
* The cells were centrifuged at 2100 G instead of 10.000 G
+
-
* The viruses were harvested after 44 hours
+
-
* 3 cycles of freezing and thawing
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Search for restriction sites before and after the insertion sites 453 and 585/588</u></p>
+
-
Investigator: Volker<br>
+
-
 
+
-
 
+
-
 
+
-
===='''Transduction of 3x6er dishes '''====
+
-
Investigators: Adrian Bea
+
-
 
+
-
* used plasmids: 10µg, 20µg YFP
+
-
* we have 10µg and 20µg from standart protocol => SV
+
-
* we have 10µg and 20µg from standart protocol pellet => Pellet
+
-
* we have 10µg and 20µg from standart protocol suspension => Super
+
-
* amount of 500µl
+
-
 
+
-
1. Plate I(A is up)
+
{| border="1"
{| border="1"
-
| 10µg dropped Super || align="right" |10µg dropped Super gently resuspending|| align="right" |10µg dropped Super gently resuspending
+
|<b>sample/µL </b>||align="right"| '''loading dye/µL'''
|-
|-
-
| 10µg Super gently resuspending Super||  align="right" |20µg dropped Super gently resuspending 1:10 dilution|| align="right" | control
+
| marker: 8 ||align="right"|contains loading dye
|-
|-
-
|}
+
|pAAV_MCS: 24 ||align="right"|6
-
 
+
-
 
+
-
2. Plate I(A is up)
+
-
{| border="1"
+
-
| 10µg dropped Super || align="right" |10µg dropped Super gently resuspending|| align="right" |10µg dropped Super gently resuspending
+
-
|-
+
-
| 10µg Super gently resuspending Super||  align="right" |20µg dropped Super gently resuspending 1:10 dilution|| align="right" | control
+
|-
|-
|}
|}
 +
<br>
 +
*Expected size of fragments
-
 
-
3. Plate I(A is up)
 
{| border="1"
{| border="1"
-
| 10µg dropped Pellet || align="right" |10µg dropped Pellet gently resuspending|| align="right" |10µg dropped Pellet gently resuspending
+
| '''sample''' ||align="right"| '''expected size'''
|-
|-
-
| 10µg Super gently resuspending Pellet||  align="right" |20µg dropped Pellet gently resuspending 1:10 dilution|| align="right" | control
+
|  align="right" | pAAV_MCS: cut with ClaI and BglII||align="right"|4580 bp
|-
|-
|}
|}
 +
<br>
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Search for restriction sites around the 453 and 585/588 integration sites</u></p>
+
==== 19. Labortag 02.06.2010: Oligos (NotI)====
-
Investigator: Volker<br>
+
-
For this purpose a list of all commercially availible restriction enzymes was created that do not match in the ORFs of pAAV-RC.
+
Investigators: Adrian, Bea, Chris W., Hanna, Anissa<br>
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Search for restriction sites in the sequence LQA/RGQA/RQA</u></p>
+
<br>
-
Investigator: Volker<br>
+
'''Practical work:''' <br>
 +
Control plate contained no clones. :)
 +
4 colonies were picked and grown @ 37°C over night.
 +
<br>
 +
'''Theoretical work:'''<br>
 +
Oligos for site directed mutagenesis of the NotI restriction sites in pAAV_MCS (ITRs) were designed:[[File:Freiburg10 NotI ITR Oligos.pdf]]
 +
<br>
 +
'''Sponsoring work:''' <br>
 +
Sponsoring letter was adapted for Quiagen.
-
The idea to use a R588L mutation instead of the R588A that is published in the literature was discussed with the supervisers. It was proposed to search for other amino acid exchanges that alter the loop less drastically. For this reason the mutation N587Q was examined for possible restriction sites.<br>
+
====20. Labortag 03.06.2010:  pAAV_RFC25_MCS -> problem====
-
[[File:Freiburg_Possible restriction sites around integration site 453.png|900px|left|thumb|bla Bla bla]]
+
Investigators: Anissa, Bea, Melanie, Christian L.
-
 
+
-
[[File:Freiburg_Possible restriction sites around integration site 585.png|900px|left|thumb|bla Bla bla]]
+
-
<p style="clear:both;"><li>.</p>
+
<br>
<br>
-
===52.Labortag 07.07.2010: ===
+
'''Comment''': Continue with Mini-Prep and test digestion of pAAV_RFC25_MCS <br>
-
====<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of GIO</u></p>====
+
Mini-Prep and test digestion have been performed: <br>
-
Investigator: '''Hanna''' <br>
+
-
Comments: Neither sequencing with forward nor with reverse primer (O29 + O30) worked. Therefore P40 (pAAV_iGEM_mVenus-YFP) was sent for sequencing once again. <br>
+
-
*Name: Hanna P40 <br>
+
-
*V (P40) = 11 µL + 19 µL H2O <br>
+
-
*Name of primer forward: Hanna 1 (O30)<br>
+
-
*Name of primer reverse: Hanna 2 (O29)<br>
+
-
*V(primer) = 3 µL + 27 µL H2O <br>
+
-
====<p style="font-size:15px; font-weight: bold; color: purple;"><u>Interview with Bild der Wissenschaft</u></p>====
+
<span style="color:red; font-weight:bold;">Problem</span>: Designed oligos (MCS_RFC25) for altering the MCS of the pAAV_MCS vector cannot be used. <br> Two startcodons are in the MCS.  
-
*'''Adrian''' did a good job ;-)
+
[[File:Oligo RFC25 MCS.jpg|800px|thumb|left| Oligo MCS_RFC25: contains 2 Startcodons. the "wrong" Codon is the first ATG which results in peptide chain with 30 aa. The second ATG is the right ATG which is right before the Gene of Interest.]]
-
*The article will be send to us next week
+
-
*For additional question, Jessica will be send an email
+
-
 
+
-
====<p style="font-size:15px; font-weight: bold; color: purple;"><u>Transfection</u></p>====
+
-
Investigators:''' Adrian, Bea'''
+
-
 
+
-
*Transfection of AAV-293 cells with pAAV_iGEM-mVenus_YFP
+
-
 
+
-
====<p style="font-size:15px; font-weight: bold; color: purple;"><u>New pcr run with new polymerase and different MgSO4 concentrations</u></p>====
+
-
*While this time the positive control was actually positive, no pcr product could be seen. The reasons are unclear. (Secondary structures, primer binding...)
+
-
 
+
-
 
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Checking the results of the following sequencing reactions for the expression constructs from the DKFZ</u></p>
+
-
Investigator: Volker<br>
+
-
 
+
-
 
+
-
pKEX-VP1ex: sequence confirmed as described in  [Name et al.,] with two pointmutations (ACG=>GCG) and (ATG=>CTG) to avoid the translation of VP2 and VP3.<br>
+
-
 
+
-
pKEX-VP2ex: sequence confirmed as described in  [Name et al.,] with one mutation (ATG=>CTG) to avoid the translation of VP3 and a second mutation (AAGACG=>CATATG) to switch to the main start codon ATG and to introduce a restriction site (which one??) before the start codon.<br>  
+
-
 
+
-
pKEX-VP3ex: sequence confirmed as described in [Name et al.,] with two silent pointmutations and a second mutation to introduce a restriction site before the start codon.<br>
+
-
 
+
-
pKEX-Rep40ex: Sequence as expected until now, further sequencing reaction required with the primer: GATC_std_pTeSp-1<br>
+
-
 
+
-
pKEX-Rep52ex: Point mutation directly at the beginning of the exon sequence, perhaps functionality in this context? At the end of the sequence some umcertainities. For the beginning further sequencing reaction required with the primer: GATC_std_pTeSp-1<br>
+
-
 
+
-
 
+
-
pKEX-Rep68ex: One point mutation in the second condon that changes the coded amino acids from P to A, a second mutation (ATG=>GGG) at the beginning of the Rep40/Rep52 ORFs to avoid the translation of these sequences and a silent mutation. One further sequencing reaction is required with the primer: GATC_std_pcDNA1.1-RP.<br>
+
-
 
+
-
pKEX-Rep78ex: One point mutation in the second condon that changes the coded amino acids from P to A, a second mutation (ATG=>GGG) at the beginning of the Rep40/Rep52 ORFs to avoid the translation of these sequences, a silent mutation and the same point mutation at the beginning of the exon as seen before in pKEX-Rep52ex.
+
-
 
+
-
===53.Labortag 08.07.2010: ===
+
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u> Final planing of the Cap modifications.</u></p>
+
-
Investigator: Volker<br>
+
-
 
+
-
 
+
-
[[File:Freiburg_Final integration site 453 planing.png|900px|left|thumb|]]
+
-
[[File:Freiburg_Final integration site 585__588 planing.png|900px|left|thumb|]]
+
-
 
+
-
 
+
-
'''BbvCI'''<br>
+
-
50|100|10|100 37°<br>
+
-
[[File:Freiburg10_BbvC-I-cutsite_1_v1_000007.gif]]<br>
+
-
Recognition sites in Rep/Cap ORFs:  <br>
+
-
Recognition sites in pAAV_RC:    <br>
+
-
Recognition site in pSB1C3:    <br>
+
-
 
+
-
'''KpnI'''<br>
+
-
100|75|0|50 37°C + BSA<br>
+
-
[[File:Freiburg10_Kpn-I-cutsite_1_v1_000021.gif.gif]]<br>
+
-
Recognition sites in Rep/Cap ORFs:  <br>
+
-
Recognition sites in pAAV_RC:    <br>
+
-
Recognition site in pSB1C3:    <br>
+
-
 
+
-
'''SalI'''<br>
+
-
10|100|100|100 37°C<br>
+
-
[[File:Freiburg10_Sal-I-cutsite_1_v1_000016.gif.gif]]<br>
+
-
Recognition sites in Rep/Cap ORFs:  <br>
+
-
Recognition sites in pAAV_RC:    <br>
+
-
Recognition site in pSB1C3:    <br>
+
-
 
+
-
'''AarI'''<br>
+
-
|||<br>
+
-
[[File:Freiburg10_.gif]]<br>
+
-
Recognition sites in Rep/Cap ORFs:  <br>
+
-
Recognition sites in pAAV_RC:    <br>
+
-
Recognition site in pSB1C3:    <br>
+
-
+
-
'''ScaI'''<br>
+
-
100|100|10|100 37°C<br>
+
-
[[File:Freiburg10_Sca-I-cutsite_1_v1_00001.gif.gif]]<br>
+
-
Recognition sites in Rep/Cap ORFs:  <br>
+
-
Recognition sites in pAAV_RC:    <br>
+
-
Recognition site in pSB1C3: 2   <br>
+
-
 
+
-
'''BamHI'''<br>
+
-
75|100|100|100 37°C + BSA<br>
+
-
[[File:Freiburg10_BamH-I-cutsite_1_v1_000025.gif.gif]]<br>
+
-
Recognition sites in Rep/Cap ORFs:  <br>
+
-
Recognition sites in pAAV_RC:    <br>
+
-
Recognition site in pSB1C3:    <br>
+
-
 
+
-
'''PvuII'''<br>
+
-
100|100|100|100 37°C<br>
+
-
[[File:Freiburg10_Pvu-II-cutsite_1_v1_000013.gif.gif]]<br>
+
-
Recognition sites in Rep/Cap ORFs:  <br>
+
-
Recognition sites in pAAV_RC:    <br>
+
-
Recognition site in pSB1C3:  1  <br>
+
-
 
+
-
'''EagI'''<br>
+
-
10|25|100|10 37°C<br>
+
-
[[File:Freiburg10_Eag-I-cutsite_1_v1_000021.gif.gif]]<br>
+
-
Recognition sites in Rep/Cap ORFs:  <br>
+
-
Recognition sites in pAAV_RC:    <br>
+
-
Recognition site in pSB1C3:  2  <br>
+
-
 
+
-
===54.Labortag 09.07.2010: ===
+
-
 
+
-
*New DMEM-Medium was prepared (10% FCS). Investigators: Bea, Patrick
+
-
*HT and 293 cells were split into 4 flasks, 2 flasks each. Investigator: Kira
+
-
*AAV stocks were prepared, put into the -80°C freezer and labeled with the date, name, AAV, the amount of DNA used for transfection and drop/resuspend to make clear whether the DNA was just pippeted dropwise to the 293 cells or gently mixed with the cells. The numbers on the 15 ml falcons refer to DNA amount and DNA administration, too. Investigator: Patrick
+
-
 
+
-
Investigators: Anissa, Kerstin, Anna
+
-
 
+
-
====<p style font-weight: bold; color: blue;">PCR of hgH</p>====
+
-
*PCR program: Unnamed
+
-
<br />
+
-
{| border="1"
+
-
| components  || align="right" |volume of vector /µl 
+
-
|-
+
-
| 5x Phusion HF buffer  ||  align="right" | 10
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" | 1
+
-
|-
+
-
| hgH_primer_for||  align="right" | 2,5
+
-
|-
+
-
| hgH_primer_rev||  align="right" | 2,5
+
-
|-
+
-
|DNA template||  align="right" | 0,38
+
-
|-
+
-
|DMSO||  align="right" | -
+
-
|-
+
-
|Phusion polymerase||  align="right" | 0,5
+
-
|-
+
-
|H2O||  align="right" | 33,1 
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 50
+
-
|}
+
-
<br /><br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
-
<br />
+
-
0,625 g Agarose, 50 ml TAE (1,25%), 3 µl GELRED (3-6µl), at 110 Volt, running time: 60 minutes
+
-
<br />
+
-
<br />
+
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (5x/6x)/µl
+
-
!Expected size (Geneious)
+
-
|--
+
-
|p47: hgH
+
-
|50 µl
+
-
|10 µl
+
-
|488 bp
+
-
|--
+
-
 
+
-
|}
+
-
{| align=right
+
-
|}
+
-
<br />
+
-
*Marker: GeneRuler ladder mix
+
-
{| border="1"
+
-
|
+
-
!Marker (8 µl)
+
-
!Sample 50 /µl
+
-
|-
+
-
!Lane
+
-
|1
+
-
|4
+
-
|-
+
-
|}
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
+
-
<br />
+
-
Gel measurement:
+
-
<br />
+
-
{| border="1"
+
-
| align="left" | '''Sample''' ||align="left"| '''weight'''
+
-
|-
+
-
| align="left" | p47: hgH ||align="left"| 0,13 g
+
-
|}
+
-
<br /><br />
+
-
*DNA concentration (hgH): 19,83 ng/µl
+
-
<br />
+
-
'''Comments:''' PCR was succesful:-)
+
-
to do: Ligation of PCR product into standard plasmid which we´ve received wihthin the DNA distrivution kit of iGEM-HQ .
+
<br>
<br>
-
====<p style= "font-weight: bold; color: blue;">Order oligos for GMK_TK30</p>====
 
-
Investigator: '''Bea'''<br />
 
-
Oligos have been ordered at sigmaaldrich in order to insert prefix and suffix to fusionenzyme mGMK_TK30 in RFC25.
 
<br>
<br>
<br>
<br>
-
[[File:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010.jpg]]
 
<br>
<br>
-
[[File:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010 page2.jpg]]
 
<br>
<br>
-
[[File:Freiburg10 Cloning strategy for preparation of inserzting RFC25 to fusionenzyme gmk tk30 09 07 2010 page3.jpg]]
 
<br>
<br>
-
<p style= "font-weight: bold; color: red;">to do: Order gene tk30 and part of gene sr39</p>
+
<br>
-
 
+
<br>
-
====Quickchange for the PstI restriction sites in pAAV-RC====
+
<br>
-
Investigators: Kira and Volker
+
The two startcodons are not in the same open reading frame (ORF). Therefore two proteins will be produced. The Gene of Interest and the short peptide (30 aa).<br>
-
 
+
The idea of the oligos was to ligate the oligos into the pAAV_MCS vector. The oligos contained two overhangs which correspond to the sequences of the two restriction sites ClaI and BglII: <br>
-
Quick change, Gel and test digestion with PstI. (more precise informations will be added)<br>
+
The pAAV_MCS vector was digested with ClaI and BglII and then we ligated the oligo and the vector. Problem was that we did not notice that the overhang of ClaI and the sequence of EcoRI of the MCS_RFC25 resulted in another ATG startcodon.
-
@Kira and Volker: did the Quickchange actually work? Could you please add the information onto the wiki!! Thx!
+
<br>
-
 
+
<br>
-
'''PCR program''': PstI
+
'''Possible Solutions''':  
-
<br />
+
<ul>
 +
# first: modify MCS with ordered oligos of Sven (shorter MCS which cannot be used for pEX)and clone mVenus
 +
# Perform site-directed-mutagenesis (QuikChange from Stratagene)
 +
# Order new MCS-oligos and consider that '''no''' new ATG is produced. For example: add another base between ClaI overhang and EcoRI sequence. -----AT'''X'''G---- '''This solution is the more possible one we are going to perform.'''
 +
</ul>
 +
<br>
 +
<span style="color:blue; font-weight:bold;">Practical work</span>
 +
<br>
 +
<ul>
 +
*Preparing four glycerol stocks (2:1)
 +
**numbers: B4 - B7 (for details see nomenclature)
 +
**stored in -80°C, Box 1
 +
</ul>
 +
*<b>MiniPrep</b>
 +
**Nanodrop concentrations
 +
<br>
{| border="1"
{| border="1"
-
| components  || align="right" |volume in µl
+
| align="right" | '''Sample''' ||align="right"| '''Concentration/ng*µl-1'''
|-
|-
-
| 10x Phusion HF buffer || align="right" | 2.5 µl
+
|  align="right" | P11 ||align="right"|340,5
|-
|-
-
| 10 mM dNTP mix || align="right" | 0.5 µl
+
| align="right" | P12 ||align="right"|364,0
|-
|-
-
| __310 ____primer_for (1:10 dilution)|| align="right" | 0,39 µl
+
| align="right" | P13 ||align="right"|358,5
|-
|-
-
| __310____primer_rev (1:10 dilution)|| align="right" | 0,39 µl
+
| align="right" | P14 ||align="right"|284,4
|-
|-
-
|DNA template (1:40 dilution)||  align="right" |  0,5 µl
 
-
|-
 
-
|DMSO||  align="right" |  0 µl
 
-
|-
 
-
|Phusion polymerase||  align="right" |  0.5 µl
 
-
|-
 
-
|H2O||  align="right" | 20,22 µl
 
-
|-
 
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 25 µl
 
|}
|}
-
<br />
+
<br>
-
 
+
*Test digestion
-
<br />
+
<br>
{| border="1"
{| border="1"
-
| components   || align="right" |volume in µl
+
| Components   || align="right" |Volume µl ||align="right"| Mastermix µl
|-
|-
-
| 10x Phusion HF buffer ||  align="right" | 2.5 µl
+
| DNA ||  align="right" | 800 ||  align="right" | --
|-
|-
-
| 10 mM dNTP mix ||  align="right" | 0.5 µl
+
| BSA (10x) ||  align="right" | 1,5 ||  align="right" | 7,5  
|-
|-
-
| __4073____primer_for (1:10 dilution)||  align="right" |  0.33 µl
+
| Buffer No.2 (10x)||  align="right" | 1,5 ||  align="right" | 7,5
|-
|-
-
| ___4073___primer_rev (1:10 dilution)||  align="right" | 0.33 µl
+
|Enzyme 1 (no.Lab:45) Nde I ||  align="right" | 0,5 ||  align="right" | 2,5
|-
|-
-
|DNA template (1:40 dilution)||  align="right" | 0.5 µl
+
|Enzyme 2 (no.Lab:71) Spe I ||  align="right" | 0,5 ||  align="right" | 2,5
|-
|-
-
|DMSO||  align="right" |  0 µl
+
|H<sub>2</sub>O||  align="right" | variable ||  align="right" | --
|-
|-
-
|Phusion polymerase||  align="right" | 0.5 µl
+
|'''Total volume '''||  align="right" | 15 ||  align="right" | 20
-
|-
+
-
|H2O||  align="right" | 20.32 µl
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 25 µl
+
|}
|}
-
<br />
+
<br>
{| border="1"
{| border="1"
-
| cycles   || align="right" |temperature || align="right" |time
+
| Sample   || align="right" | Volume/ µl ||align="right"| H<sub>2</sub>O / µl
-
|-
+
-
| 1 ||  align="right" |95 C ||  align="right" |2 min 
+
-
|-
+
-
| 20 ||  align="right" |95 C ||  align="right" |30 sec
+
-
|-
+
-
| ||  align="right" |66 C ||  align="right" |1 min
+
-
|-
+
-
|||  align="right" |68 C ||  align="right" |5 min
+
-
|}
+
-
<br />
+
-
* The PCR-products were digested with DpnI (1µl instead of 0.5 µl)
+
-
* aragose gel revealed for both samples very distinct bands
+
-
 
+
-
<br />
+
-
'''TEST DIGESTION'''
+
-
{| border="1"
+
-
| components  || align="right" |volume  /µl  
+
-
|-
+
-
| DNA  ||  align="right" | 10
+
|-
|-
-
| BSA (10x) ||  align="right" | 2  
+
| P11  ||  align="right" | 2,3 ||align="right"| 8,7
|-
|-
-
| Buffer 3 (10x)||  align="right" | 2  
+
| P12  ||  align="right" | 2,2 ||align="right"| 8,8
|-
|-
-
|Enzyme (no.Lab: 48)||  align="right" | 1
+
| P13  ||  align="right" | 2,2 ||align="right"| 8,8
|-
|-
-
|H2O||  align="right" | 5
+
| P14  ||  align="right" | 2,8 ||align="right"| 8,2
|-
|-
-
|'''Total volume '''||  align="right" | 20
 
|}
|}
-
<br />
+
*Incubation: 1,5 h
-
* agarose gel was performed with digested samples and revealed 3 distinct bands, while only 1-2 bands have been expected. Because of the density of the bands it might be that the digestion with DpnI did not work properly, thus additional 1 µl of DpnI was added to each sample. Incubation @ 37 C lasted 1 h.
+
<br>
-
<br />
+
<li>Agarose-Gel
-
===55.Labortag 11.07.2010===
+
*Materials
 +
0,5 g Agarose, 50 ml TAE, 3µl GELRED, at 100 Volt, running time: 45 minutes
-
HT 1080 and HEK 293 cells were split. Investigator: Patrick <br>
 
-
@ Kira: fetch new trypsin if it is not sufficient for the next splitting !
 
-
===56.Labortag 12.07.2010: ITR BioBrick production===
 
-
 
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Practical Cloning:</u></p>
 
-
*experiment date: 12.07.2010 ; time: 11.00
 
-
*name of investigator: Anna, Kerstin, Anissa
 
-
*plasmid: pSB1c3_CFP (p48)
 
-
**Vector: name: pSB1c3 number:- production date: - origin: iGEM
 
-
**Insert: name: pMA_CFP number:- production date: - origin: Sven
 
-
*new vector name: pSB1c3_CFP (p48)
 
-
*buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:28) EcoRI ; Enzyme 2 (no.Lab:48) PstI ;Enzyme 3 (no.Lab:77) DpNI
 
-
*DNA concentration (vector): 25 µg/µl ; DNA concentration (insert): 436,8 µg/µl
 
-
<br />
 
-
'''Comments:'''Third enzyme was only used to digest template from vector pcr
 
-
<br />
 
-
<br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
 
-
{| border="1"
 
-
| components  || align="right" |volume of vector /µl || align="right" |volume of insert /µl
 
-
|-
 
-
| DNA  ||  align="right" |4 ||  align="right" |5
 
-
|-
 
-
| BSA (100x) ||  align="right" |0,2 ||  align="right" | 2
 
-
|-
 
-
| Buffer ____ (10x)||  align="right" |1,5 ||  align="right" |2
 
-
|-
 
-
|Enzyme 1 (no.Lab:23)||  align="right" |0,5 ||  align="right" |1
 
-
|-
 
-
|Enzyme 2 (no.Lab:48)||  align="right" |0,5 ||  align="right" |1
 
-
|-
 
-
|Enzyme 3 (no.Lab:77)||  align="right" |0,5 ||  align="right" |1
 
-
|-
 
-
|H2O||  align="right" |7,8 ||  align="right" |9
 
-
|-
 
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | 15||  align="right" |20
 
-
|}
 
-
*Incubation: 1h
 
-
<br /><br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
 
-
<br />
 
-
0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 Volt, running time:45 minutes
 
-
<br />
 
-
<br />
 
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
!Sample
!Sample
Line 959: Line 343:
!Expected size 1 (Geneious)
!Expected size 1 (Geneious)
!Expected size 2 (Geneious)
!Expected size 2 (Geneious)
-
!Expected size 3 (Geneious)
 
-
!Expected size 4 (Geneious)
 
|--
|--
-
| 2
+
|P11
-
|20 µl  
+
|15 µl  
-
|3,3 µl
+
|3 µl
-
|732 bp (Insert)
+
|3677 bp
-
|2074 bp (Vector)
+
| 974 bp
-
|____ bp
+
|--
-
|____ bp
+
|P12
 +
|15 µl
 +
|3 µl
 +
|3677 bp
 +
| 974 bp
 +
|--
 +
|P13
 +
|15 µl
 +
|4 µl
 +
|3677 bp
 +
| 974 bp
 +
|--
 +
|P14
 +
|15 µl
 +
|4 µl
 +
|3677 bp
 +
| 974 bp
|--
|--
Line 974: Line 372:
{| align=right
{| align=right
|}
|}
-
<br />
+
 
-
*Marker: GeneRuler ladder mix
+
 
{| border="1"
{| border="1"
|
|
!Marker
!Marker
-
!Sample 23,3 µl
+
!Sample P11 /18 µl
 +
!Sample P12 /18 µl
 +
!Sample P13 /19 µl
 +
!Sample P14 /19 µl
|-
|-
!Lane  
!Lane  
-
|1
+
| 1
-
|3
+
| 3
 +
| 5
 +
| 7
 +
| 9
|-
|-
|}
|}
-
<br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
 
-
<br />
 
-
Gel measurement:
 
-
<br />
 
-
{| border="1"
 
-
| align="left" | '''Sample''' ||align="left"| '''weight'''
 
-
|-
 
-
| align="left" | 2 (Insert) ||align="left"| 0,14g
 
-
|-
 
-
|}
 
-
<br /><br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Ligation</p>
 
-
<br />
 
-
{| border="1"
 
-
| align="left" |  ||align="left"| '''Insert''' ||align="left"| '''Vector'''
 
-
|-
 
-
| align="left" | '''Volume/µl''' ||align="left"| 6,77 µl||align="left"| 2,23 µl
 
-
|}
 
-
<br />
 
-
'''TRAFO-EVALUATION'''
+
'''Results of agarose-gel:'''
-
* Unfortunately the agar plate with p48, pSB1c3_CFP [XL1B, Cm, A.B.] does not contain any colonies. Thus, the plate was incubated @ 37 C for another 5 hours. Still no detectable colonies. This was double checked by Sven.  
+
<br>
 +
<ul>
 +
*Expected fragments of 3677 bp and 974 bp can be cerified. The insertion of the RFC25_MCS has been inserted. <br>
 +
For further verification the insert has to be sequenced has to be conducted (to do for 04.06.2010). <br>
 +
</ul>
 +
<br>
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Seeding HT1080 + Passage:</u></p>
+
<span style="color:blue; font-weight:bold;">Picking clones of Thymindinkinase of Amor</span>
 +
**5 clones of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 with the thymidinkinase''' have been picked from LBamp-agarplates
 +
**1 clone of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 without the thymidinkinase (control) has been picked from LBamp-agarplates
 +
**all clones have been inoculated in 10 mL LB containing 10 µL Amp. Incubation: 37°C over-night.
 +
**'''to do: Mini-Prep of pUB6/HV5/His6 with the thymidinkinase and pUB6/HV5/His6 without the thymidinkinase (control)'''
 +
<br>
 +
<span style="color:blue; font-weight:bold;">Idea</span>
 +
<ul>
 +
*Insertion of Kozak consensus sequence before MCS to enhance gene expression (cloning consideration in Stratagene manual)
 +
** New RFC standard with Kozak sequence for eucaryotes??
-
*Investigators: Adrian, Patrick
+
====21. Labortag 04.06.2010: DKFZ plasmid Retrafos, TK/GMK Mini-Prep====
-
* 3* 6well dishes
+
-
{| border="1"
+
-
|3*10^5 cells || align="right" |3*10^5 cells|| align="right" |3*10^5 cells
+
-
|-
+
-
|3*10^5 cells ||  align="right" |3*10^5 cells||  align="right" |3*10^5 cells
+
-
|-
+
-
|}
+
-
* The amount of cells was doubled in first place and diluted in following steps (for further information ask patrick and adrian)
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>PCR of beta-globin:</u></p>
+
Investigators: Adrian, Bea, Chris W., Hanna<br>
-
*Investigator: Achim
+
<p style="font-size:15px; font-weight: bold; color: green;"><u>DKFZ</u></p>
-
*PCR program: BETA...(?)
+
 
 +
'''Comments''': Plasmids of PD Kleinschmidt of the DKFZ arrived. The DNA was dried on a whatman paper.<br>
 +
Plasmids received: <br>
 +
 
 +
*'''pXX6''' alle Adenovirus Helfer Gene ohne AAV Gene; Plasmid von J. Samulski; evtl. Anfragen für Benutzererlaubnis
 +
*'''pKEX-2XL.Rep40''' Expressionsplasmide für das Rep Proteine 40
 +
*'''pKEX-2XL.Rep 52''' Expressionsplasmide für das Rep Proteine 52
 +
*'''pKEX-2XL.Rep 68''' Expressionsplasmide für das Rep Proteine 68
 +
*'''pKEX-2XL.Rep 78''' Expressionsplasmide für das Rep Proteine 78
 +
*'''pCMV-VP(HS)''' Expressionsplasmid der drei VP Proteine in Kombination (assemly kompetent
 +
*'''pKEX-VP1''' Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
 +
*'''pKEX-VP2'''Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
 +
*'''pKEX-VP3'''Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
 +
*'''pTRUF_CMV_eGFP'''Einzelstrang Vektor zur Expression von eGFP
 +
*'''dsAAV_CMV_eGFP'''"self complementary" Expressionsvektor von X. Xiao; evtl. anfragen wegen Benutzererlaubnis
 +
*'''pTAV2 (gesamtes AAV Genom im "blue script" Vektor)
 +
*'''pDG''' komplettes Helferplasmid zur Vektorherstellung; Grimm et al. 1998
 +
<br>
 +
*In order to obtain the DNA following steps have been performed:
 +
**cut out the spot where the DNA is spotted with a clean scalpel (note: scalpel should not have any contamination).
 +
**put a 0,5 mL Eppi in a 1,5 mL Eppi. Put little holes in the smaller eppi.
 +
**transfer Whatman paper into Eppi
 +
**add 50 µL TE-EF (Redissolving buffer) to whatman paper and wait 15 minutes
 +
**centrifuge eppis at 2000 rpm, 10 minutes
 +
*Transformation with obtained plasmids was performed.
 +
</ul>
 +
<br>
 +
<p style="font-size:15px; font-weight: bold; color: green;"><u>Fusion Enzyme: Thymidinkinase/Guanylate Kinase (TK/GMK)</u></p>
 +
<p style="font-size:12px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
 +
*experiment date: 04.06.2010 ; time: 3,5h
 +
*name of investigator: Adrian, Bea, ChrisW.,Hanna
 +
*new vector name: pUB_V5_His6 + TK/GMK (fusionenzyme)
<br />
<br />
 +
<u>Glycerol Stocks</u>
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl 
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5'''||align="left"|'''Control'''
|-
|-
-
| 5x Phusion HF buffer  || align="right" | 10
+
| align="left" | '''Bacteria strain''' ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue
|-
|-
-
| 10 mM dNTP mix || align="right" | 1
+
| align="left" | '''Plasmidname''' ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK
|-
|-
-
| beta-globin_primer_for||  align="right" | 2,5
+
| align="left" | '''Date''' ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010
|-
|-
-
| beta-globin_primer_rev|| align="right" | 2,5
+
| align="left" | '''given number''' ||align="left"| B8 ||align="left"| B9 ||align="left"| B10 ||align="left"| B11 ||align="left"| B12 ||align="left"| B13
-
|-
+
-
|DNA template||  align="right" | 8 ng
+
-
|-
+
-
|DMSO||  align="right" | -
+
-
|-
+
-
|Phusion polymerase||  align="right" | 0,5
+
-
|-
+
-
|H2O||  align="right" | 33,2 
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''|| align="right" | 50
+
|}
|}
-
<br /><br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
 
<br />
<br />
-
0,625 g Agarose, 50 ml TAE (1,25%), 3 µl GELRED (3-6µl), at 115 Volt, running time: 30 minutes
+
<u>Given Plasmid-Number</u>
-
<br />
+
-
<br />
+
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (5x/6x)/µl
+
-
!Expected size (Geneious)
+
-
|--
+
-
|p49: beta-globin
+
-
|50 µl
+
-
|10 µl
+
-
|509 bp
+
-
|--
+
-
 
+
-
|}
+
-
{| align=right
+
-
|}
+
-
<br />
+
-
*Marker: GeneRuler ladder mix
+
{| border="1"
{| border="1"
-
|
+
| align="left" | ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Control'''
-
!Marker (8 µl)
+
-
!Sample 50 /µl
+
-
|-
+
-
!Lane
+
-
|1
+
-
|4
+
|-
|-
 +
| align="left" | '''given number''' ||align="left"| P15 ||align="left"| P16 ||align="left"| P17 ||align="left"| P18 ||align="left"| P19 ||align="left"| P20
|}
|}
<br />
<br />
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
+
<p style="font-size:12px; font-weight: bold; color: blue;"><u>Nanodrop concentration</u></p>
 +
*Plasmid
 +
**Given Plasmid-Number: P15; DNA concentration: 493,7 ng/µL ;
 +
**Given Plasmid-Number: P16; DNA concentration: 464,4 ng/µL;
 +
**Given Plasmid-Number: P17; DNA concentration: 445,6 ng/µL;
 +
**Given Plasmid-Number: P18; DNA concentration: 562,9 ng/µL;
 +
**Given Plasmid-Number: P19; DNA concentration: 528,1 ng/µL;
 +
**Given Plasmid-Number: P20; DNA concentration: 499,9 ng/µL;
<br />
<br />
-
Gel measurement:
+
'''Comments:'''A Plasmid-Mini Prep with the received Fusionenzyme Thymidinkinase/Guanylate Kinase (TK/GMK)from Amor has been performed.<br>
 +
The DNA will be sent to GATC for sequencing.
 +
*pUB6_V5_His6 - clone 1 (P15) (3 µL added to 27µL H20) has been sent to GATC.
 +
*Expected results: Saturday
 +
 
<br />
<br />
-
{| border="1"
 
-
| align="left" | '''Sample''' ||align="left"| '''weight'''
 
-
|-
 
-
| align="left" | p49: hgH ||align="left"| 0,21 g
 
-
|}
 
-
<br /><br />
 
-
*DNA concentration (hgH): 34,87 ng/µl
 
-
<br />
 
-
'''Comments:''' PCR was succesful:-)<br>
 
-
to do: Ligation of PCR product into standard plasmid which we´ve received wihthin the DNA distrivution kit of iGEM-HQ .
 
-
<br>
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Midi-Prep preparation pAAV_RC</p>
 
-
Bea
 
-
*200mL LB-Medium and 200µl Amp
 
-
*inoculated with glycerol stock containing pAAV_RC
 
-
*20:00 p.m.: put intp 37°C room on shaker
 
-
<br>
 
<br>
<br>
-
<p style="font-size:20px; font-weight: bold; color: fuchsia;"><u>First steps in producing ITR BioBricks via Fancy Method</u></p>
+
====22. Labortag 05.06.2010: Insertion of iGEM expression parts into pAAV_MCS====
-
Hanna, Chris W. <br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pGA14_Cerulean-CFP</p>
+
-
<br>
+
-
'''1. Digestion with EcoRI and NotI:'''
+
-
<br>
+
-
{| border="1"
+
-
| components  || align="right" |volume of vector /µl
+
-
|-
+
-
| DNA  ||  align="right" | 3.5
+
-
|-
+
-
| BSA (10x) ||  align="right" | 2
+
-
|-
+
-
| Buffer 3 (10x) ||  align="right" | 2
+
-
|-
+
-
|Enzyme EcoRI (no.Lab:23)||  align="right" | 1
+
-
|-
+
-
|Enzyme NotI (no.Lab:46)||  align="right" | 1
+
-
|-
+
-
|H2O||  align="right" | 10.5
+
-
|-
+
-
|'''Total volume'''||  align="right" | 20
+
-
|}
+
-
<br>
+
-
Incubation: 1.5 hours, 37°C
+
-
<br>
+
-
Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker <br>
+
Investigators: Adrian, Bea, Melanie, Hanna<br>
-
Expected fragment size: ~ 2900 bp
+
-
<br>
+
-
 
+
-
Gel extraction:
+
-
<br>
+
-
Sample weight: 0.15 g <br>
+
-
Gel extraction was performed following the standard protocol. <br>
+
-
<br>
+
-
DNA concentration: 26.8 ng/µL
+
-
<br>
+
<br>
<br>
-
'''1. Digestion with XbaI and PstI:'''
+
<p style="font-size:15px; font-weight: bold; color: blue;">Hybridization:</p>
 +
*Hybridization of received oligos: iGEM expression parts (RFC25 without EcoRI, NotI)
 +
*Prior to opening the tubes, they were centrifugated at 13.000 rpm for 30 sec.
 +
**expression part MCS_for (charge-no: ST00114065): 108 µL Millipore H<sub>2</sub>O (Volume on obtained sheet)were added.
 +
**expression part MCS_for (charge-no: ST00114066): 165 µL Millipore H<sub>2</sub>O (Volume on obtained sheet)were added.
 +
*Resuspended DNA was vortexted.
 +
*Aliquots of both Oligos (1:10) were prepared: 10 µL Oligo + 90 µL H<sub>2</sub>O (final volume usually 100 µl).
 +
*Mix together(into PCR-tube):
<br>
<br>
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl
+
| align="right" | '''Volume/µL''' ||align="right"| '''solution'''
|-
|-
-
| DNA || align="right" | 3.5
+
|  align="right" | 10 (1:10)||align="right"|Oligo 1: expression part MCS_for (charge-no: ST00114065)
|-
|-
-
| BSA (10x) || align="right" | 2
+
| align="right" |10 (1:10)||align="right"|Oligo 2: expression part MCS_for (charge-no: ST00114066)
|-
|-
-
| Buffer 3 (10x) || align="right" | 2
+
| align="right" |4||align="right"| 100 mM TrisHCl pH8
|-
|-
-
|Enzyme XbaI (no.Lab:63)|| align="right" | 1.25
+
| align="right" |8||align="right"|5 mM MgCl2
|-
|-
-
|Enzyme PstI (no.Lab:48)||  align="right" | 0.75
+
|  align="right" |8||align="right"| H20
-
|-
+
-
|H2O||  align="right" | 10.5
+
-
|-
+
-
|'''Total volume'''||  align="right" | 20
+
|}
|}
<br>
<br>
-
Incubation: 1.5 hours, 37°C
+
* Program: ORIGAMI 1 modified for long oligos:
 +
** 1    99°C    7’
 +
** 2    99°C    1’
 +
** -1°C  R=0.3 °/s
 +
** Goto 2 rep 74
 +
** Hold 4°C
<br>
<br>
-
 
+
*While hybridization of oligos was performed, digestion of pAAV_MCS vector was conducted <br>
-
Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker <br>
+
following standard protocol for cloning.
-
Expected fragment size: ~ 2900 bp
+
<br>
<br>
-
 
-
Gel extraction:
 
<br>
<br>
-
Sample weight: 0.17 g <br>
+
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion:</p>
-
Gel extraction was performed following the standard protocol. <br>
+
*Title: Ligation iGEM expression parts (="iGEM-MCS") with pAAV_MCS
-
<br>
+
*Plasmid: pAAV_MCS
-
DNA concentration: 22.9 ng/µL
+
*Buffer used: 3
-
<br>
+
*BSA: Yes
-
<br>
+
*DNA-Concentration: 260 ng/uL
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pAAV_MCS (P9) with AlwNI</p>
+
*Restriction-enzyms used:
-
<br>
+
Enzyme1 (Nr. Lab: 152): ClaI
-
{| border="1"
+
Enzyme2 (Nr. Lab: 15): BglII   
-
| components  || align="right" |volume of vector /µl
+
-
|-
+
-
| DNA ||  align="right" | 11.6
+
-
|-
+
-
| BSA (10x) ||  align="right" | -
+
-
|-
+
-
| Buffer 4 (10x) ||  align="right" | 2.5
+
-
|-
+
-
|Enzyme AlwNI (no.Lab:120)||  align="right" | 2.5
+
-
|-
+
-
|H2O||  align="right" | 8.4
+
-
|-
+
-
|'''Total volume'''||  align="right" | 25
+
-
|}
+
-
<br>
+
-
Incubation: 1 hours + 20 minutes, 37°C
+
<br>
<br>
 +
*Digestion components :
-
Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker <br>
 
-
Expected fragment sizes: 2982 bp = right ITR and 1674 bp = left ITR
 
-
<br>
 
-
 
-
Gel extraction:
 
-
<br>
 
-
* Sample: right ITR = 0.15 g <br>
 
-
* Sample: left ITR = 0.12 g <br>
 
-
Gel extraction was performed following the standard protocol. <br>
 
-
<br>
 
-
DNA concentration:
 
-
<br>
 
-
* right ITR: 44.5 ng/µL
 
-
* left ITR: 32.8 ng/µL
 
-
<br>
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of ITR fragments with NotI and PstI</p>
 
-
<br>
 
-
Digestion of '''both''' fragments was performed as follows:
 
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl
+
| '''components'''   || align="right" | '''pAAV_MCS'''
|-
|-
-
| DNA  ||  align="right" | 19 µL
+
| DNA  ||  align="right" | 5.8 µL
|-
|-
-
| BSA (10x) ||  align="right" | 1.5
+
| BSA (10x) ||  align="right" |3 µL
|-
|-
-
| Buffer 3 (10x) ||  align="right" | 2.5
+
| Buffer 3 (10x)||  align="right" |2 µL
|-
|-
-
|Enzyme NotI (no.Lab:46)||  align="right" | 1
+
|Enzyme: ClaI (no.Lab:152)||  align="right" |2 µL
|-
|-
-
|Enzyme PstI (no.Lab:48)||  align="right" | 1
+
|Enzyme: BglII (no.Lab:15)||  align="right" |1 µL
|-
|-
-
|H2O||  align="right" | -
+
|H<sub>2</sub>O||  align="right" |16.2 µL
|-
|-
-
|'''Total volume'''||  align="right" | 25
+
|'''Total volume'''||  align="right" |<b>30 µL</b>
|}
|}
 +
*Mixture was incubated for 1,5 h at 37°C.
<br>
<br>
-
Incubation: 1 hours + 15 minutes, 37°C
+
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
 +
*1% agarose gel was prepared, gel ran for 45 minutes(110 V)
<br>
<br>
-
 
+
*Amount of loading dye added
-
Gel run:
+
-
* due to the small fragment sizes, we prepared a 2% agarose gel: 1.3 g agarose + 65 ml TAE buffer
+
-
* 25 µL of each sample + 5 µL loading dye (6x); 8µL marker <br>
+
-
* Expected fragment sizes: ~ 150 bp (both)
+
-
* Big problem: Small fragments and little amounts -> 150 bp fragments were nearly not visible. In addition to that, the right ITR sample delivered 2 fragments in the referring range. Therefore two gel extractions ("right ITR oben" and "right ITR unten") were performed.
+
-
<br>
+
-
 
+
-
Gel extraction:
+
-
<br>
+
-
* Sample: right ITR oben = 0.11 g <br>
+
-
* Sample: right ITR unten = 0.12 g <br>
+
-
* Sample: left ITR = 0.2 g <br>
+
-
Gel extraction was performed with special columns provided from Sven. In order to elute the samples 12 µL EB were used, columns were placed for 2 minutes into 50°C water bath and then centrifuged at 13200 rpm for 1 minute. <br>
+
-
<br>
+
-
DNA concentration:
+
-
<br>
+
-
* right ITR oben: 23.9 ng/µL
+
-
* right ITR unten: 13.8 ng/µL
+
-
* left ITR: 4.46 ng/µL
+
-
<br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Hybridization of ITR-Präfix-Oligos</p>
+
-
<br>
+
-
'''left ITR:'''
+
-
* 10 µL Oligo 1 (O43 = Präfix_for)
+
-
* 10 µL Oligo 2 (O44 = Präfix_rev)
+
-
* 4 µL 100 mM TrisHCl pH8
+
-
* 8 µL 5 mM MgCl2
+
-
* 8 µL H2O
+
-
Total: 40 mL
+
-
<br>
+
-
 
+
-
'''right ITR:'''
+
-
* 10 µL Oligo 1 (O47 = Präfix_for)
+
-
* 10 µL Oligo 2 (O48 = Präfix_rev)
+
-
* 4 µL 100 mM TrisHCl pH8
+
-
* 8 µL 5 mM MgCl2
+
-
* 8 µL H2O
+
-
Total: 40 mL
+
-
<br>
+
-
 
+
-
Because some of the oligos produce strong secondary structures, we used the ORIGAMI1 program:<br>
+
-
1) initial denaturation: 99°C, 7 minutes<br>
+
-
2) 99°C, 1 minute<br>
+
-
3) 73 x repetition of 2) -> -1°C, R = 0.3 °C/sec<br>
+
-
4) hold 4°C<br>
+
-
<br>
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Ligation of pGA14 + ITR + Präfix</p>
+
-
<br>
+
-
'''1. right ITR oben:'''
+
-
* Präfix: 1 µL
+
-
* ITR: 7 µL
+
-
* vector (pGA14): 9 µL
+
-
* buffer: 2 µL
+
-
* T4 ligase: 1 µL
+
-
Total volume: 20 µL
+
-
<br>
+
-
 
+
-
'''2. right ITR unten:'''
+
-
* Präfix: 1 µL
+
-
* ITR: 7 µL
+
-
* vector (pGA14): 9 µL
+
-
* buffer: 2 µL
+
-
* T4 ligase: 1 µL
+
-
Total volume: 20 µL
+
-
<br>
+
-
 
+
-
'''3. left ITR:'''
+
-
* Präfix: 1 µL
+
-
* ITR: 7 µL
+
-
* vector (pGA14): 9 µL
+
-
* buffer: 2 µL
+
-
* T4 ligase: 1 µL
+
-
Total volume: 20 µL
+
-
<br>
+
-
 
+
-
Samples will be incubating over night at 16°C.
+
-
 
+
-
====Ordering genes for the replacement of Rep and Cap parts====
+
-
Investigator: Volker guided by Sven & Tobi
+
-
 
+
-
The replacement for the Rep ORF from base 1510 to base 2008 and for the Cap ORF from base 3064 to base 3985 was ordered from Mr. Gene.
+
-
 
+
-
[[File:Freiburg10_Rep_Cap_Replacement.pdf‎]]
+
-
<br>
+
-
<br>
+
-
 
+
-
<p style="font-size:20px; font-weight: bold; color: fuchsia;"><u>Sequencing of GOI</u></p>
+
-
Hanna <br>
+
-
This time the sequencing delivered good results: <br>
+
-
[[File:GOI primer for.jpg|500px|]] <br>
+
-
[[File:GOI primer rev.jpg|500px|]] <br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Conclusion: The designed primers can always be used in order to sequence any gene of interest!!!</p>
+
-
<br>
+
-
<br>
+
-
 
+
-
===57.Labortag 13.07.2010:===
+
-
 
+
-
====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Endotoxin-free Midi Prep of pAAV_RC</u></p>====
+
-
Investigators: Chris, Stefan, Patrick<br>
+
-
Deviations from the Standard Protocol: <br>
+
-
As the lysate was applied to the column filter, about 1/5 of the lysate was spilled. <br>
+
-
Result of the Midi-prep: about 18 ng/µl => waste <br>
+
-
A new Midi-Pred will be prepared for tomorrow: 200 ml LB, 0,2 ml Amp, E.coli XL-1-blue (with pAAV_RC plasmid).
+
-
 
+
-
====<p style="font-size:20px; font-weight: bold; color: blue;"><u>HEK-293 cells</u></p>====
+
-
The cells were split according to the standard protocol. Investigator: Patrick
+
-
 
+
-
====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Oligos pMGMK_TK30 arrived</u></p>====
+
-
New Oligos arrived for inserting RFC25 to thymidinkinase_gmk construct!(number O60 to O65). They were resuspended in water and a 1:10 dilution was done. They were put in Primer Box 2.
+
-
<p style="font-size:12px; font-weight: bold; color: green;"><u>to do: perform PCR tomorrow and clone PCR product into pAAV_RFC25</u></p>
+
-
 
+
-
====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Transduction</u></p>====
+
-
 
+
-
Invetigators: Adrian, Patrick
+
-
* 3 Plates got transduced
+
-
 
+
-
1. Plate I(A is up) completely 10 µg
+
{| border="1"
{| border="1"
-
| 300µl dropped || align="right" |300µl resuspended|| align="right" |450µl resuspended
+
|<b>sample/µL </b>||align="right"| '''loading dye/µL'''
|-
|-
-
| 600µl dropped|| align="right" |600µl resuspended||  align="right" | control
+
| marker: 8 ||align="right"|contains loading dye
-
|-
+
-
|}
+
-
 
+
-
 
+
-
2. Plate II(A is up)completely 18 µg
+
-
{| border="1"
+
-
| 300µl dropped || align="right" |300µl resuspended|| align="right" |450µl resuspended
+
-
|-
+
-
| 600µl dropped||  align="right" |600µl resuspended||  align="right" | control
+
-
|-
+
-
|}
+
-
 
+
-
 
+
-
3. Plate III(A is up) completely 24 µg
+
-
{| border="1"
+
-
| 300µl dropped || align="right" |300µl resuspended|| align="right" |450µl resuspended
+
|-
|-
-
| 600µl dropped|| align="right" |600µl resuspended||  align="right" | control
+
|pAAV_MCS: 30 ||align="right"|6 (6x loading dye)
|-
|-
|}
|}
-
====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Results of Trafo of cloning CFP into pSB1C3</u></p>====
 
-
Investigator: Bea <br>
 
-
Results: no clones on trafo plate even after longer incubation at 37 °C<br>
 
-
'''Solution: perform digestion of linearized plasmid pSB1C3 and pMA_CFP again!!!'''
 
<br>
<br>
-
====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Repetition of cloning of CFP into pSB1C3</u></p>====
+
*Expected size of fragments
-
*experiment date: 13.07.2010 ; time: 16:00
+
-
*name of investigator: Bea
+
-
**Vector: name: pSB1c3 number: do not have any number production date: - origin: iGEM HQ sent per DNA distribution kit
+
-
**Insert: name: pMA_CFP number:- production date: - origin: iGEM 2009
+
-
*new vector name: pSB1c3_CFP (P48)
+
-
*buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab: 23) EcoRI ; Enzyme 2 (no.Lab: 48) PstI ;Enzyme 3 (no.Lab: 77) DpnI
+
-
*DNA concentration (vector: pSB1C3): 25 ng/µl ; DNA concentration (insert pMA_CFP): 436,8 µg/µl
+
-
<br />
 
-
'''Comments:'''The standard plasmid vector (pSB1C3) received from the iGEM HQ is linearized (PCR product) and need to be cut with EcoRI, PstI and optionally with DpnI to digest the DNA template. 
 
-
<br />
 
-
<br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion of pSB1C3 and pMA_CFP </p>
 
{| border="1"
{| border="1"
-
| '''components'''   || align="right" |'''volume of pSB1C3 /µl''' || align="right" |'''volume of pMA_CFP /µl'''  
+
| '''sample''' ||align="right"| '''expected size'''  
|-
|-
-
| DNA  ||  align="right" |4 || align="right" |4,6
+
|  align="right" | pAAV_MCS: cut with ClaI and BglII||align="right"|4580 bp
|-
|-
-
| BSA (100x) ||  align="right" |1,5 ||  align="right" | 2
 
-
|-
 
-
| Buffer 3 (10x)||  align="right" |1,5 ||  align="right" |2
 
-
|-
 
-
|Enzyme EcoRI (no.Lab:23)||  align="right" |0,5 ||  align="right" |1
 
-
|-
 
-
|Enzyme PstI (no.Lab:48)||  align="right" |0,5 ||  align="right" |1
 
-
|-
 
-
|Enzyme DpnI (no.Lab:77)||  align="right" |0,5 ||  align="right" |-
 
-
|-
 
-
|H2O||  align="right" |6,5 ||  align="right" |9
 
-
|-
 
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | 15||  align="right" |20
 
-
|-
 
-
|'''Incubation''' ||30 min at 37°C in PCR cycler||45min at 37°C in PCR cycler
 
-
|-
 
-
|'''commment''' ||after digestion: 80°C 20 min heat kill|| load on agarose gel
 
-
|}
 
-
*Load pMA_CFP digestion reaction onto 1% agarose gel
 
-
<br /><br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">1% Agarose-Gel</p>
 
-
<br />
 
-
0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 Volt, running time:45 minutes
 
-
<br />
 
-
<br />
 
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="blue"
 
-
!Sample
 
-
!Sample/µl]
 
-
!Loading dye (/6x)/µl
 
-
!Expected size 1 (Geneious)
 
-
!Expected size 2 (Geneious)
 
-
|--
 
-
|pMA_CFP
 
-
|20 µl
 
-
|4 µl
 
-
|732 bp (Insert)
 
-
|2974 bp (Vector)
 
-
|--
 
|}
|}
-
{| align=right
 
-
|}
 
-
<br />
 
-
'''Loading plan for agarose gel''': <br>
 
-
Marker used: GeneRuler ladder mix (Fermentas)<br>
 
-
{| border="1"
+
</ul>
-
|
+
-
!Marker
+
-
!Sample 24 µl
+
-
|-
+
-
!Lane
+
-
|1
+
-
|3
+
-
|-
+
-
|}
+
<br>
<br>
-
'''Results''': Expected bands too high, but lower band (= CFP) was cut out and gel extraction have been performed folowing standard protocol.
 
<br>
<br>
-
<br>
+
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction:</p>
-
<p style="font-size:12px; font-weight: bold; color: blue;">Gel extraction </p>has been performed and Nanodrop measurement reveals following concentraion of the insert CFP:
+
-
*c(CFP)= 6,75ng/µL
+
-
<br>
+
-
*Ligation ratio of vector/insert was calculated with LabTools
+
-
*v(pSB1C3)= 4,4 µL
+
-
*v(CFP)= 4,6 µL
+
-
*vQuickligase Buffer (2x)= 10µL
+
-
*vQuickLigase = 1µL
+
-
<br>
+
-
<p style="font-size:12px; font-weight: bold; color: blue;">Transformation </p>
+
-
*used bacterial strain: XL-1B
+
-
*2µL of DNA (pSB1C3_CFP)
+
-
*Trafo plate in 37°C room for incubating at 23:00
+
-
 
+
-
====TRANSFORMATION of Quickchange PstI====
+
-
Investigator: Kira
+
-
*Transfection was performed according to the standard protocol with XL1B cells.
+
-
 
+
-
===58.Labortag 14.07.2010: Seed HEK, DAAD Timetable, Summary, Ordering ITR+TKGMKI, Quickchange for the PstI restriction sites in pAAV-RC===
+
-
 
+
-
====Trafo evaluation of Quickchange PstI====
+
-
Investigator: Kira
+
<br />
<br />
-
Both plates contained lots of colonies, while 8-10 colonies are considered for inoculation to perform a mini prep and an additional test digestion.
+
Gel measurement:  
-
However, the experiment has to be repeated.
+
-
 
+
-
====Quickchange for the PstI restriction sites in pAAV-RC (modified)====
+
-
Invetigators: Kira
+
-
 
+
-
'''PCR program''': PstI
+
<br />
<br />
{| border="1"
{| border="1"
-
| components  || align="right" |volume in µl 
+
| align="left" | '''Sample''' ||align="left"| '''weight'''
-
|-
+
-
| 10x Phusion HF buffer  ||  align="right" | 2.5 µl
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" | 0.5 µl
+
-
|-
+
-
| __310 ____primer_for (1:10 dilution)||  align="right" |  0,39 µl
+
-
|-
+
-
| __310____primer_rev (1:10 dilution)||  align="right" |  0,39 µl
+
-
|-
+
-
|DNA template (1:40 dilution)||  align="right" |  0,5 µl
+
-
|-
+
-
|DMSO||  align="right" |  0.5 µl
+
-
|-
+
-
|Phusion polymerase|| align="right" | 0.5 µl
+
|-
|-
-
|H2O|| align="right" | 19.72 µl
+
| align="left" |pAAV_MCS ||align="left"| 60 mg
|-
|-
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 25 µl
 
|}
|}
-
<br />
+
*Gelextraction was performed following standard protocol.  
-
 
+
*DNA-concentrations were meassured: pAAV_MCS 18.2 ng/µL, Oligos: 136.7 ng/µL -> 1:10 dilution was prepared: 13.67 ng/µL
-
<br />
+
-
{| border="1"
+
-
| components  || align="right" |volume in µl 
+
-
|-
+
-
| 10x Phusion HF buffer  ||  align="right" | 2.5 µl
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" | 0.5 µl
+
-
|-
+
-
| __4073____primer_for (1:10 dilution)||  align="right" |  0.33 µl
+
-
|-
+
-
| ___4073___primer_rev (1:10 dilution)||  align="right" |  0.35 µl
+
-
|-
+
-
|DNA template (1:40 dilution)||  align="right" |  0.5 µl
+
-
|-
+
-
|DMSO||  align="right" |  0.5 µl
+
-
|-
+
-
|Phusion polymerase||  align="right" |  0.5 µl
+
-
|-
+
-
|H2O||  align="right" | 19.82 µl
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 25 µl
+
-
|}
+
-
<br />
+
-
{| border="1"
+
-
| cycles  || align="right" |temperature || align="right" |time
+
-
|-
+
-
| 1 ||  align="right" |95 C ||  align="right" |2 min 
+
-
|-
+
-
| 20 ||  align="right" |95 C ||  align="right" |30 sec
+
-
|-
+
-
|||  align="right" |68 C ||  align="right" |7 min
+
-
|}
+
-
<br />
+
-
*PCR products were digested with 0.5 µl and incubated @ 37 C for 1 h
+
-
 
+
-
'''TRANSFORMATION'''
+
-
*The transformation of XL1B was performed according to the standard protocol but with DYT instead of LB.
+
-
 
+
-
====Results of trafo cloning pSB1C3_CFP====
+
-
Investigator: Bea<br>
+
-
Comments: experiment have been repeated because no clones were grown after the last trafo!<br>
+
-
*There have been clones grown on the trafo plate. Four clones were picked and inoculated on LB_Medium containing Cm (Chloramphenicol).
+
-
*18:00: 37°C room on shaker. Incubating over night!
+
-
 
+
-
====Seed HEK====
+
-
Investigators: Adrian ,Bea
+
-
* 2x75cm2 culture flasks
+
-
* after counting via neubauer chamber (2,2*20*10000*(x/4))= should be around 3,xxx so it would be possible to prepare 4x10cm petri dishes with 3.000.000 cells per plate and passage 1.500.000 cells to a 75cm.
+
-
 
+
-
====DAAD Timetable====
+
-
Investigators: Adrian, Kerstin
+
-
 
+
-
====Summary====
+
-
Investigators:
+
-
<p style="font-size:12px; color: blue;">have not been done yet! to do for tomorrow! deadline of submitting project descrpition is 16th of july!!  (Bea)</p>
+
-
 
+
-
====Ordering ITR+TK/GMK====
+
-
Investigators: Bea, Sven
+
-
<ul>
+
-
*It has been ordered the TK30 with NgoMIV add-on prefix and ageI and SpeI add-on suffix combined with the  wt_left_ITR in the RFC10 standard.  
+
-
</ul>
+
-
 
+
-
====Endotoxoin free Midi prep mAAV_RC====
+
-
 
+
-
<br>Investigator: Chris W.
+
-
<br>Midi prep done with the Qiagen-Kit
+
-
<br>OD of the Bacteria: 3.07
+
-
<br>concentration:  429,8 and 378,5 ng/µl
+
-
<br>Labeled as P50 and stored in the -20° Freezer
+
-
 
+
-
====MGMK_TK30:PCR with iGEM restriction-sites and cloning into pAAV_RFC25====
+
-
 
+
-
Investigators:Achim,Bea,Anissa
+
-
 
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>PCR:</u></p>
+
-
 
+
-
*PCR program:mGMK_TK30
+
-
<br />
+
-
{| border="1"
+
-
| '''components'''  || align="right" |'''volume in µl''' 
+
-
|-
+
-
| 5x Phusion HF buffer  ||  align="right" |10
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" |1
+
-
|-
+
-
|pMGMK_TK30_RFC25_prefix_for (060) (1:10 dilution)||  align="right" |2,5 (0,5 µM) 
+
-
|-
+
-
|pMGMK_TK30_RFC25_suffix_rev (063) (1:10 dilution)||  align="right" |2,5 (0,5 µM)
+
-
 
+
-
|-
+
-
|DNA template||  align="right" | ~8 ng 
+
-
|-
+
-
|DMSO||  align="right" | - 
+
-
|-
+
-
|Phusion polymerase||  align="right" |0,5 
+
-
|-
+
-
|H2O||  align="right" |fill up to 50 µl
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" |50
+
-
|}
+
-
<br />
+
-
'''Comments:'''Oligos with add-on tails (prefix and suffix), but TK30 still contains three iGEM restriction sites (TK30 without restriction sites was ordered today)
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Practical Cloning:</u></p>
+
-
 
+
-
**Vector: name:pAAV_RFC25 number:p42
+
-
**Insert: name: MGMK_TK30 (after PCR with iGEM standard) number:-
+
-
*new vector name: pAAV_RFC25_MGMK_TK30
+
-
*buffer used:4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:149) AgeI ; Enzyme 2 (no.Lab:63) XbaI
+
-
*DNA concentration (vector):321,5 ng/µl ; DNA concentration (insert):
+
-
<br />
+
-
'''Comments:'''_____
+
-
<br />
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
+
-
{| border="1"
+
-
| components  || align="right" |volume of vector /µl || align="right" |volume of insert (=PCR product) /µl
+
-
|-
+
-
| DNA  ||  align="right" |3,1 (1 µg) ||  align="right" | 30 (0,691 µg)
+
-
|-
+
-
| BSA (100x) ||  align="right" |2 ||  align="right" | 5 µl
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" |2 ||  align="right" | 5µl
+
-
|-
+
-
|AgeI (no.Lab:149)||  align="right" |1 ||  align="right" | 2 µl
+
-
|-
+
-
|XbaI(no.Lab:63)||  align="right" |0,75 ||  align="right" | 1 µl
+
-
|-
+
-
|H2O||  align="right" |11,15 ||  align="right" | 7 µl
+
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" |20 ||  align="right" | 50 µl
+
-
|}
+
-
*Incubation: Vector: 1h; PCR product: 2h
+
<br /><br />
<br /><br />
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
<p style="font-size:15px; font-weight: bold; color: blue;">Ligation:</p>
<br />
<br />
-
0,5 g Agarose, 50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 (PCR); 115 (vector) Volt, running time:____ minutes
 
-
<br />
 
-
<br />
 
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
 
-
!Sample
 
-
!Sample/µl]
 
-
!Loading dye (5x/6x)/µl
 
-
!Expected size (Geneious)
 
-
 
-
|--
 
-
|PCR product
 
-
|50 µl
 
-
|10 µl
 
-
|~1692 bp
 
-
|--
 
-
|vector
 
-
|20 µl
 
-
|4 µl
 
-
|4646 bp
 
-
|--
 
-
 
-
 
-
|}
 
-
{| align=right
 
-
|}
 
-
<br />
 
-
*Marker: GeneRuler ladder mix
 
{| border="1"
{| border="1"
-
|
+
| align="left" | ||align="left"| '''iGEM-MCS''' ||align="left"| '''pAAV_MCS'''
-
!Marker
+
-
!Sample 60 /µl
+
-
|-
+
-
!Lane
+
-
|8 µl
+
-
|PCR
+
|-
|-
 +
| align="left" | '''Volume/µl''' ||align="left"| 0.4 ||align="left"| 8.6
|}
|}
<br />
<br />
-
*Marker: GeneRuler ladder mix
+
Trafo was performed (using XL1B cells) following standard protocol.
-
{| border="1"
+
<br>
-
|
+
<br>
-
!Marker
+
-
!Sample 24 /µl
+
-
|-
+
-
!Lane
+
-
|8 µl
+
-
|vector
+
-
|-
+
-
|}
+
-
<br />
+
-
'''Comments:''' two gels were made, one for the vector, one for the pcr product <br>
+
-
*Gel extraction was carried out according to standard protocol
+
====23. Labortag 07.06.2010: Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)====
-
*Nanodrop:
+
investigators: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea
-
**pAAV_rfc 25 Digestion: 15,07 ng/µl
+
<br>
-
**mgmk tk30 pcr product: 23,04 ng/µl
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-MCS</u></p>
-
 
+
<p style="font-size:15px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
-
*Puricifation using Quiagen QIAquick PCR Purification Kit Protocol
+
*experiment date:07.06.2010; time: whole day
-
**c(mgmk_tk30) = 8,1ng/µL
+
*name of investigator: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea
-
*Ligation of mgmk tk30 and pAAV_rfc 25
+
-
**v(vector) = 2,97 µL
+
-
**v(insert) = 6,03 µL
+
-
 
+
-
*Trafo
+
-
*put in 37°C room at 22:00
+
-
 
+
-
====Ordering of Oligos====
+
-
Investigator:Volker <br>
+
-
 
+
-
The following four Oligos were ordered:<br>
+
-
*SDM BamHI (729) for
+
-
*SDM BamHI (729) rev
+
-
*SDM SalI (1110) for
+
-
*SDM SalI (1110) rev
+
<br />
<br />
-
===59.Labortag 15.07.2010===
+
<u>Glycerol Stocks</u>
-
 
+
-
'''Picking clones for mini-prep''' <br />
+
-
Investigators: Adrian, Chris, Stefan
+
-
 
+
-
4 clones (1-4) of pAAV_RFC25_mgmk_tk30 where picked according to protocol for mini-prep (tomorrow). <br />
+
-
Antibiotic: Amp <br />
+
-
Time: 18:30
+
-
 
+
-
'''New millipore H2O, LB + Agar and DMEM medium were prepared''' <br />
+
-
Investigators: Stefan, Patrick
+
-
 
+
-
'''HT 1080 cells were split according to the standard protocol''' <br />
+
-
Investigators: Chris, Patrick
+
-
 
+
-
 
+
-
'''TRAFO EVALUATION (PstI Quickchange Trafo from 14.07)''' <br />
+
-
Investigator: Kira <br />
+
-
Unfortunately no colonies are present.
+
-
 
+
-
'''MINI PREP (PstI Quickchange Trafo from 13.07)''' <br />
+
-
Investigator: Kira
+
-
 
+
-
@Kira: ich habe die Clone benannt: SDM310 Nr. 1 ist jetzt P58 und sdm4073 nr 1 ist jetzt P59. Bitte eintragen.
+
-
 
+
-
'''TEST DIGESTION (PstI Quickchange Trafo from 13.07)''' <br />
+
-
Investigator: Kira
+
-
<br />
+
-
 
+
-
 
+
-
'''FACS''' <br />
+
-
Investigators: Kerstin, Anna <br />
+
-
 
+
-
FACS analysis of different treated HT1080 cells was done (18 samples)
+
-
 
+
-
The first percentage refers to the living and fluorescent cells and the second percentage to the total amout of living cells.
+
-
 
+
-
The data are listed this way:
+
-
 
+
-
1. Plate I(A is up)
+
{| border="1"
{| border="1"
-
|A1|| align="right" |A2|| align="right" |A3
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''
|-
|-
-
|B1|| align="right" |B2|| align="right" |B3
+
| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
|-
|-
-
|}
+
| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM-MCS ||align="left"| pAAV_iGEM-MCS||align="left"| pAAV_iGEM-MCS||align="left"| pAAV_iGEM-MCS
-
 
+
-
1= Plate 1 A1 : 0% YFP-positive Cells (there were only a few cells in this sample)<br>
+
-
2=  Plate 1 A2 : 27,7% YFP-positve Cells  from 73,3% <br>
+
-
3=  Plate 1 A3 : 17,3%      "           from 63,1% <br>
+
-
4=  Plate 2 A1 : 32,9%      "           from 75,3% <br>
+
-
5= Plate 2 A2 : 27,2%      "           from 76,5% <br>
+
-
6=  Plate 2 A3 : 30,7%      "           from 73,4% <br>
+
-
7=  Plate 3 A1 : 26,8%      "            from 76,0% <br>
+
-
8=  Plate 3 A2 : 30,5%      "            from 74,2% <br>
+
-
9=  Plate 3 A3 : 30,7%      "            from 75,2% <br>
+
-
10= Plate 1 B1 : 6,25%      "            from 36,1% <br>
+
-
11= Plate 1 B2 : 6,42%      "            from 68,4% <br>
+
-
12= Plate 1 B3 : 0,05%      "            from 89,5% <br>
+
-
13= Plate 2 B1 : 20,5%      "            from 72,5% <br>
+
-
14= Plate 2 B2 : 15,7%      "            from 73,6% <br>
+
-
15= Plate 2 B3 : 0,02%      "            from 85,4% <br>
+
-
16= Plate 3 B1 : 19,5%      "            from 73,3% <br>
+
-
17= Plate 3 B2 : 20,8%      "            from 75,7% <br>
+
-
18= Plate 3 B3 : 0,07%      "            from 84,8% <br>
+
-
 
+
-
The calculated value written into the table describes the fluorescent amount of cells from the living cells.
+
-
Example:  1 A2 : 27,7% YFP-positve cells of 73,3% living cells : 27,7/73,3 = 0,378
+
-
 
+
-
 
+
-
1. Plate I(A is up) completely 10 µg
+
-
{| border="1"
+
-
| 300µl dropped 0,00|| align="right" |300µl resuspended 0,378|| align="right" |450µl resuspended 0,274
+
|-
|-
-
| 600µl dropped 0,173|| align="right" |600µl resuspended 0,094|| align="right" | control 5,6x10^-4
+
| align="left" | '''Date''' ||align="left"| 07.06.2010 ||align="left"| 07.06.2010||align="left"| 07.06.2010||align="left"| 07.06.2010
|-
|-
 +
| align="left" | '''given number''' ||align="left"| - ||align="left"| B27 ||align="left"| B28||align="left"| B29
|}
|}
-
 
-
 
-
2. Plate II(A is up)completely 18 µg
 
-
{| border="1"
 
-
| 300µl dropped 0,437|| align="right" |300µl resuspended 0,356|| align="right" |450µl resuspended 0,418
 
-
|-
 
-
| 600µl dropped 0,283|| align="right" |600µl resuspended 2,1x10^-3||  align="right" | control 2,3x10^-4
 
-
|-
 
-
|}
 
-
 
-
 
-
3. Plate III(A is up) completely 24 µg
 
-
{| border="1"
 
-
| 300µl dropped 0,353|| align="right" |300µl resuspended 0,411|| align="right" |450µl resuspended 0,408
 
-
|-
 
-
| 600µl dropped 0,266||  align="right" |600µl resuspended 0,275||  align="right" | control 8,3x10^-4
 
-
|-
 
-
|}
 
-
 
-
 
-
<b>Conclusions </b>
 
-
* Higher amounts of Plasmids (24, 30µg) seems to have no obvious effect on YFP expression
 
-
* Theres no difference in YFP expression comparing resuspended samples to not resuspended samples
 
-
* The amount of dead HT cells is about 25%, it is not clear if it is either AAV induced or mechanic stress (Trypsin, washing procedure)
 
-
 
-
Next steps:
 
-
 
-
* does the amount of GOI (ng plasmids) has an effect on YFP expression 
 
-
* compare transduced to non transduced cells (vitality), or in other words is the mechanic stress responsible for 25% dead cell ratio?
 
-
* comparison of transduction efficiency of different virus stock production routines
 
-
 
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
 
-
*experiment date: 15.07.2010 ; time:10.00
 
-
*name of investigator: Kerstin, Anissa
 
-
*new vector name:pSB1C3_CFP
 
<br />
<br />
-
<u>Glycerol Stocks</u>
+
<u>Given Plasmid-Number</u>
{| border="1"
{| border="1"
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''  
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''  
|-
|-
-
| align="left" | '''Bacteria strain''' ||align="left"| XL1 blue ||align="left"| XL1 blue ||align="left"| XL1 blue ||align="left"| XL1 blue
+
| align="left" | '''given number''' ||align="left"| - ||align="left"| P34.2 ||align="left"| P34.3||align="left"| P34.4
-
|-
+
-
| align="left" | '''Plasmidname''' ||align="left"| pSB1C3_CFP ||align="left"| pSB1C3_CFP ||align="left"|pSB1C3_CFP ||align="left"| pSB1C3_CFP
+
-
|-
+
-
| align="left" | '''Date''' ||align="left"| 15.7.2010 ||align="left"| 15.7.2010 ||align="left"| 15.7.2010 ||align="left"| 15.7.2010
+
-
|-
+
-
| align="left" | '''given glycerol-stock no.''' ||align="left"| B38 ||align="left"| B39 ||align="left"| B40 ||align="left"| B41
+
-
|-
+
-
| align="left" | '''given plasmid no.''' ||align="left"| p48 ||align="left"| p51 ||align="left"| p52 ||align="left"| p53
+
|}
|}
<br />
<br />
-
 
<p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
<p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
-
*buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:48)PstI ; Enzyme 2 (no.Lab:23) EcoRI
+
*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) NdeI
*Plasmid
*Plasmid
-
**Given Plasmid-Number: p48; DNA concentration: 195,1 ng/µl ;
+
**Given Plasmid-Number: P34.2; DNA concentration: 433.78 ng/µL ;
-
**Given Plasmid-Number: p51; DNA concentration: 230,1 ng/µl;
+
**Given Plasmid-Number: P34.3; DNA concentration: 408.48 ng/µL ;
-
**Given Plasmid-Number: p52; DNA concentration: 134,1 ng/µl;
+
**Given Plasmid-Number: P34.4; DNA concentration: 409.80 ng/µL ;
-
**Given Plasmid-Number: p53; DNA concentration: 244,1 ng/µl;
+
 
<br />
<br />
-
'''Comments:'''p48 and p51 were sequenzed
+
'''Comments:'''Clone no.1 was dismissed...
<br />
<br />
<br />
<br />
 +
'''Test digestion:'''
{| border="1"
{| border="1"
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix'''  
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix'''  
|-
|-
-
| align="left" | DNA ||align="left"| Variable (800-1000 ng) ||align="left"| -
+
| align="left" | DNA (clone 2)||align="left"| 1000 ng ||align="left"| -
|-
|-
-
| align="left" | BSA (100x) ||align="left"| 1,5 ||align="left"| 7,5
+
| align="left" | BSA (10x) ||align="left"| no ||align="left"| -
|-
|-
-
| align="left" | Buffer no.3    (10x) ||align="left"| 1,5 ||align="left"| 7,5
+
| align="left" | Buffer no. 4 (10x) ||align="left"| 1.5 µL||align="left"| -
|-
|-
-
| align="left" | Enzyme 1 (no. Lab:48   ) ||align="left"| 0,5 ||align="left"| 2,5
+
| align="left" | Enzyme 1 (no. Lab:    ) AgeI ||align="left"| 0.75 µL ||align="left"| -
|-
|-
-
| align="left" | Enzyme 2 (no. Lab:23   ) ||align="left"| 0,5 ||align="left"| 2,5
+
| align="left" | Enzyme 2 (no. Lab:    ) NdeI ||align="left"| 0.5 µL||align="left"| -
|-
|-
-
| align="left" | H2O ||align="left"| variable ||align="left"| -
+
| align="left" | H<sub>2</sub>O ||align="left"| variable ||align="left"| -
|-
|-
-
| align="left" | '''Total volume''' ||align="left"| 15 ||align="left"| -
+
| align="left" | '''Total volume''' ||align="left"| '''15 µL''' ||align="left"| -
|}
|}
<br />
<br />
{| border="1"  
{| border="1"  
-
| Sample  || align="right" | Volume sample/ µl ||align="right"| Volume H2O / µl
+
| Sample  || align="right" | Volume sample/ µl ||align="right"| Volume H<sub>2</sub>O / µl
|-
|-
-
| p48 ||  align="right" | 5 ||align="right"| 6
+
| P34.2  ||  align="right" |2.3 ||align="right"| 9.95
|-
|-
-
| p51 ||  align="right" | 4 ||align="right"| 7
+
| P34.3 ||  align="right" | 2.4 ||align="right"| 9.85
|-
|-
-
| p52 ||  align="right" | 7 ||align="right"| 4
+
| P34.4 ||  align="right" | 2.4||align="right"| 9.85
|-
|-
-
| p53  ||  align="right" | 4 ||align="right"| 7
+
 
|-
|-
|}
|}
-
*Incubation: 1h
+
*Incubation: 45 min, 37°C
<br />
<br />
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
<br />
<br />
-
0,5 g Agarose, 50 TAE (1%), 3GELRED (3-6µl), at 110Volt, running time:30 minutes
+
0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 110 Volt, running time: 45 minutes
<br />
<br />
<br />
<br />
Line 1,914: Line 685:
!Sample
!Sample
!Sample/µl]
!Sample/µl]
-
!Loading dye (6x)/µl
+
!Loading dye (5x/6x)/µl
-
!Expected size (Geneious)
+
!Expected size 1 (Geneious)
-
 
+
!Expected size 2 (Geneious)
|--
|--
-
|p48
+
|P34.2
|15 µl  
|15 µl  
|3 µl
|3 µl
-
|700 bp
+
|3686 bp
 +
|951 bp
|--
|--
-
|p51
+
|P34.3
|15 µl  
|15 µl  
|3 µl
|3 µl
-
|700 bp
+
|3686 bp
 +
|951 bp
|--
|--
-
|p52
+
|P34.4
-
|15 µl
+
|15 µl  
|3 µl
|3 µl
-
|700 bp
+
|3686 bp
-
 
+
|951 bp
|--
|--
-
|p53
 
-
|15 µl
 
-
|3 µl
 
-
|700 bp
 
-
|--
 
|}
|}
Line 1,951: Line 719:
|
|
!Marker
!Marker
-
!Sample p48 /µl
+
!Sample  
-
!Sample p51 /µl
+
!Sample
-
!Sample p52 /µl
+
!Sample  
-
!Sample p53 /µl
+
|-
|-
!Lane  
!Lane  
-
|8 µl
+
|34.2 / 18 µl
-
|18µl
+
| 34.3 / 18 µl
-
|18µl
+
|34.4 / 18 µl
-
|18µl
+
 
-
|18µl
+
|-
|-
|}
|}
<br />
<br />
-
'''Comments:''' Gel was leaky, therefore two samples "flew through". Plasmid p48 and p51 were sent for sequencing.
 
-
<br>
 
-
<br>
 
-
 
-
<p style="font-size:20px; font-weight: bold; color: fuchsia;"><u>2nd try: First steps in producing ITR BioBricks via Fancy Method</u></p>
 
-
'''Hanna''' <br>
 
-
<br>
 
-
Unfortunately it turned out, that the digestion step of the 1st try didn't work: After the transformation very much colonies grew on the plates. Sequencing delivered, that survival of the bacteria was due to re-ligated vector... Therefore the whole experiment will be performed again today.
 
-
<br> 
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pGA14_Cerulean-CFP</p>
 
-
<br>
 
-
'''1. Digestion with EcoRI and NotI:'''
 
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Kleinschmidt-plasmids</u></p>
 +
<p style="font-size:15px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
 +
*experiment date: 07.06.2010 ; time: 10 – 20 h
 +
*name of investigator: Kira, Achim, Jessy, Bea, Adrian, Hanna
 +
*Kleinschmidt-plasmids
 +
<br />
 +
<u>Glycerol Stocks</u>
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7''' ||align="left"| '''Clone 8''' ||align="left"| '''Clone 9''' ||align="left"| '''Clone 10''' ||align="left"| '''Clone 11''' ||align="left"| '''Clone 12''' ||align="left"| '''Clone 13'''
|-
|-
-
| DNA  || align="right" | 3.4
+
| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
|-
|-
-
| BSA (10x) || align="right" | 2
+
| align="left" | '''Plasmidname''' ||align="left"| pXX6 ||align="left"| pKEX-2XL.Rep 40 ||align="left"| pKEX-2XL.Rep 52 ||align="left"| pKEX-2XL.Rep 68 ||align="left"| pKEX-2XL.Rep 78 ||align="left"| pCMV-VP(HS) ||align="left"| pKEX-VP1 ||align="left"| pKEX-VP2 ||align="left"| pKEX-VP3 ||align="left"| pTRUF_CMV_eGFP ||align="left"| dsAAV_CMV_eGFP ||align="left"| pTAV2||align="left"| pDG
|-
|-
-
| Buffer 4 (10x) ||  align="right" | 2
+
| align="left" | '''Date''' ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010
|-
|-
-
|Enzyme EcoRI-HF || align="right" | 1
+
| align="left" | '''given number''' ||align="left"| B14 ||align="left"| B15 ||align="left"| B16 ||align="left"| B17 ||align="left"| B18 ||align="left"| B19 ||align="left"| B20 ||align="left"| B21 ||align="left"| B22 ||align="left"| B23 ||align="left"| B24 ||align="left"| B25 ||align="left"| B26 
-
|-
+
-
|Enzyme NotI-HF || align="right" | 1
+
-
|-
+
-
|H2O|| align="right" | 10.6
+
-
|-
+
-
|'''Total volume'''|| align="right" | 20
+
|}
|}
-
<br>
 
-
Incubation: 1.5 hours, 37°C in thermocycler
 
-
<br>
 
-
Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker <br>
+
<br />
-
Expected fragment size: ~ 2900 bp
+
<u>Given Plasmid-Number</u>
-
<br>
+
-
 
+
-
Gel extraction:
+
-
<br>
+
-
Sample weight: 0.31 g <br>
+
-
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C.  <br>
+
-
<br>
+
-
DNA concentration: 43 ng/µL
+
-
<br>
+
-
<br>
+
-
'''1. Digestion with XbaI and PstI:'''
+
-
<br>
+
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7'''||align="left"| '''Clone 8''' ||align="left"| '''Clone 9''' ||align="left"| '''Clone 10'''||align="left"| '''Clone 11''' ||align="left"| '''Clone 12''' ||align="left"| '''Clone 13'''
|-
|-
-
| DNA  ||  align="right" | 3.4
+
| align="left" | '''given number''' ||align="left"| P21 ||align="left"| P22 ||align="left"| P23 ||align="left"| P24 ||align="left"| P25 ||align="left"| P26 ||align="left"| P27 ||align="left"| P28 ||align="left"| P29 ||align="left"|  P30 ||align="left"| P31 ||align="left"| P32 ||align="left"| P33
|-
|-
-
| BSA (10x) || align="right" | 2
+
| align="left" | '''measured concentration''' ||align="left"|351,01 ||align="left"| 673,1 ||align="left"| 532,22 ||align="left"| 579,05 ||align="left"| 725,31 ||align="left"| 659,68||align="left"| 692,8 ||align="left"| 545,46 ||align="left"| 568,34 ||align="left"|  420,62 ||align="left"| 446,95 ||align="left"| 496,8 ||align="left"| 472,58
-
|-
+
-
| Buffer 4 (10x) || align="right" | 2
+
-
|-
+
-
|Enzyme XbaI || align="right" | 1
+
-
|-
+
-
|Enzyme PstI-HF || align="right" | 1
+
-
|-
+
-
|H2O||  align="right" | 10.6
+
-
|-
+
-
|'''Total volume'''|| align="right" | 20
+
|}
|}
 +
<br />
<br>
<br>
-
Incubation: 1.5 hours, 37°C in thermocycler
+
'''Comments:'''
 +
Many things went wrong today!
 +
* Glycerol stocks must be vortexted!
 +
* Check mini-prep buffers - especially buffer PE (needs to contain ethanol!)
 +
* Always check volumes - try to estimate if volume makes sense (check pipettes!)
 +
* Don't discard bacteria cultures until glycerol stocks and mini-preps are successfully done!!!
 +
<p style="font-size:20px; font-weight: bold; color: red;">'''Today's conclusion: Better ask 2 times than do something wrong without asking!!!'''</p>
<br>
<br>
-
 
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)</u></p>
-
Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker <br>
+
-
Expected fragment size: ~ 2900 bp
+
<br>
<br>
-
 
+
'''Quickchange site directed mutagenesis:'''
-
Gel extraction:
+
PCR reaction:
 +
* 2.5 µL 10x Pfu Ultra II buffer
 +
* 0.5 µL template (therefore the a 1:20 dilution of the pAAV_iGEM-MCS (433 ng/µL) was prepared) = 10.825 ng
 +
* 0.56 µL primer 1 (of 1:10 dilution)
 +
* 0.56 µL primer 2 (of 1:10 dilution)
 +
* 1 µL DMSO (primers form very strong secondary structures)
 +
* 0.5 µL dNTP
 +
* 18.88 µL dH<sub>2</sub>O
 +
* 0.5 µL PfuUltra II fusion (1.25 U)
 +
-> end volume: 25 µL
<br>
<br>
-
Sample weight: 0.31 g <br>
 
-
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C. <br>
 
<br>
<br>
-
DNA concentration: 38.6 ng/µL
+
'''PCR program:'''
<br>
<br>
 +
1 x : 2' 95°C (HotStart polymerase)
 +
20 x : 30 s 95°C -> 1' 55°C -> 5' 68°C
 +
1 x : 4°C (over night)
<br>
<br>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pAAV_MCS with AlwNI</p>
+
Experiment will be continued tomorrow.
<br>
<br>
-
{| border="1"
 
-
| components  || align="right" |volume of vector /µl
 
-
|-
 
-
| DNA  ||  align="right" | 17.86 = 5 µg
 
-
|-
 
-
| BSA (10x) ||  align="right" | -
 
-
|-
 
-
| Buffer 4 (10x) ||  align="right" | 3
 
-
|-
 
-
|Enzyme AlwNI (no.Lab:120)||  align="right" | 3
 
-
|-
 
-
|H2O||  align="right" | 6.14
 
-
|-
 
-
|'''Total volume'''||  align="right" | 30
 
-
|}
 
-
<br>
 
-
Incubation: 1.5 hours , 37°C in thermocycler
 
<br>
<br>
-
Gel run: 30 µL sample + 6 µL loading dye (6x); 8µL marker <br>
+
====24. Labortag 08.06.2010: Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis====
-
Expected fragment sizes: 2982 bp = right ITR and 1674 bp = left ITR
+
-
<br>
+
-
Gel extraction:
+
Investigators: Kira, Jessy, Hanna, Achim <br>
-
<br>
+
-
* Sample: right ITR = 0.19 g <br>
+
-
* Sample: left ITR = 0.17 g <br>
+
-
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C. Further on 30 µL EB-buffer was used.<br>
+
-
<br>
+
-
DNA concentration:
+
-
<br>
+
-
* right ITR: '''59.8 ng/µL'''
+
-
* left ITR: '''46.2 ng/µL'''  '''  :)'''
+
-
<br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of ITR fragments with NotI and PstI</p>
+
-
<br>
+
-
Digestion of right ITR fragment:
+
-
{| border="1"
+
-
| components  || align="right" |volume of vector /µl
+
-
|-
+
-
| DNA  ||  align="right" | 30 µL
+
-
|-
+
-
| BSA (100x) ||  align="right" | 0.5
+
-
|-
+
-
| Buffer 4 (10x) ||  align="right" | 3.74
+
-
|-
+
-
|Enzyme NotI-HF ||  align="right" | 1.5
+
-
|-
+
-
|Enzyme PstI-HF ||  align="right" | 1.5
+
-
|-
+
-
|H2O||  align="right" | -
+
-
|-
+
-
|'''Total volume'''||  align="right" | 37.4
+
-
|}
+
-
<br>
+
-
Incubation: 50 minutes, 37°C in thermocycler
+
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Analysis of iGEM-MCS sequence (RFC25 without EcoRI and NotI):</u></p> <br>
 +
[[File:Freiburg10 iGEM-MCS.jpg|800x800px|]] <br>
 +
The alignment with the theoretical pAAV_iGEM-MCS delivered a "C-deletion" within the NgoMIV restriction site. Due to that the pAAV_iGEM-MCS lacks this site. We controlled the bill of delivery and noted that the deletion must be GATC's fault.
 +
All in all this doesn't matter, because parts which are in iGEM standard can be inserted and therefore they will deliver the lacking NgoMIV restriction site. Further on this could be an advantage because after digestion the fragment which is cut out can be better detected in the gel.
<br>
<br>
-
Digestion of left ITR fragment:
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Insertion of mVenus_YFP into pAAV_iGEM-MCS</u></p>
 +
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion:</p>
 +
 
 +
<li>plasmid: insert: pGA14mVenusGeneart; number: - origin:Sven
 +
<li>plasmid: vector: pAAV_iGEM-MCS; number: P32.2  production date:05.06.2010 origin: ____
 +
<li>new vector name: pAAV_iGEM-MCS_mVenus <br>
 +
<li>buffer used:4 ; Restriction-enzymes used: Enzyme AgeI (no. Lab:149); Enzyme XbaI (no. Lab: 63)
 +
<li>DNA concentration (vector):433,78ng/µl ; DNA concentration (insert): 530 ng/µl<br /><br />
 +
 
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl
+
| components  || align="right" | V (pAAV_iGEM-MCS)/ µl ||align="right"| I(pGA14mVenus_Geneart) / µl
|-
|-
-
| DNA  ||  align="right" | 30 µL
+
| DNA  ||  align="right" | 2,3||align="right"|3,8
|-
|-
-
| BSA (100x) ||  align="right" | 0.5
+
| BSA (10x) ||  align="right" |2||align="right"|2
|-
|-
-
| Buffer 4 (10x) ||  align="right" | 3.72
+
| Buffer 3 (10x)||  align="right" |2||align="right"|2
|-
|-
-
|Enzyme NotI-HF ||  align="right" | 1.5
+
|Enzyme: AgeI (no.Lab:149)||  align="right" |1,25||align="right"|1,25
|-
|-
-
|Enzyme PstI-HF ||  align="right" | 1.5
+
|Enzyme: XbaI (no.Lab:63)||  align="right" |0,75||align="right"|0,75
|-
|-
-
|H2O||  align="right" | -
+
|H<sub>2</sub>O||  align="right" |11,7||align="right"|10,2
|-
|-
-
|'''Total volume'''||  align="right" | 37.2
+
|'''Total volume'''||  align="right" |<b>20</b>||align="right"|<b>20</b>
|}
|}
-
<br>
 
-
Incubation: 50 minutes, 37°C in thermocycler
 
-
<br>
 
-
Gel run:
 
-
* due to the small fragment sizes, a 2% agarose gel was prepared.
 
-
* 5 µL loading dye was added to the whole volume of each sample; 8µL marker <br>
 
-
* 115 V, 40 minutes <br>
 
-
* Expected fragment sizes: ~ 150 bp (both)
 
-
* Problem: Small fragments, little amounts, blurred 150 bp bands -> fragments were cut out broad-minded.
 
-
<br>
 
-
Gel extraction:
+
<li> Incubation: 1 1/2 h at 37°C<br>
-
<br>
+
-
* Sample: right ITR oben = 0.4 g <br>
+
-
* Sample: left ITR = 0.36 g <br>
+
-
Gel extraction was performed following standard protocol. After applying EB buffer to the columns, they were placed for 2 minutes into 50°C water bath and then centrifuged at 13200 rpm for 1 minute. <br>
+
-
<br>
+
-
DNA concentration:
+
-
<br>
+
-
* right ITR: 4 ng/µL
+
-
* left ITR: 4 ng/µL
+
-
<br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Hybridization of ITR-Präfix-Oligos</p>
+
-
<br>
+
-
'''left ITR:'''
+
-
* 10 µL Oligo 1 (O43 = Präfix_for)
+
-
* 10 µL Oligo 2 (O44 = Präfix_rev)
+
-
* 4 µL 100 mM TrisHCl pH8
+
-
* 8 µL 5 mM MgCl2
+
-
* 8 µL H2O
+
-
Total: 40 mL
+
-
<br>
+
-
'''right ITR:'''
+
0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 115 Volt, running time:  
-
* 10 µL Oligo 1 (O47 = Präfix_for)
+
<br />
-
* 10 µL Oligo 2 (O48 = Präfix_rev)
+
<br />
-
* 4 µL 100 mM TrisHCl pH8
+
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
-
* 8 µL 5 mM MgCl2
+
!Sample
-
* 8 µL H2O
+
!Sample/µl]
-
Total: 40 mL
+
!Loading dye (6x)/µl
-
<br>
+
!Expected size 1 (Geneious)
 +
!Expected size 2 (Geneious)
 +
|--
 +
|P34.2
 +
|20 µl
 +
|4 µl
 +
|4617 bp
 +
|22 bp
-
Because some of the oligos produce strong secondary structures, we used the ORIGAMI1 program:<br>
+
|--
-
1) initial denaturation: 99°C, 7 minutes<br>
+
|pGA14mVenus
-
2) 99°C, 1 minute<br>
+
|20 µl
-
3) 73 x repetition of 2) -> -1°C, R = 0.3 °C/sec<br>
+
|4 µl
-
4) hold 4°C<br>
+
|2870 bp
-
<br>
+
|774 bp
 +
|}
 +
<br /><br />
 +
<li>Gel loaded with vector and insert samples, 24 µl each & 8 µl marker
 +
<li>after 20 minutes, the insert band was cut out. Two overlapping bands were visible in the vector well, after 1 1/2 hours those bands were separated and both were cut out. <br /><br />
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Ligation of pGA14 + ITR + Präfix</p>
 
-
<br>
 
-
'''1. right ITR'''
 
-
* Präfix: 2 µL
 
-
* ITR: 10 µL
 
-
* vector (pGA14): 5 µL
 
-
* buffer: 2 µL
 
-
* T4 ligase: 1 µL
 
-
Total volume: 20 µL
 
-
<br>
 
-
 
-
'''2. left ITR'''
 
-
* Präfix: 2 µL
 
-
* ITR: 10 µL
 
-
* vector (pGA14): 5 µL
 
-
* buffer: 2 µL
 
-
* T4 ligase: 1 µL
 
-
Total volume: 20 µL
 
-
<br>
 
-
 
-
'''3. control 1:'''
 
-
* vector 1 (pGA14, digested with EcoRI + NotI): 5 µL
 
-
* buffer: 2 µL
 
-
* T4 ligase: 1 µL
 
-
* H2O: 12 µL
 
-
Total volume: 20 µL
 
-
<br>
 
-
 
-
'''4. control 2:'''
 
-
* vector 2 (pGA14, digested with XbaI + PstI): 5 µL
 
-
* buffer: 2 µL
 
-
* T4 ligase: 1 µL
 
-
* H2O: 12 µL
 
-
Total volume: 20 µL
 
-
<br>
 
-
 
-
Samples will be incubating over night at 16°C.
 
-
'''To do:''' Trafo (Agar plates were already prepared.)
 
-
<br>
 
-
<br>
 
-
 
-
===60.Labortag 16.07.2010===
 
-
<br>
 
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Continuation of Fancy Method</u></p>====
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Trafo</u></p>
 
-
'''Hanna''' <br>
 
-
<br>
 
-
Trafo was performed following standard protocol. Aberration: Instead of 2 µL, 3 µL DNA was added to BL21 bacteria (50 µL).
 
-
<br>
 
-
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>right ITR</u></p>
 
-
'''Hanna''' <br>
 
-
<br>
 
-
It turned out, that the strategy by digesting pGA14 with XbaI and PstI cannot work. pGA14 needs to be digested with '''EcoRI''' and PstI: <br>
 
-
<br>
 
-
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pGA14_Cerulean-CFP with EcoRI and PstI</p>
 
-
<br>
 
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl
+
| Sample|| align="right" | weight || align="right" | concentration
|-
|-
-
| DNA ||  align="right" | 3.4
+
| Vektor_Oben ||  align="right" |0,32 g  ||  align="right" |29,8 ng/µl
|-
|-
-
| BSA (10x) ||  align="right" | 2
+
| Vektor_Unten ||  align="right" |0,14 g  ||  align="right" |12,8 ng/µl
|-
|-
-
| Buffer 4 (10x) ||  align="right" | 2
+
| Insert||  align="right" |0,3 g ||  align="right" |12,9 ng/µl
-
|-
+
-
|Enzyme EcoRI-HF || align="right" | 1
+
-
|-
+
-
|Enzyme PstI-HF ||  align="right" | 1
+
-
|-
+
-
|H2O||  align="right" | 10.6
+
-
|-
+
-
|'''Total volume'''||  align="right" | 20
+
-
|}
+
-
<br>
+
-
Incubation: 1 hour, 37°C in thermocycler
+
-
<br>
+
-
Gel run: 1% gel, 20 µL sample + 4 µL loading dye (6x); 8µL marker <br>
 
-
Expected fragment size: ~ 2900 bp
 
-
<br>
 
-
 
-
Gel extraction:
 
-
<br>
 
-
Sample weight: 170 mg <br>
 
-
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C.  <br>
 
-
<br>
 
-
DNA concentration: 26.8 ng/µL
 
-
<br>
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pAAV_MCS with NotI and PstI</p>
 
-
In order to create ITRs with NotI and PstI restriction sites, the AlwNI-digestion step was skipped. Therefore 50% of the constructs will also contain the left ITR... this means: picking more colonies and sequencing! <br>
 
-
 
-
 
-
{| border="1"
 
-
| components  || align="right" |volume of vector /µl
 
-
|-
 
-
| DNA  ||  align="right" | 10.71
 
-
|-
 
-
| BSA (10x) ||  align="right" | 2
 
-
|-
 
-
| Buffer 4 (10x) ||  align="right" | 2
 
-
|-
 
-
|Enzyme EcoRI-HF ||  align="right" | 1
 
-
|-
 
-
|Enzyme PstI-HF ||  align="right" | 1
 
-
|-
 
-
|H2O||  align="right" | 3.29
 
-
|-
 
-
|'''Total volume'''||  align="right" | 20
 
|}
|}
-
<br>
+
<br /><br />
-
Incubation: 1 hour, 37°C in thermocycler
+
<li>the exact volume of insert and vector was calculated with LabTools:
-
<br>
+
<li>Ligation I with Vektor_Oben:
 +
<ul>
 +
*Vector: 4,16 µl
 +
*Insert: 4,84 µl
 +
</ul>
 +
<li>Ligation II with Vektor_Unten:
 +
<ul>
 +
*Vector: 6 µl
 +
*Insert: 3 µl
 +
</ul>
-
Gel run: 2% gel, 20 µL sample + 4 µL loading dye (6x); 8µL marker <br>
 
-
Expected fragment size: ~ 150 bp
 
-
<br>
 
-
'''Gel run delivered no satisfying results. Therefore the gel was discarded and the strategy changed: The residual right ITR solution of yesterday's elution will be taken for ligation.
 
-
'''
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Ligation of right ITR + Präfix + pGA14</p>
 
-
<br>
 
-
* ITR: 7 µL
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>continuation of site-directed mutagenesis</u></p>
-
* pGA14: 7 µL
+
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion with DpnI:</p>
-
* Präfix: 1.5 µL
+
<li>0.5 µl DpnI added
-
* Buffer: 2 µL
+
<li>incubated for 1 hour at 37°C
-
* T4 ligase: 1 µL
+
-
* H2O: 1.5 µL
+
-
Total: 20 µL
+
-
<br>
+
-
* pGA14: 7 µL
+
<p style="font-size:15px; font-weight: bold; color: blue;">Trafo:</p>
-
* Buffer: 2 µL
+
-
* T4 ligase: 1 µL
+
-
* H2O: 10 µL
+
-
Total: 20 µL
+
-
<br>
+
-
The ligation-solution will be incubating over night.
+
<li>Cells used for transformation: XL1B
 +
<li>Centrifugation for 3 min at 8000 rpm instead of 6000 rpm (accidentaly)
 +
<li>Plated on agar plate: pAAV_IGEM-MCS Mutagenese PST1 8.6.2010 AM XL1B
 +
<li>incubated over night
<br>
<br>
<br>
<br>
-
'''To do:'''
+
====25. Labortag 09.06.2010: pAAV_iGEM-MCS_mVenus-YFP, site-directed mutagenesis====
-
* Mini-Prep of pGA14_präfix_leftITR 
+
investigators: Jessy, Achim, Sven, Toby, Hanna
-
* Trafo of pGA14_präfix_rightITR
+
-
* Midi-Prep of pGA14
+
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: red;">'''No pAAV_iGEM-MCS_w/oPstI transformed bacteria (site-directed mutagensis) grew on the ampicillin agar plates over night! '''</p> Experiment is conducted again by Toby (Thanks a lot!!!).<br>
<br>
<br>
-
 
+
<p style="font-size:15px; font-weight: bold; color: red;">'''Further on the cloning of mVenus-YFP into pAAV_iGEM-MCS seemed to fail: '''</p> Only on the agar plate cotaining the bacteria transformed with the "vector_oben" ligation, which actually should be the "wrong" ligation (gelextraction of a band which contained fragments that were too large, see picture in lab journal), revealed colonies. Therefore this experiments is also conducted one more time by Sven (thanks also a lot!!!)<br>
-
====<p style="font-size:15px; font-weight: bold; color: blue;">Results sequencing of pSB1C3_CFP</p>====
+
-
'''Investigator: Bea'''<br>
+
-
Plasmid: pSB1C3_CFP <br>
+
-
Primer used: VR2 <br>
+
-
Plasmid names: P48_KK and P51_AB<br>
+
-
'''Comments''': Sequencing results of cloning experiment performed at 14.-15.07.2010. <br>
+
<br>
<br>
-
<p style="font-size:13px; font-weight: bold; color: green;">'''Results''': Sequencing reads are good. Cloning of CFP into pSB1C3 can be confirmed. There are no insertions, transitions or deletions in the sequence or the iGEM restriction sites. Using this plasmid in order to create our iGEM BioBricks in RFC10 standard can be confirmed. </p>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Insertion of mVenus_YFP into pAAV_iGEM-MCS</u></p>
-
<br>
+
*experiment date: 9.6.2010
-
[[File:Freiburg10 Sequencing results pSB1C3 CFP P48 KK.jpg|500px|thumb|left|Sequencing results of '''pSB1C3_CFP (plasmid number P48)'''. There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).]]
+
*name of investigator: Sven
-
 
+
*plasmid:  
-
[[File:Freiburg10 Sequencing results pSB1C3 CFP P51 AB.jpg|500px|thumb|right|Sequencing results of '''pSB1C3_CFP (plasmid number P51'''). There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).]]
+
**Vector: name: pAAV_iGEM-MCS number: 34.2 production date: 5.6.2010
-
<br>
+
**Insert: name: pOG14_mVenus number: - production date: ____ origin: Sven :)
-
<br>
+
*new vector name: pAAV_iGEM-MCS_mVenus-YFP
-
<br>
+
*buffer used: NEB4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) XbaI
-
<br>
+
*DNA concentration (vector): 433 ng/µL ; DNA concentration (insert): 530 ng/µL
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<p style="font-size:18px;"> BioBrick production with hGH and beta-globin by cloning it into pSB1C3</p>
+
-
 
+
-
'''Investigator: Bea'''<br>
+
-
Plasmid:  pSB1C3_CFP <br>
+
-
Plasmid names: pSB1C3 (P51 or P48) and PCR prdouct of hGH and beta-globin<br>
+
-
<br>
+
-
'''Comments''': While cloning theoretically the hGH PCR product into the vector pSB1C3, it was recognized that the primers that were used for PCR for
+
-
*hGH RFC10 production and
+
-
*beta-globin intron RFC10 production
+
-
do not contain the required "G" at the end of the prefix  and the "T" in the suffix add-on in the RFC10 standard. They were already used by performing a PCR with the add-on prefix and suffix primer, but we did not clone it into the pSB1C3 because of the wrong add-on tails. Therefore new primers were designed and ordered.
+
-
<br>
+
-
 
+
-
<br>
+
-
[[File:Freiburg10 BioBrick beta-globin missing G.jpg]]
+
-
<br><br>
+
-
<p style="font-size:15px; font-weight: bold; color: purple;">Ordered oligos:</p>
+
-
 
+
-
hGH
+
-
*suffix (reverse)
+
-
*prefix (forward)
+
-
beta-globin
+
-
*suffix (reverse)
+
-
*prefix (forward)
+
-
CMV
+
-
*suffix (reverse)
+
-
*prefix (forward)
+
-
TK_GMK
+
-
*tk_gmk_prefix for
+
-
*tk_gmk_suffix_rev
+
-
*gmk_suffix_rev
+
-
 
+
-
<br>
+
-
<p style="font-size:14px; font-weight: bold; color: Turquoise;">To do: Upload cloning strategy of tk_gmk and BioBrick production</p>
+
-
<br>
+
-
--[[User:Beate|Bea]] 15:21, 16 July 2010 (UTC) <br>
+
-
'''Comment: reverse beta-globin primer is correct!? (Hanna)'''
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Transfection</u></p>====
+
-
Investigator: Adrian
+
-
<br>
+
-
30µg Plasmid were used (pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30)<br>
+
-
VIRUS nix:pHelper + pAAV_RC<br>
+
-
VIRUS 1  :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 1 : P54<br>
+
-
VIRUS 2  :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 2 : P55<br>
+
-
VIRUS 3  :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 3 : P56<br>
+
-
<br>
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Mini Prep of pAAV_RFC25_mgmk_TK30</u></p>====
+
-
Investigator: Adrian
+
-
4ml were preparated
+
-
 
+
-
*pAAV_RFC25_mgmk_TK30 clone1 conc: 291,43 ng/µl : P54
+
-
*pAAV_RFC25_mgmk_TK30 clone2 conc: 243,99 ng/µl : P55
+
-
*pAAV_RFC25_mgmk_TK30 clone3 conc: 247,00 ng/µl : P56
+
-
*pAAV_RFC25_mgmk_TK30 clone4 conc: 246,01 ng/µl : P57
+
-
<br>
+
-
 
+
-
Test digestion of all four plasmids to check if the mgmg_TK30 insert is present. Investigator: Patrick, Chris
+
-
<br>
+
-
Each digestion sample:
+
-
*0,2 µl BSA (I picked the wrong tube. It should have been 2 µl BSA)
+
-
*2 µl Buffer 4
+
-
*0,5 µl XbaI
+
-
*0,5 µl SpeI
+
-
*13,8 µl H2O
+
-
*3 µl DNA
+
-
<br>
+
-
Digestion: 65 minutes, 37°C. Results: No mgmk_TK30 insert detectable. I will try it again on saturday or sunday.
+
-
 
+
-
====<p style="font-size:15px; font-weight: bold; color: blue;">Preparation of 50x TAE and 0,5M EDTA</p>====
+
-
Investigators: Chris W., Patrick
+
-
 
+
-
<br>1 L TAE (50x)
+
-
 
+
-
<br>242 g tris base
+
-
<br>57.1 ml glacial acetic acid
+
-
<br>100 ml 0.5 M EDTA
+
-
<br>ad 1 L Milipor
+
-
 
+
-
<br>1 L EDTA (0.5 M)
+
-
 
+
-
<br>146,13 g  Ethylendiamintetraessigsäure
+
-
<br>ad 800 ml Milipor
+
-
<br>~20 g NaOH
+
-
<br>pH mit NaOH auf 8 einstellen
+
-
<br>ad 1 L Milipor
+
-
 
+
-
====Test digestion of the QuickChange for PstI (310) and PstI (4073)====
+
-
Investigator: Kira & Volker<br>
+
-
 
+
-
The digestion showed two bands with apropirate lengt for each of the 6 clones as they were expected.<br>
+
-
The constructs were sent to GATC for sequencing. <br>
+
-
*pAAV_RC_SDM_PstI(310) with the primer GATC_std_QE-FP
+
-
*pAAV_RC_SDM_PstI (4073) with the primer GATC_std_M13_FP
+
-
 
+
-
====Primers to convert the expression constructs into the iGEM standard were ordered.====
+
-
Investigator: Volker<br>
+
-
 
+
-
*Praefix VP1ex
+
-
*Praefix VP2ex
+
-
*Praefix VP3ex
+
-
*Suffix VP123ex
+
-
*Praefix Rep68_78ex
+
-
*Praefix Rep 40_52ex
+
-
*Praefix AAPex
+
-
*Suffix Rep 40_68ex
+
-
*Suffix Rep 52_78ex
+
-
*Suffix AAPex
+
-
<br>
+
-
<br>
+
-
 
+
-
===61.Labortag 17.07.2010: left ITR===
+
-
<br>
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Picking clones of pGA14_Präfix-lITR Trafo</u></p>====
+
-
Investigator: Hanna <br>
+
-
<br>
+
-
Bacteria also grew on control plates. Control means: Ligation of digested vector (pGA14_Cerulean) without insert (Präfix and left ITR). Therefore it seemed that somehow pGA14 religated (Can't be if vector digested completely). Therefore 10 colonies were picked, in order to increase the chance to get a successfully ligated plasmid.
+
-
<br>
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Mini-Preps of pGA14_Präfix-lITR cultures </u></p>====
+
-
Investigator: Hanna <br>
+
-
<br>
+
-
 
+
-
No glycerol stocks were prepared, because I'm going to perform the test digestion today. <br>
+
-
<br>
+
-
10 Mini-Preps were performed following the standard protocol.
+
-
<br>
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Test digestion of pGA14_Präfix-lITR (Ligation)</u></p>====
+
-
Investigator: Hanna <br>
+
-
<br>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
+
-
*buffer used: 4; Restriction-enzymes used: Enzyme 1: EcoRI-HF ; Enzyme 2: PstI-HF
+
-
*Plasmid: pGA14_Präfix_lITR 1 - 10 (all: ~ 400 ng/µL)
+
-
 
+
<br />
<br />
 +
<br />
 +
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
{| border="1"
{| border="1"
-
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix'''
+
| components  || align="right" |volume of vector /µl || align="right" |volume of insert /µl
|-
|-
-
| align="left" | DNA ||align="left"| 2.5 ||align="left"| -
+
| DNA || align="right" |2.83  || align="right" | 2.77
|-
|-
-
| align="left" | BSA (10x) ||align="left"| - ||align="left"| 12
+
| BSA (100x) || align="right" | 0.5 || align="right" | 0.5
|-
|-
-
| align="left" | Buffer 4 (10x) ||align="left"| - ||align="left"| 12
+
| Buffer NEB4 (10x)|| align="right" | 3.0 || align="right" | 3.0
|-
|-
-
| align="left" | Enzyme 1 EcoRI-HF ||align="left"| - ||align="left"| 6
+
|Enzyme 1 (AgeI)|| align="right" | 1.75 || align="right" | 1.75
|-
|-
-
| align="left" | Enzyme 2 PstI-HF ||align="left"| - ||align="left"| 6
+
|Enzyme 2 (XbaI)|| align="right" | 1.25 || align="right" | 1.25
|-
|-
-
| align="left" | H2O ||align="left"| - ||align="left"| 54
+
|H<sub>2</sub>O|| align="right" |20.73 || align="right" | 20.67
|-
|-
-
| align="left" | '''Total volume''' ||align="left"| 10 ||align="left"| 90
+
|'''Total volume (e.g. 15,20,25,30 µl)'''|| align="right" | 30 || align="right" | 30
|}
|}
-
<br />
 
-
*Incubation: 55 minutes
+
<br /><br />
-
<br />
+
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
<br />
<br />
-
0.75 g Agarose, 50 ml TAE (1.5 %), 3 µL GELRED, at 115 Volt, running time: 30 minutes
+
0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED (3-6µl), at 115 Volt
<br />
<br />
<br />
<br />
-
Expected fragment size: Hopefully 160 bp = left ITR :) If pGA14_Cerulean religated the expected fragment size would be ~ 800 bp.
+
 
-
<br>
+
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
-
*Marker: GeneRuler ladder mix (6x)
+
-
{| border="1"
+
-
|
+
-
!Marker
+
-
!Sample 1
+
-
!Sample 2
+
-
!Sample 3
+
-
!Sample 4
+
-
!Sample 5
+
-
!Sample 6
+
-
!Sample 7
+
-
!Sample 8
+
-
!Sample 9
+
-
!Sample 10
+
-
|-
+
-
!Lane
+
-
|8 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|-
+
-
|}
+
<br />
<br />
-
'''Comments:''' Numbers refer to "colony 1, 2, 3,..."
+
* insert (mVenus-YFP): 26 ng/µL
-
<p style="font-size:14px; font-weight: bold; color: fuchsia;">Wonderful news: All 10 test digestions delivered positive results: 150 bp fragments and no 800 bp fragment was detectable. Means: left ITR + Präfix was inserted successfully into pGA14!!! :)</p>
+
* vector (pAAV_iGEM-MCS): 30 ng/µL
-
<p style="font-size:12px;  color: blue;">yees, thats great! Finally something worked with our ITRs. well done Hanna!! (Bea)</p>
+
<p style="font-size:15px; font-weight: bold; color: blue;">Ligation</p>
-
<p style="font-size:12px;  color: black;">the most astonishingly test digestion gel of our entire working time! :)(Adrian)</p>
+
<br />
-
[[File:Freiburg10 left itr test digest 1707.jpg|400px|]]
+
* vector: 5.85 µL
-
<p style="font-size:12px; font-weight: bold; color: fuchsia;">Next step: Fusion of suffix to left ITR</p>
+
* insert: 3.15 µL
 +
* ligase: 1 µL
 +
* buffer: 10 µL
<br>
<br>
-
Glycerol stocks of all 10 colonies were prepared: B46.1 - B46.10; Plasmid names: P62.1 - P62.10
+
<br />
-
<br>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Test digestion of pAAV_iGEM-MCS</u></p>
-
<br>
+
p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
-
 
+
*buffer used: 1 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) NgoMIV
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Trafo of pGA14_Präfix_rITR</u></p>====
+
*Plasmid
-
Investigator: Hanna <br>
+
**Given Plasmid-Number: P34.2 ; DNA concentration: 433.78 ng/µL;
-
<br>
+
**Given Plasmid-Number: P34.3 ; DNA concentration: 408.48 ng/µL;
-
Transformation of BL21 bacteria with pGA14_Präfix_rITR which ligated over night was performed following standard protocol. Abberation: 3µL DNA was added to 50 µL cells.
+
**Given Plasmid-Number: P34.4 ; DNA concentration: 409.8 ng/µL;
-
<br>
+
<br />
-
<br>
+
-
'''To do:''' Mini-Prep + Test digestion of pGA14_Präfix_rITR; Sequencing of pGA14_Präfix_lITR and pGA14_Präfix_rITR.
+
-
<br>
+
-
 
+
-
 
+
-
===62.Labortag 18.07.2010:===
+
-
 
+
-
'''Calculation of ganciclovir cymeven concentration'''
+
-
 
+
-
<br>Investigator Adrian:
+
-
 
+
-
*Ganciclovir: m = 255,23 g/mol
+
-
*dissolved in PBS (?), NaCL (0,9%) ?
+
-
*Concentrations : 0,5 µM = 0,0000005M
+
-
* xg = (0,0000005 mol/l *255,23 g/mol)/(1l PBS resp. 1l 0,9% NaCl)
+
-
* x = 0,000128g
+
-
* x = 0,128 mg
+
-
* 0,128 mg solved in 1l of PBS = 1l of 0,5µM solution
+
-
* steril filtrated under steril bench
+
-
<br>
+
-
preparation of Aliquots:
+
-
 
+
-
<br>
+
-
 
+
-
'''Cellculture'''<br>
+
-
 
+
-
The HEK-293 cells were split according to the standard protocol. The HT 1080 cells were split and sowed (3x10^5 cells each well).
+
-
The amount of cells/ml was determined with the Neubauer-Meteringchamber: (8 cells counted/4)x2,2x20x10^4 = 888000 cells/ml. Two 6-well dishes could be prepared.
+
-
{| border="1"
+
-
| only DMEM || align="right" |3x10^5 cells+DMEM|| align="right" |3x10^5 cells+DMEM
+
-
|-
+
-
| 3x10^5 cells+DMEM||  align="right" |3x10^5 cells+DMEM||  align="right" | 3x10^5 cells+DMEM
+
-
|-
+
-
|}
+
-
 
+
-
Investigators: Chris, Patrick
+
-
 
+
-
 
+
-
'''Test digestion of pAAV_RFC_mgmk_tk30: P54, P55, P56, P57'''<br>
+
-
To check whether the mutual mgmk_tk30 insert is present in the plasmid we digested it with AgeI and EcoRI. If the insert is present there will an DNA fragmet with a size of about 1700 bp.
+
-
 
+
-
{| border="1"
+
-
| P54 || align="right" | P55 || align="right" | P56 || align = "right" | P57
+
-
|-
+
-
| 291,4 ng/µl || align="right" |244 ng/µl || align="right" |247 ng/µl || align = "right" | 246 ng/µl
+
-
|-
+
-
|}
+
-
 
+
-
<br>
+
-
Mastermix:
+
-
*10 µl Buffer 4
+
-
*4,4 µl AgeI
+
-
*2,5 µl EcoRI
+
-
*no BSA (accroding to NEB)
+
-
*83,1 µl H2O
+
-
*Total volume: 100 µl
+
-
 
+
-
17 µl of the mastermix were pipetted to 3 µl plasmid sample. Digestion time: 75 minutes.
+
-
 
+
-
Gelrun (1% Agarose), 55 minutes, 115 mV: Results: See picture. Interpretation of the results: ? The "upper" DNA seems to be undigested vector underneath the probably digested vector with an estimated size of about 5600 bp. The mutual insert (mgmk_tk30) should be about 1700 bp. There are probably several DNA coil structures visible but not our mutual insert. To do : ligate again.
+
-
 
+
-
[[File:Gelrun20100718.jpg|400px|]]
+
-
 
+
-
Aferwards i noticed that i miscalculated the Mastermix. Investigators: Patrick, Chris
+
-
<br>
+
-
<br>
+
-
===63. Labortag 19.07.2010===
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>rITR</u></p>====
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Picking clones of pGA14_Präfix-rITR Trafo</p>====
+
-
<br>
+
-
Few bacteria also grew on control plates. Control means: Ligation of digested vector (pGA14_Cerulean) without insert (Präfix and right ITR).<br>
+
-
6 colonies were picked, in order to increase the chance to get a successfully ligated plasmid.
+
-
<br>
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Mini-Preps of pGA14_Präfix-lITR cultures</p>====
+
-
Investigator: Hanna, Jessy <br>
+
-
<br>
+
-
 
+
-
Glycerol stocks were prepared: B47.1, B47.2, B47.3, B47.4, B47.6 <br>
+
-
<br>
+
-
6 Mini-Preps were performed following the standard protocol.
+
-
<br>
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Test digestion of pGA14_Präfix-rITR (Ligation)</p>====
+
-
Investigator: Hanna, Jessy <br>
+
-
<br>
+
-
 
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
+
-
*buffer used: 4; Restriction-enzymes used: Enzyme 1: EcoRI-HF ; Enzyme 2: PstI-HF
+
-
*Plasmid: pGA14_Präfix_rITR 1 - 6 (all: ~ 500 ng/µL) -> 1 µg
+
-
 
+
<br />
<br />
{| border="1"
{| border="1"
-
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix'''  
+
| align="left" | '''Components''' ||align="left"| '''P34.2 [µL] ''' ||align="left"| '''P34.3 [µL] '''||align="left"| '''P34.4 [µL] '''  
|-
|-
-
| align="left" | DNA ||align="left"| 2 ||align="left"| -
+
| align="left" | DNA ||align="left"| 2.3 ||align="left"| 2.5 ||align="left"| 2.4
|-
|-
-
| align="left" | BSA (10x) ||align="left"| - ||align="left"| 6.4
+
| align="left" | BSA (10x) ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
|-
|-
-
| align="left" | Buffer 4 (10x) ||align="left"| - ||align="left"| 6.4
+
| align="left" | Buffer no. 1 (10x) ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
|-
|-
-
| align="left" | Enzyme 1 EcoRI-HF ||align="left"| - ||align="left"| 4
+
| align="left" | Enzyme 1 (no. Lab: 113) ngoMIV ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
|-
|-
-
| align="left" | Enzyme 2 PstI-HF ||align="left"| - ||align="left"| 4
 
|-
|-
-
| align="left" | H2O ||align="left"| - ||align="left"| 43.2
+
| align="left" | H<sub>2</sub>O ||align="left"| 4.7 ||align="left"| 4.5 ||align="left"| 4.6
|-
|-
-
| align="left" | '''Total volume''' ||align="left"| 10 ||align="left"| 64
+
| align="left" | '''Total volume''' ||align="left"| '''10''' ||align="left"| '''10''' ||align="left"| '''10'''
|}
|}
-
<br />
 
-
*Incubation: 45 minutes
+
*Incubation: 1 h, 37°C
<br />
<br />
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
<br />
<br />
-
0.75 g Agarose, 50 ml TAE (1.5 %), 3 µL GELRED, at 90 - 100 Volt, running time: 45 minutes
+
0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes + 20 minutes
<br />
<br />
<br />
<br />
-
Expected fragment size: Hopefully 160 bp = right ITR :) If pGA14_Cerulean religated the expected fragment size would be ~ 800 bp.
+
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
-
<br>
+
!Sample
-
*Marker: GeneRuler ladder mix (6x)
+
!Sample/µl]
 +
!Loading dye (6x)/µl
 +
!Expected size 1 (Geneious)
 +
!Expected size 2 (Geneious)
 +
|--
 +
|P34.2
 +
|10 µl
 +
|2 µl
 +
|3728 bp
 +
|903 bp
 +
|--
 +
|P34.3
 +
|10 µl
 +
|2 µl
 +
|3782 bp
 +
|903 bp
 +
|--
 +
|P34.4
 +
|10 µl
 +
|2 µl
 +
|3782 bp
 +
|903 bp
 +
|--
 +
 
 +
|}
 +
{| align=right
 +
|}
 +
<br />
 +
*Marker: GeneRuler ladder mix
{| border="1"
{| border="1"
|
|
-
!Marker
 
-
!Sample 1
 
-
!Sample 2
 
-
!Sample 3
 
-
!Sample 4
 
-
!Sample 5
 
-
!Sample 6
 
!Marker
!Marker
 +
!Sample P34.2 /µl
 +
!Sample P34.3 /µl
 +
!Sample P34.4 /µl
|-
|-
!Lane  
!Lane  
-
|8 µL
+
| 8 µL
-
|10 µL
+
| 10 µL
-
|10 µL
+
| 10 µL
-
|10 µL
+
| 10 µL
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
-
|10 µL
+
|-
|-
|}
|}
<br />
<br />
-
'''Comments:''' Numbers refer to "colony 1, 2, 3,..."
+
'''Comments:''' Digestion of P34.2 delivered just one fragment size, revealing that - as expected after sequencing (C-deletion: no NgoMIV site in iGEM-MCS) - there was just one NgoMIV restriction site in the vector. In contrast to that the digestion of P34.3 and P34.4 delivered two bands - whereas the band of the smaller fragments looked like a smier. Because of this obscure and non-satisfying results (besides our assumption that there's something wrong with the marker :) )we decided to sequence the P34.3 vector:
-
<p style="font-size:14px; font-weight: bold; color: fuchsia;">Wonderful news: All 6 test digestions delivered positive results: ~ 160 bp fragments and no 800 bp fragment were detectable. Means: right ITR + Präfix was inserted successfully into pGA14!!! :)</p>
+
* c(P34.3): 408.48 ng/µL
-
<br>
+
* Volume (plasmid): 5.14 µL
-
[[File:RightITR.jpg|350px|]]
+
* Volume (vector): 24.86 µL
 +
* Name of eppi: HW_34
 +
* Primer: GATC_std_pTeSp-1
-
<p style="font-size:12px; font-weight: bold; color: fuchsia;">Next step: Ordering new oligos: Präfix of lITR, suffix of right and left ITRs, continuation of fancy cloning protocol</p>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben</u></p>
-
New Oligos (left ITR Präfix and Suffix + right ITR Suffix) were ordered.  
+
*experiment date: 9.6.2010
-
<br>
+
*name of investigator: Hanna, Achim
-
<br>
+
*plasmid:
 +
**Vector: name: pAAV_iGEM-MCS_Vektor_oben 
 +
**Insert: name: pOG14_mVenus
 +
*new vector name: pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben
 +
<br />
 +
The Clones were picked and incubated in 10 mL LB-Medium containing 10µL ampicillin over night at 37°C on a rotary shaker.
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Sequencing</p>====
+
===26. Labortag 10.06.2010:===
-
Investigator: Hanna <br>
+
====Site-directed mutagenesis of PstI in ITRs====
-
<br>
+
<p style="font-size:12px; font-weight: bold; color: blue;">1. Site directed mutagenisis</p><br>
-
pGA14_Präfix_lITR and pGA14_Präfix_rITR were sent for sequencing to GATC:<br>
+
-
1) pGA14_Präfix_lITR: c(P62.1) = 422.38 ng/µL -> V = 5 µL + 25 µL H2O <br>
+
-
2) pGA14_Präfix_rITR: c(P63.1) = 501 ng/µL -> V = 4.2 µL + 25.8 µL H2O <br>
+
-
<br>
+
-
Primer: GATC_std_pQE-FP
+
-
<br>
+
-
<br>
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Quantitative real time PCR</p>====
+
-
Investigator: Hanna <br>
+
-
<br>
+
-
Template: DNA of HT1080 cells transducted with 1) 10 µL and 2) with 30 µL virus stock solution.<br>
+
-
<br>
+
-
'''Pipetting scheme:'''<br>
+
-
Master Mix<br>
+
-
* 2x QuantiFast SYBR Green PCR Mix: 400 µL
+
-
* Primer for and rev: 32 µL of 1:10 dilution = 10 µM
+
-
* Water: 208 µL
+
-
* Total: 640 µL
+
-
<br>
+
-
Template: 5 µL <br>
+
-
To each template 20 µL master mix were added.<br>
+
-
<br>
+
-
PCR program:
+
-
* Hold: 95°C, 5 minutes
+
-
* Cycling: 95°C for 10 seconds, 60°C for 30 seconds
+
-
* Melt: Ramp from 60°C to 95°C, rising by 1°C each step, wait for 45 seconds on first step, then wait for 5 seconds for each step afterwards. Aquire to Melt A on FAM.
+
-
<br>
+
-
<br>
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Cloning strategy for gmk_tk added!!</p>====
+
* Aim: deletion of PstI from both ITR's
-
Investigator: Bea<br>
+
* 2 PCR tubes got prepared, one for the left ITR and one for the right. (The SDM was performed according to the standart protocol)
-
[[Media:Freiburg10 BioBrick GMK TK30 07 07 2010 with new oligos.pdf]]
+
* [[Media:Freiburg10_Site_directed_Mutagenesis_pAAV_MCS_deletion_PstI.pdf‎]]
<br>
<br>
-
<br>
+
====Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion====
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">pAAV_RC site directed mutagenesis: Digestion of the two mutagenesis reaction of PstI site: 310 and 4073</p>====
+
<p style="font-size:12px; font-weight: bold; color: blue;">2.1 Mini-Prep of pAAV_iGEM_mVenus_YFP</p><br>
-
'''Digestion of pAAV_RC '''
+
Title: '''pAAV_iGEM_mVenus_''' <br>
-
 
+
investigator: Jessy, Achim <br>
-
<li> experiment date: 19.07.2010
+
<u>Glycerol Stocks</u>
-
<li> name of investigator:Volker
+
-
<li> plasmid: name: pAAV_RC number: P58 / P59
+
-
<li> buffer used: 4 ; Restriction-enzymes used: Enzyme  (no. Lab:66) XmnI
+
-
<li> DNA concentration (vector):  ng/µL
+
-
<br>
+
{| border="1"
{| border="1"
-
| components  || align="right" |P58 /µl || align="right" |P59 /µl
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2'''
|-
|-
-
| DNA  || align="right" | 4,34|| align="right" |3,76
+
| align="left" | '''Bacteria strain''' ||align="left"| XL1 blue ||align="left"| XL1 blue
|-
|-
-
| BSA (10x) || align="right" |2 || align="right" | 2
+
| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM_mVenus||align="left"| pAAV_iGEM_mVenus
|-
|-
-
| Buffer 4 (10x)|| align="right" | 2|| align="right" | 2
+
| align="left" | '''Date''' ||align="left"| 10.06.2010 ||align="left"| 10.06.2010 
|-
|-
-
|Enzyme XmnI (no.Lab: 66)||  align="right" |1 ||  align="right" | 1
+
| align="left" | '''given number''' ||align="left"| B30 ||align="left"| B31
-
|-
+
-
|H2O||  align="right" | 10,66||  align="right" | 11,24
+
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''|| align="right" | '''20'''|| align="right" | '''20'''
+
|}
|}
-
<br>
+
<br />
-
Incubate at 37°C
+
<u>Given Plasmid-Number</u>
-
 
+
-
[[File:Freiburg10 pAAV RC site directed mutagenesis performed with PstI 310 and 4073 19 07 2010.jpg]]<br>
+
-
*Gelextraction was prepared according to the protocol<br>
+
-
**weight of gel: 310: 150 mg; 4073: 150mg <br>
+
-
*Nanodrop: 310: 5,5ng/µl; 4073: 7,0ng/µl<br>
+
-
*Ligation was prepared according to the protocol <br>
+
-
**Ratio: 310:4073 --> 2,52 µl:6,48µl<br>
+
-
Ligation was frozen in -20°C<br>
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">pHelper plasmid for Midi-Prep prepared</p>====
+
-
Investigator:  Stefan<br>
+
-
200ml DYT media + 200µl Amp were inoculated with pHelper-plasmid glycerol stock and put on shaker in 37°C room.<br>
+
-
For Midi-Prep:  Use Endotoxin-free Midi Prep not our Midi Prep!
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;"><u>Trafo of IGEM 2009 linkers</u></p>====
+
-
*We borrowed several linkers/tags from Gerrit and did a Trafo in XL1B cells:
+
-
**small linker
+
-
**middle linker
+
-
**long linker
+
-
**Strep-Tag
+
-
**Split
+
-
**GSAT
+
-
**SEG
+
-
 
+
-
*Amount of DNA used: 0,5 µl
+
-
*Plates incubated at 37°C overnight
+
-
<br>
+
-
<br>
+
-
 
+
-
===64. Labortag 20.07.2010===
+
-
<br>
+
-
 
+
-
'''Quickchange site directed mutagenesis:'''
+
-
<br>
+
-
Investigators: Achim,Anissa
+
-
<br> 1) VP1ex P27.2<br> 2) VP2ex P28.2 <br> 3) VP3ex P29.2 <br>
+
-
PCR reaction:
+
-
* 2.5 µL 10x Pfu Ultra II buffer
+
-
* 1) 1,44µl 2) 1,83µl 3) 1,76µl  template (1:100 dilution)
+
-
* 0.34 µL primer SDM PstI (4073)forward (of 1:10 dilution)
+
-
* 0.35 µL primer SDM PstI (4073) reverse (of 1:10 dilution)
+
-
* 0,5 µL DMSO (primers form very strong secondary structures)
+
-
* 0.5 µL dNTP
+
-
* 1) 18,9 2) 18,5 3) 18,6 µL dH2O
+
-
* 0.5 µL PfuUltra II fusion (1.25 U)
+
-
-> end volume: 25 µL
+
-
<br>
+
-
<br>
+
-
'''PCR program:'''<br> Quickge
+
-
<br>
+
-
Trafo was carried out, using 2µl DNA, strain:XL1 blue
+
-
 
+
-
<p style="font-size:12px; font-weight: bold; color: blue;">Transformation with ligation from july 19th </p>
+
-
*used bacterial strain: BL21
+
-
*2µL of DNA (pAAV_RC w/o PstI 310/4073)
+
-
*Trafo plate in 37°C room for incubating at 12.30
+
-
* no clones to pick at 22.00
+
-
 
+
-
'''Picking Clones from Linker Trafo'''<br>
+
-
* clones were picked at 22.00
+
-
====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Endotoxin-free Midi Prep of pHelper</u></p>====
+
-
Investigators: Chris, Stefan<br>
+
-
Midi-Prep was done according to protocol.<br>
+
-
Result of the Midi-prep: 503,2 ng/µl<br>
+
-
Plasmid (P64) was placed in Stratagene-Box.
+
-
<br>
+
-
<br>
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Quantitative real time PCR</p>====
+
-
Investigator: Hanna <br>
+
-
<br>
+
-
Because there was one positive non-template control (H2O) yesterday, we performed the qPCR one more time.<br>
+
-
For this purpose we also calculated the plasmid pipetting for the standard curve again:
+
-
* c(P9) = 272 ng/µL --> 3 x 1:10 = 1:1000 dilution.
+
-
* 2.68 µL of the 1:1000 dilution was added to 52.32 µL H2O = 2600000 copies/µL.
+
-
* By performing 1:10 dilutions further 6 "standard samples" were created: 260000 copies/µL; 26000 copies/µL; 2600 copies/µL; 260 copies/µL, 26 copies/µL, 2.6 copies/µL
+
-
<br>
+
-
Template: DNA of HT1080 cells transducted with 1) 10 µL and 2) with 30 µL virus stock solution.<br>
+
-
<br>
+
-
'''Pipetting scheme:'''<br>
+
-
Master Mix<br>
+
-
* 2x QuantiFast SYBR Green PCR Mix: 400 µL
+
-
* Primer for and rev: 32 µL of 1:10 dilution = 10 µM
+
-
* Water: 208 µL
+
-
* Total: 640 µL
+
-
<br>
+
-
Template: 5 µL <br>
+
-
To each template 20 µL master mix were added.<br>
+
-
Comment: To non-template control 2 17 µL + 3µL H2O was added (not enough master mix was left).
+
-
<br>
+
-
PCR program:
+
-
* Hold: 95°C, 5 minutes
+
-
* Cycling: 95°C for 10 seconds, 60°C for 30 seconds
+
-
* Melt: Ramp from 60°C to 95°C, rising by 1°C each step, wait for 45 seconds on first step, then wait for 5 seconds for each step afterwards. Aquire to Melt A on FAM.
+
-
<br>
+
-
<br>
+
-
====<p style="font-size:20px; font-weight: bold; color: blue;"><u>Cloning of p51(pSB1C3_RFC25) for His-tag insert</u></p>====
+
-
Investigators: Anna, Stefan<br>
+
-
<br>
+
-
 
+
-
<li>buffer used:4 ; Restriction-enzymes used: Enzyme SpeI (no. Lab:71), NgOMIV (no. Lab:113)
+
-
<li>DNA concentration (vector): 230 ng/µl
+
{| border="1"
{| border="1"
-
| components  || align="right" | V (p51)/ µl
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2'''
-
|-
+
-
| DNA || align="right" | 5
+
-
|-
+
-
| BSA (10x) ||  align="right" |2
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" |2
+
-
|-
+
-
|Enzyme: SpeI (no.Lab:71)||  align="right" |1
+
-
|-
+
-
|Enzyme: NgOMIV (no.Lab: 113)||  align="right" |1
+
-
|-
+
-
|H2O||  align="right" |9
+
|-
|-
-
|'''Total volume'''|| align="right" |<b>20</b><b></b>
+
| align="left" | '''given number''' ||align="left"| P35 ||align="left"| P36
|}
|}
 +
<br />
-
1% Agarose-gel, 3µl Gelred<br>
+
Title: '''pAAV_iGEM_mVenus_YFP''' (guided by Sven) <br>
-
 
+
investigator: Bea
-
Loading dye(5x): 4µl<br>
+
-
 
+
-
Loading plan: marker (10µl), free, sample (24µl)<br>
+
-
 
+
-
expected size of fragment: 2080 bp
+
-
<br>
+
-
<br>
+
-
 
+
-
===65. Labortag 21.07.2010===
+
-
<br>
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Sequencing of ITRs</p>====
+
-
Investigator: Hanna <br>
+
-
<br>
+
-
P62.1 (=left ITR + RFC23-Präfix in pGA14) and P63.1 (= right ITR-Präfix in pGA14) were sequenced:
+
-
<br>
+
-
[[File:LITR-RFC23Präfix.jpg |600px|thumb|left|Sequencing results of '''pGA14_lITR-RFC23Präfix'''.]]
+
-
 
+
-
[[File:RITR-Präfix.jpg|600px|thumb|right|Sequencing results of '''pGA14_rITR-RFC10Präfix''').]]
+
-
<br>
+
-
<br>
+
-
Sequencing delivered, that the präfixes were fused successfully to the ITRs. The mismatch (orange box) was due to the alignment with the RFC10 präfix... (oligos were ordered!), what means, that the sequencing is OK.<br>
+
-
Interestingly it seems, that not only we had problems with PCR of the ITR -> Very strong secondary structures. Even sequencing of the ITRs seems impossible under normal conditions: Exactly at the point where the ITR sequence starts the sequencing signal delivered no clear results. <br>
+
-
<p style="clear:both;">Conclusion: Fancy method worked until now.</p>
+
-
<br>
+
-
<br>
+
-
 
+
-
====<p style="font-size:18px; font-weight: bold; color: fuchsia;">Quantitative real time PCR</p>====
+
-
Investigator: Hanna <br>
+
-
<br>
+
-
Because the non-template control and the not-transduced cell-DNA controls delivered positive PCR results for the CMV-promoter, a control qPCR was prepared: <br>
+
-
1. not-transduced cell-DNA controls (K1 and K2) were diluted: 1:100<br>
+
-
2. Oligos (O20, O21) were 1:10 diluted<br>
+
-
3. Master Mix was prepared:<br>
+
-
* 75 µL SYBR Green
+
-
* 39 µL H2O
+
-
* 6 µL Oligos
+
-
4. Pipetting scheme:
+
-
* 1. K1
+
-
* 2. K2
+
-
* 3. NTC1
+
-
* 4. NTC2
+
-
* 5. Sdt7
+
-
 
+
-
<br>
+
-
<br>
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
+
-
*experiment date: 21.07.2010 ; time: 10:30Uhr
+
-
*name of investigator: Anissa, Kerstin
+
-
 
+
-
<br />
+
<u>Glycerol Stocks</u>
<u>Glycerol Stocks</u>
{| border="1"
{| border="1"
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7'''  
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''  
|-
|-
-
| align="left" | '''Bacteria strain''' ||align="left"| XL1 B ||align="left"| XL1 B ||align="left"| XL1 B ||align="left"| XL1 B ||align="left"| XL1 B||align="left"| XL1 B||align="left"| XL1 B
+
| align="left" | '''Bacteria strain''' ||align="left"| BL-21 ||align="left"| BL-21 ||align="left"| BL-21 ||align="left"| BL-21
|-
|-
-
| align="left" | '''Plasmidname''' ||align="left"| pGA14_middle linker ||align="left"| pGA14_GSAT linker ||align="left"| pGA14_long linker ||align="left"| pGA14_split ||align="left"| pGA14_strep ||align="left"| pGA14_short linker ||align="left"| pGA14_SEG
+
| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP
|-
|-
-
| align="left" | '''given glycerol-stock no.''' ||align="left"| B48 ||align="left"| B49 ||align="left"| B50 ||align="left"| B51 ||align="left"| B52||align="left"| B53||align="left"| B54
+
| align="left" | '''Date''' ||align="left"| 10.06.2010 ||align="left"| 10.06.2010 ||align="left"| 10.06.2010 ||align="left"| 10.06.2010
|-
|-
-
| align="left" | '''given plasmid no.''' ||align="left"| p65 ||align="left"| p66 ||align="left"| p67 ||align="left"| p68 ||align="left"| p69 ||align="left"| p70 ||align="left"| p71
+
| align="left" | '''given number''' ||align="left"| B32 ||align="left"| B33 ||align="left"| B34 ||align="left"| B35
|}
|}
-
 
-
'''Comments:''' Different Linker-fragments are very short (5-178bp) --> no Test-digestion; directly sequencing
 
-
 
-
====<p style="font-size:17px; background-color:#66bbff;">'''Results of Trafo of cloning pAAV_RC SDM of PstI 310 and 4073'''</p>====
 
-
'''Investigator: Bea''' <br>
 
-
''Comments:'' Cloning together of the two site-directed mutagenesis performed with the pAAV_RC
 
-
<br>
 
-
<p style="font-size:12px; font-weight: bold; color: blue;"> '''Results:''' no clones grown on LB-agar plate, because pAAV_RC was digested with only one blunt-end restriction enzyme. Luckily, th enzyme vut twice, and one time in the Amp gene. Therefore wrong ligation of the two fragments lacked the Amp resistance. </p>
 
-
<br>
 
-
<p style="font-size:14px; font-weight: bold; color: red;">To do: new cloning together of pAAV_RC PstI 310 and 4073 with TWO other enzymes.</p>
 
-
 
-
====<p style="font-size:17px; background-color:#66bbff;">'''PCR with pUB_V5_mGMK_TK30'''</p>====
 
-
'''Investigator: Adrian, Bea''' <br>
 
-
''Comments:'' Perform PCR with two primers
 
-
*pmGMK_TK30_prefix_RFC25_for
 
-
*pmGMK_TK30_suffix_RFC25_rev
 
-
and pUB_V5_hisB_mGMK_tk30 (P15) and clone it into pAAV_RFC25.<br>
 
-
<p style="font-size:17px; font-weight: bold; color: blue;">PCR:</p>
 
-
 
-
*PCR program: GMKTK
 
<br />
<br />
 +
<u>Given Plasmid-Number</u>
{| border="1"
{| border="1"
-
| '''components'''   || align="right" |'''volume in µl'''
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''  
|-
|-
-
| 5x Phusion HF buffer  ||  align="right" |10
+
| align="left" | '''given number''' ||align="left"| P37 ||align="left"| P38 ||align="left"| P39 ||align="left"| P40
-
|-
+
-
| 10 mM dNTP mix ||  align="right" |1
+
-
|-
+
-
|pMGMK_TK30_RFC25_prefix_for (060) (1:10 dilution)||  align="right" |2,5 (0,5 µM) 
+
-
|-
+
-
|pMGMK_TK30_RFC25_suffix_rev (063) (1:10 dilution)||  align="right" |2,5 (0,5 µM)
+
-
 
+
-
|-
+
-
|DNA template: pUB_V5_hisB_mgmk_tk30||  align="right" | ~2 µL of 1:1000 dilution 
+
-
|-
+
-
|DMSO||  align="right" | - 
+
-
|-
+
-
|Phusion polymerase||  align="right" |0,5 
+
-
|-
+
-
|H2O||  align="right" |31,5µL
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''|| align="right" |50
+
|}
|}
<br />
<br />
-
'''Comments:'''New Oligos (pmGMK_TK30_prefix_RFC25_for and pmGMK_TK30_suffix_RFC25_rev) with add-on tails (prefix and suffix), but TK30 still contains three iGEM restriction sites but will be ready for use in cell culture <br>
+
<p style="font-size:12px; font-weight: bold; color: blue;">2.2 Test digestion</p>
-
'''Result of PCR product''' (theoretically)<br>
+
*buffer used: 4 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme AgeI (no.Lab:___) ____
-
[[File:Freiburg10 PCR product mGMK tk30 RFC25.jpg|800px|thumb|left|]]
+
*Plasmid
 +
**Given Plasmid-Number: P37; DNA concentration: 114,8 ng/µL ;
 +
**Given Plasmid-Number: P38 ; DNA concentration: 179,8 ng/µL;
 +
**Given Plasmid-Number: P39 ; DNA concentration: 180,8ng/µL ;
 +
**Given Plasmid-Number: P40; DNA concentration: 189,2 ng/µL;
 +
<br />
 +
'''Comments:''' Clones were picked from trafo-plate in the morning and mini-prep was performed in the late afternoon. Due to this and the fact that bacterial strain was BL-21, DNA-concentrations are quite low.
<br>
<br>
-
<br />
+
<br>
-
<br />
+
Investigators: Bea, Chris W. <br>
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<p style="font-size:17px; font-weight: bold; color: blue;">Digestion of pAAV_RFC25</p>
+
-
*Vector: name:pAAV_RFC25 number:p42
 
-
*new vector name: pAAV_RFC25_MGMK_TK30
 
-
*buffer used:4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:149) AgeI ; Enzyme 2 (no.Lab:63) XbaI
 
-
*DNA concentration (vector):321,5 ng/µl
 
-
<br />
 
-
'''Comments:''' Digestion of pAAV_RFC25 wihle performing PCR with P42
 
-
<br />
 
-
<br />
 
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl || align="right" |volume of insert (=PCR product) /µl
+
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix''' ||align="left"| '''Sample: P37''' ||align="left"| '''Sample: P38''' ||align="left"| '''Sample: P39''' ||align="left"| '''Sample: P40'''
|-
|-
-
| DNA || align="right" |4,73 || align="right" | -
+
| align="left" | DNA ||align="left"| 800 ng ||align="left"| - ||align="left"|7,0 µL||align="left"|4,5 µL||align="left"|4,4 µL||align="left"| 4,2 µL
|-
|-
-
| BSA (100x) || align="right" |2 || align="right" | -
+
| align="left" | BSA (10x) yes ||align="left"| 1,5 µL ||align="left"| 7,5 µL ||align="left"|MM 4,5 µL||align="left"|MM 4,5 µL||align="left"|MM 4,5 µL||align="left"| MM 4,5 µL
|-
|-
-
| Buffer 4 (10x)|| align="right" |2 || align="right" | -
+
| align="left" | Buffer no. 4 (10x) ||align="left"| 1.5 µL||align="left"| 7,5 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
|-
|-
-
|AgeI (no.Lab:149)|| align="right" |1 || align="right" | -
+
| align="left" | Enzyme 1 (no. Lab:   ) AgeI ||align="left"| 0.75 µL ||align="left"| 3,75 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
|-
|-
-
|XbaI(no.Lab:63)|| align="right" |1 || align="right" | -
+
| align="left" | Enzyme 2 (no. Lab:   ) XbaI ||align="left"| 0.5 µL||align="left"| 2,5 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
|-
|-
-
|H2O|| align="right" |9,27 || align="right" | -
+
| align="left" | H<sub>2</sub>O ||align="left"| variable ||align="left"| - ||align="left"|3,75 µL||align="left"|0,25 µL||align="left"|6,35 µL||align="left"| 6,55 µL
|-
|-
-
|'''Total volume (e.g. 15,20,25,30 µl)'''|| align="right" |20 || align="right" | -
+
| align="left" | '''Total volume''' ||align="left"| '''15 µL''' ||align="left"| - ||align="left"|15 µL||align="left"|15 µL||align="left"|15 µL||align="left"| 15 µL
|}
|}
-
*Incubation: Vector: 1.5 h
 
-
<br /><br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
 
-
*0,5 g Agarose
 
-
*50 ml TAE (1%)
 
-
*3 µl GELRED (3-6µl)
 
-
*110 Volt, running time: 50 minutes
 
-
<br>
 
-
'''Results of digestion with XbaI and AgeI of pAAV_RFC25 and PCR with pUB_V5_gmk_tk30 <br>'''
 
-
[[File:Freiburg10 pAAV RFC25 digestion and PCR of mgmk tk30 30 21 07 2010.jpg|300px|thumb|left|Digestion of pAAV_RFC25 witth XbaI and AgeI and PCR of pUB_V5_gmk_tk30 with prefix and suffix primer in RFC25 standard loaded on 1% agarose gel.]]
 
-
<br>
 
-
'''Result''': Gel was loaded with 50µL of pCR product and 20µL of pAAV_RFC25 digestion. Expected bands can be seen, but pAAV_RFC25 too high and there are some additional bands. We cut out only the intensive band at around 1700 bp.<br>
 
-
<br>
 
-
<p style="font-size:17px; color: blue;">'''Comment:'''After a PCR there can be two ways to proceed with the PCR product:  </p>
 
-
# load 7-8µL of PCR sample on an analytical gel and watch agarose gel for additional bands. If there are some more bands than expected load sample on preparative gel.If there aren´t any additional bands. proceed with digestion of PCR product in order to ligate it into vector.
 
-
#load total PCR sample on preparative gel. Ask Sven or Tobi in which volume you should elute after cutting out the gel (Gel extraction), but you should elute sample at least in 30µL.
 
-
[[File:Freiburg10 General plan Overview PCR.png|200px|thumb|right|]]
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
*After gel extraction was performed, concentration of the two constructs was measured and revealed:
 
-
**c(pAAV_RFC25)= 27,33ng/µL
 
-
**c(gmk_tk30)= 24,53ng/µL
 
-
*After the gel extraction, the PCR product gmk_tk30 was digested again with XbaI and AgeI
 
-
*and purified with the PCR purification Kit provided by Qiagen
 
-
<br>
 
-
'''Digestion of the PCR product gmk_tk30'''
 
<br />
<br />
-
{| border="1"
 
-
| components  || align="right" |volume of vector /µl || align="right" |volume of insert (=PCR product) /µl
 
-
|-
 
-
| DNA  ||  align="right" |- ||  align="right" | 30
 
-
|-
 
-
| BSA (100x) ||  align="right" |-||  align="right" | 0,5
 
-
|-
 
-
| Buffer 4 (10x)||  align="right" |- ||  align="right" | 4
 
-
|-
 
-
|AgeI (no.Lab:149)||  align="right" |- ||  align="right" | 1
 
-
|-
 
-
|XbaI(no.Lab:63)||  align="right" |- ||  align="right" | 1
 
-
|-
 
-
|H2O||  align="right" |- ||  align="right" | 3,5
 
-
|-
 
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" |- ||  align="right" | 40
 
-
|}
 
-
<br>
 
-
*Incubation:  1:45 h
 
-
*Ligation and Trafo were performed following standard protocols.
 
-
====<p style="font-size:17px; background-color:#66bbff;">'''Gelextraction, Ligation and Transformation for cloning of pSB1C3_His_RFC25 (continuation of cloning from 64th lab day)'''</p>====
+
*Incubation: 45 min, 37°C
-
Investigator: Bea, Kerstin, Stefan <br>
+
<br />
-
<b>Extraction</b>
+
===27. Labortag 11.06.2010:===
-
<ul>
+
in additon to<p style="font-size:12px; font-weight: bold; color: blue;">Site directed mutagenisis</p> on 10.06.10
-
<li>Gel extraction performed following standard protocol provided by Qiagen</li>
+
-
</ul>
+
-
<b>Ligation</b>
 
-
<ul>
+
'''transformation'''<br>
-
<li>Measure DNA-concentration with Nanodrop </li>
+
transformation was performed according to the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]]<br>
-
<li>c(pSB1C3) = 18,2,8 ng/µL</li>
+
Cells were plated on agar plates (2x 1:100; 2x pellet)containing ampicillin and stored over night at 37°C.
-
<li>c(His-tag) = 11,2 ng/µL</li>
+
-
<li>Calculation of volume needed for ligation:  
+
-
<li>c(pSB1C3) = 8,26 µL</li>
+
-
<li>c(His-tag) = 0,74 µL</li></li>
+
-
</ul>
+
-
<b>Transformation</b>
+
<p style="font-size:12px; font-weight: bold; color: blue;">Sequenzing</p>
-
<ul>
+
p39 was send to GATC for sequenzing
-
<li>Transformation has been followed the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]]<br>
+
-
Deviation of standard protocol added: medium added to cells before incubation on thermomixer changed to DYT. Standard protocol changed. </li>
+
-
</ul>
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones pf VP1-3 pEX plasmids from DKFZ'''</p>====
+
* p39: 180,83 ng*µl^-1
-
'''Investigator: Bea''' <br>
+
* volume plasmid: 8,3 µl
-
Two clones of each plasmid were picked and inoculated in 10mL DYT medium containing 10 µL ampicillin
+
* volume water: 21,7 µl
-
*VPex-1 clone 1
+
* primer: GATC_std_pTeSp-1
-
*VPex-1 clone 2
+
-
*VPex-2 clone 1
+
-
*VPex-2 clone 2
+
-
*VPex-3 clone 1
+
-
*VPex-3 clone 2
+
-
and they were put in the 37°c room at 19:15
+
-
 
+
===28. Labortag 12.06.2010:===
-
=== 66. Labortag 22.7.2010 ===
+
Kira <br>
-
 
+
The plates were stored in the iGEM shelf @ 4 °C. Even if the transformation was not very successfull, some colonies can be picked and inoculated either tomorrow or on Monday.
-
 
+
'''Note: Site-directed mutagenesis does not generate lots of intact plasmids, so few colonies are normal!! (Tobias)'''
-
==== cell culture ====
+
-
HT 1080 cells were split according to the standart protocol. Investigator: Adrian
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Mini Prep and test digestion  pKEX_VP1-3 w/o PstI(4073)'''</p>====
+
-
Investigators: Kerstin, Jessica<br>
+
-
'''PstI should be deleted in VP1, VP2, VP3'''
+
-
 
+
-
* Glycerol stock were prepared:  
+
-
** B55-B60
+
-
*Plasmids
+
-
** pKEX_VP1 clone1:488,2 P72
+
-
** pKEX_VP2 clone1:484,8 P73
+
-
** pKEX_VP3 clone1:485,8 P74
+
-
** pKEX_VP1 clone2:499,2 P75
+
-
** pKEX_VP2 clone2:511,7 P76
+
-
** pKEX_VP3 clone2:470,4 P77<br>
+
-
 
+
-
Test digestion of three plasmids to check if the PstI 4073 is deleted (compared to the origin P27-P29)
+
<br>
<br>
-
{| border="1"
+
===29. Labortag 13.06.2010:===
-
| components  || align="right" |P72 /µl || align="right" |P27 /µl || align="right" |P73/µl|| align="right" |P28/µl|| align="right" |P74/µl|| align="right" |P29
+
Jessy, Patrick, Hanna <br>
-
|-
+
We weren't able to detect any colonies on the plates - just a few air bubbles :) To be entirely sure, we put them back into the 37°C room over night.
-
| DNA  ||  align="right" | 1,6||  align="right" |1,7|| align="right" |1,6|| align="right" |8,1|| align="right" |7,5|| align="right" |7,4
+
-
|-
+
-
| BSA (10x) ||  align="right" |1 ||  align="right" | 1||  align="right" | 1||  align="right" | 1||  align="right" | 1||  align="right" | 1
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" | 1||  align="right" | 1||  align="right" | 1||  align="right" | 1||  align="right" | 1||  align="right" | 0,5
+
-
|-
+
-
 
+
-
 
+
-
|H2O||  align="right" | 10,9||  align="right" | 10,8||  align="right" |10,9||  align="right" |4,4||  align="right" |5,0||  align="right" |5,1
+
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | '''15'''||  align="right" | '''15'''||  align="right" | '''15'''||  align="right" | '''15'''||  align="right" | '''15'''||  align="right" | '''15'''
+
-
|}
+
<br>
<br>
-
<br>
+
===30. Labortag 14.06.2010:===
-
Digestion: 45 minutes, 37°C. Results:
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-mVenus-YFP:</u></p>
 +
The sequencing data of pAAV_iGEM_mVenus-YFP was analyzed. The alignment with the "theoretical" pAAV_iGEM_mVenus-YFP showed that we successfully inserted mVenus-YFP into pAAV_iGEM-MCS.
 +
[[File:Freiburg10 mVenus-Alignment.jpg|800x800px|]]
<br>
<br>
-
Deletion was succesful, there are still 2 PstI restriction sites in P72-74
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Site-directed mutagenesis:</u></p>
-
<br>
+
Also today no colonies were detectable on any plates!
-
[[File:Freiburg10 SDM of pKex VP1-3 und Origing pKex VP1-3.jpg|400px|thumb|left|]]
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>TK-GMK-Plasmid</u></p>
 +
Adrian, Hanna <br>
 +
puB6_V5_His6_clone1 + TK/GMK (P15) will be sequenced again: <br>
 +
* name: AF 1
 +
* primer: GATC_std_BGH-reverse
 +
* volume(plasmid) = 4.25 µL
 +
* volume (H<sub>2</sub>O) = 25.75 µL
 +
Results (15.06.): Unfortunately just ~ 300 bp were sequenced. <br>
 +
<p style="font-size:13px; font-weight: bold; color: purple;">To do: Therefore more primers have to be designed in order to sequence the whole ~2000 bp TK-GMK fusion construct! </p>
<br>
<br>
-
====<p style="font-size:15px; background-color:#66bbff;">'''Cloning together of pAAV_RC PstI 310 and 4073 with two enzymes'''</p>====
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Zellkultur</u></p>
 +
AAV 293 and HT1080 Cells have been splitted and plated out on 10 cm dishes for transfektion.
 +
The Cells were accounted by using the Neubauer-Meteringchamber.
 +
After harvesting by following the standard protocol the pallet have been resuspendiated in 15ml of DTT medium.
 +
2,5µl of this cell suspension have been mixed with 47.5µl of trypan blue.
-
Clone P58 (pAAV_RC_SDM310.1) and P59 (pAAV_RC_SDM4073) will be digested with HindII and SpeI. The smaller fragment (about 1700 bp) of P58 and the larger fragment of P59 (about 5900 bp) will be ligated to receive a plasmid carrying both mutations.
+
We counted 12,5x 10^6 cells/ml for the T293 AAV cell line and 10x10^6 cells /ml for the HT1080 cell line.
-
<br>
+
 +
The AAV 293 cells have been plated out on four dishes with 250µl of the cell suspension, on one plated with 1ml and on another dish
 +
with 1.5ml.
 +
note that that the date is wrong on the plates and the flasks! Cells have been already plated out on the 14th. of June.
-
{| border="1"
+
We also seated two flasks one for each cell line. Therefor we used 1ml of the HT1080 cell suspension and two ml of the the AAV293 cells.
-
| components  || align="right" |volume of vector /µl (P59) || align="right" |volume of insert /µl (P58)
+
-
|-
+
-
| DNA  ||  align="right" |2 ||  align="right" | 5,5
+
-
|-
+
-
| BSA (10x) ||  align="right" |2||  align="right" | 2
+
-
|-
+
-
| Buffer 2 (10x)||  align="right" |2 ||  align="right" | 2
+
-
|-
+
-
|HindIII ||  align="right" |2 ||  align="right" | 2
+
-
|-
+
-
|SpeI ||  align="right" |2 ||  align="right" | 2
+
-
|-
+
-
|H2O||  align="right" |12 ||  align="right" | 9,5
+
-
|-
+
-
|'''Total volume '''||  align="right" |20 ||  align="right" | 20 µl
+
-
|}
+
<br>
<br>
-
 
-
Incubation: at 37°C, 70 minutes.
 
-
<br>
 
-
[[File:2010-07-23 PS CW annotated.jpg|600px|thumb|left|]]
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
The Gelextraction was performed according to the standard protocol. <br>
 
-
Weight of P58 gel extract: 50 µg <br>
 
-
Weight of P59 gel extract: 98 µg <br>
 
-
The received concentrations (measured by nanodrop):
 
-
P58: 3 ng/µl , P59: 4,7 ng/µl
 
<br>
<br>
-
Quickligation was not performed according to the standard protocol:
 
-
*2 µl P58 Insert
 
-
*2 µl P59 Vector
 
-
*5 µl Quickligase buffer (2x)
 
-
*1 µl Quickligase
 
-
*Total volume: 10 µl
 
-
Incubation: 15 minutes at roomtemperature.
+
===31. Labortag 15.06.2010:===
 +
Adrian, Achim, Chris W., Hanna
 +
 
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Solutions for transfection were prepared:</u></p>
 +
* 1 x TE-Buffer: 1.2114 g TRIS, 0.2 mL EDTA, 81 mL milipore-H<sub>2</sub>O were mixed. pH was adjusted with HCl (1M and 5M) to 7.50. Volume was adjusted to 100 mL with milipore-H<sub>2</sub>O. Solution was autoclaved (sterilization by filtration is also possible). <br>
 +
* 1 M CaCl2: 147.02 g CaCl2 x 2H<sub>2</sub>O (M = 147.02 g/mol) was solved in 1 Liter H<sub>2</sub>O and sterilized by filtration.<br>
 +
* 2 x HBS: 0.027 g Na2HPO4, 1.636 g NaCl, 1.19155 g HEPES were dissolved in ~ 30 mL milipore-H<sub>2</sub>O. pH was adjusted to 7.10. Volume was adjusted to 100 mL and sterilized by filtration.<br>
<br>
<br>
-
Transformation was performed according to the standard protocol with E. coli BL21. The agar plates were put into the 37°C room at 23:00.
 
-
<br>
 
-
New Ampicillin was prepared and put into the -20°C freezer. Investigators: Chris, Patrick
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Sequencing of linker '''</p>====
+
===32. Labortag 16.06.2010:===
-
'''Investigator: Anissa'''
+
-
<br />
+
-
{| border="1"
+
-
| align="left" | '''Linker''' ||align="left"| '''Sequencing'''
+
-
|-
+
-
| align="left" | p65: middle linker ||align="left"|was sucessful
+
-
|-
+
-
| align="left" | p66: GSAT linker ||align="left"| sequence didn’t arrive yet
+
-
|-
+
-
| align="left" | p67: long linker ||align="left"| was sucessful
+
-
|-
+
-
| align="left" | p68: split linker ||align="left"| false, '''no linker''' but YFP.Gerrit’s searching for the right sample
+
-
|-
+
-
| align="left" | p69: strep linker ||align="left"| the suffix of strep has a '''double AgeI'''! That’s why we have to cut off next time with AgeI (and digest long enough)
+
-
|-
+
-
| align="left" | p70: short linker ||align="left"| was sucessful
+
-
|-
+
-
| align="left" | p71: SEG linker ||align="left"| was sucessful
+
-
|}
+
-
<br /><br />
+
-
middle linker:
+
-
[[File:Middle linlker.jpg|600px|thumb|left|]]
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
GSAT linker:
+
-
[[File:GSAT linker.jpg|600px|thumb|left|]]
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
long linker:
+
-
[[File:Long linker.jpg|600px|thumb|left|]]
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
Split linker:
+
-
[[File:Split linker.jpg|600px|thumb|left|]]
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
Strep tag:
+
-
[[File:Strep tag.jpg|600px|thumb|left|]]
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
Short linker:
+
-
[[File:Short linker.jpg|600px|thumb|left|]]
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
SEG linker:
+
-
[[File:SEG linker.jpg|600px|thumb|left|]]
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
<br />
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Biobricks of hgH and ß-Globin'''</p>====
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sponsoring:</u></p>  
-
'''Investigators: Stefan, Anna''' <br> <p style="font-size:12px; font-weight: bold; color: blue;">Could you upload some agarose gels eg the gels after the digestion and the PCR? Thanks a lot! (Bea)</p>
+
Anna, Kerstin, Anissa<br>
-
''Comments:'' Perform PCR with two primers
+
Sponsoring letters were examined and modified one more time. <br>
 +
<br>
-
<p style="font-size:17px; font-weight: bold; color: blue;">PCR of ß-Globin and hgH:</p>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of TK-GMK:</u></p>  
-
*DNA template: pAAV_MCS; concentration: 360 ng/µl
+
Hanna<br>
-
<br />
+
Two primers were designed and ordered from Sigma-Aldrich. Probably we will receive them on Friday.<br>
-
*PCR program: BGLOB
+
<br>
-
<br />
+
-
{| border="1"
+
-
| '''components'''  || align="right" |'''volume in µl''' 
+
-
|-
+
-
| 5x Phusion HF buffer  ||  align="right" |10
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" |1
+
-
|-
+
-
|ß_globin_suffix (085) (1:10 dilution)||  align="right" |2,5 (0,5 µM) 
+
-
|-
+
-
|ß_globin_prefix (086) (1:10 dilution)||  align="right" |2,5 (0,5 µM)
+
-
 
+
-
|-
+
-
|DNA template: pAAV_MCS (1:1000)||  align="right" | 5,6 µL of 1:1000 dilution 
+
-
|-
+
-
|DMSO||  align="right" | - 
+
-
|-
+
-
|Phusion polymerase||  align="right" |0,5 
+
-
|-
+
-
|H2O||  align="right" |27,9 µL
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" |50
+
-
|}
+
-
<br />
+
-
 
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Mega primer PCR:</u></p>  
-
*PCR program: HGH
+
Bea, Hanna <br>
-
 
+
-
<br />
+
-
{| border="1"
+
-
| '''components'''  || align="right" |'''volume in µl''' 
+
-
|-
+
-
| 5x Phusion HF buffer  ||  align="right" |10
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" |1
+
-
|-
+
-
| (083) (1:10 dilution)||  align="right" |2,5 (0,5 µM) 
+
-
|-
+
-
| (084) (1:10 dilution)||  align="right" |2,5 (0,5 µM)
+
-
 
+
-
|-
+
-
|DNA template: pAAV_MCS (1:1000)||  align="right" | 5,6 µL of 1:1000 dilution 
+
-
|-
+
-
|DMSO||  align="right" | - 
+
-
|-
+
-
|Phusion polymerase||  align="right" |0,5 
+
-
|-
+
-
|H2O||  align="right" |27,9 µL
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" |50
+
-
|}
+
-
<br />
+
-
 
+
-
<p style="font-size:17px; font-weight: bold; color: blue;">Digestion of pSB1C3_RCF25_CFP:</p>
+
-
 
+
-
*DNA-Concentration: 230,9 ng/µl
+
-
<br />
+
-
 
+
-
{| border="1"
+
-
| components  || align="right" |volume of vector /µl
+
-
|-
+
-
| DNA  ||  align="right" |5
+
-
|-
+
-
| BSA (10x) ||  align="right" |3
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" |3
+
-
|-
+
-
|PstI ||  align="right" |1
+
-
|-
+
-
|XbaI ||  align="right" |1
+
-
|-
+
-
|H2O||  align="right" |17
+
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" |30
+
-
|}
+
-
<br /><br />
+
-
 
+
-
<p style="font-size:17px; font-weight: bold; color: blue;">Gel running of digested vector and PCR products</p>
+
-
 
+
-
* 1% Agarose gel
+
-
* 3 µl Gelred, 8 µl DNA-Ladder-Mix
+
-
* 125 Volt, running time: 40 minutes
+
-
<br />
+
-
 
+
-
{| border="1"
+
-
| '''Sample/µl  || align="right" |''' Loading dye (5x)/µl || align="right" |''' Expected size/bp
+
-
|-
+
-
| Vector: 30  ||  align="right" |6 ||  align="right" |2080
+
-
|-
+
-
| ß-Globin: 50 ||  align="right" |10 ||  align="right" |524
+
-
|-
+
-
| hgH: 50 ||  align="right" |10 ||  align="right" |479
+
-
|-
+
-
|}
+
-
<br />
+
-
 
+
-
 
+
-
<p style="font-size:17px; font-weight: bold; color: blue;">Gelextraction</p>
+
-
*Gel extraction performed following standard protocol provided by Qiagen
+
-
<br />
+
-
{| border="1"
+
-
| '''Sample/  || align="right" | Weight/g || align="right" | QG buffer/µl 
+
-
|-
+
-
| Vector  ||  align="right" |0,13 ||  align="right" |390
+
-
|-
+
-
| ß-Globin  ||  align="right" |0,28 ||  align="right" |840
+
-
|-
+
-
| hgH ||  align="right" |0,24 ||  align="right" |720
+
-
|-
+
-
|}
+
-
<br /><br />
+
-
 
+
-
<p style="font-size:17px; font-weight: bold; color: blue;">Digestion of PCR products</p>
+
-
 
+
-
{| border="1"
+
-
| components  || align="right" |volume of vector /µl
+
-
|-
+
-
| DNA  ||  align="right" |30
+
-
|-
+
-
| BSA (100x) ||  align="right" |0,5
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" |4
+
-
|-
+
-
|PstI ||  align="right" |1
+
-
|-
+
-
|XbaI ||  align="right" |1
+
-
|-
+
-
|H2O||  align="right" |3,5
+
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" |40
+
-
|}
+
-
<br /><br />
+
-
 
+
-
<p style="font-size:17px; font-weight: bold; color: blue;">Purification of PCR products, Ligation, Transformation</p>
+
-
 
+
-
'''procedure has been followed a different protocol (see Sven); has to be added in the standard protocols !
+
-
 
+
-
 
+
-
*Measure DNA-concentration with Nanodrop:
+
-
c(pSB1C3) = 12,42 ng/µL <br />
+
-
c(ß-Globin) = 51,93 ng/µL <br />
+
-
c(hgH)= 36,87 ng/µL
+
-
*Calculation of volume needed for ligation:
+
-
c(pSB1C3) = 7,3 µL <br />
+
-
c(ß-Globin) = 1,7 µL
+
-
 
+
-
<br />
+
-
c(pSB1C3) = 7,62 µL <br />
+
-
c(hgH) = 1,38 <br />
+
-
<br />
+
-
 
+
-
'''Note: after heatshock cells were put on the shaker without adding 750 µl DYT, it was recognized and added later after 25 min of shaking !
+
-
 
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Picking clones of pSB1C3_His_RFC25 and pAAV_RFC25_GMK_TK30 for Mini-Prep'''</p>====
+
-
'''Investigators: Stefan''' <br>
+
-
 
+
-
Three clones of each construct were picked and inoculated in 10mL DYT medium containing 10 µL ampicillin (pAAV_RFC25_GMK_TK30) or 10 µL chloramphenicol (pSB1C3_His_RFC25).
+
-
 
+
-
 
+
-
They were put in the 37°C room at 20:33.
+
-
 
+
-
 
+
-
=== 67. Labortag 23.7.2010 ===
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Picking clones of pAAV_RC_1.1'''</p>====
+
-
'''Investigator: ChrisW, Patrick''' <br>
+
-
The inoculated agar plates from 'Cloning together of pAAV_RC PstI 310 and 4073 with two enzymes' were checked for colonies. Three clones were picked and in each case inoculated 20 ml DYT + Amp at 10:20.
+
-
 
+
-
Mini prep of two pAAV_RC_SDM_PstI_310_4073. Results: It was checked visually whether enough E. coli BL21 cells had grown. Therefore only two midi preps were carried out, according to the standard protocol (Final elution with 50 µl). Unfortunately both of them yielded a quite low plasmid concentration, probably due to the short growth time (7 h). <br>
+
-
pAAV_RC mini pstI 301,4073: 44,7 ng/µl <br>
+
-
pAAV_RC mini 2 pstI 301,4073: 83,1 ng/µl <br>
+
-
 
+
-
30 µl of both plasmids were sent for sequencing to GATC, named PS1 and PS2. Primers used: GATC_std_PolyC-D and GATC_std_SK. <br>
+
-
 
+
-
Glycerol stock: <br>
+
-
B 67: pAAV_RC_SDM_PstI_310_4073 (1) <br>
+
-
B 68: pAAV_RC_SDM_PstI_310_4073 (2) <br>
+
-
 
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Results of Trafo Biobricks of hgH and ß-Globin'''</p>====
+
-
'''Investigator: Anissa, Bea'''<br>
+
-
<p style="font-size:12px; color:#68bbff;">'''''Comments:''''' No clones of pSB1C3_hGH and pSB1C3_betaGlobin grown on trafo plate. Possible reason can be the forgotten DYT medium added to the cells after the heat-shock. Cells were incubated at 37°C for 40 minutes without medium and were added afterewards.</p>
+
-
<p style="font-size:14px;">TO DO: Repeat ligation of
+
-
*hgh PCR product and
+
-
*beta-globin PCR product
+
-
with pSB1C3 cut with XbaI and PstI.</p>
+
-
 
+
-
*Measure DNA-concentration with Nanodrop:
+
-
c(pSB1C3) = 38,9 ng/µL <br />
+
-
c(ß-Globin) = 51,93 ng/µL <br />
+
-
c(hgH)= 36,87 ng/µL
+
-
*Calculation of volume needed for ligation:
+
-
c(pSB1C3) = 3,8 µL <br />
+
-
c(ß-Globin) = 5,2 µL
+
-
 
+
-
<br />
+
-
c(pSB1C3) = 3,8 µL <br />
+
-
c(hgH) = 5,2 <br />
+
-
<br />
+
-
'''Attention: There was not enough cut vector. In both Ligations were only 2,2 µl of vector added. So incubation lasted 15 minutes and for transformation 4 µl were used.  '''
+
-
 
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Mini-Prep and Test digestion of pAAV_RFC25_mGMK_TK30 '''</p>====
+
-
'''Investigator: Adrian, Bea''' <br>
+
-
<p style="font-size:13px; color:#68bbff;">'''''Comments:''''' Mini-Prep, test digestion and sequencing is carried out in order to verify insertion of  the PCR product mGMK_TK30 with RFC25 add-on tails into pAAV_RFC25(overhangs). Aim is to use the construct in order to conduct experiments with the gmk_tk30 fusionenzyme. </p><br>
+
-
'''Mini-Prep of pAAV_RFC25_mGMK_TK30 clone 1 to 3: '''
+
-
After performing Mini-Preps  of clone 1 - 3 (elution volume with EB buffer was 50 µL) , concentration was measured and revealed following concentrations:
+
-
*P81 = pAAV_RFC25_mGMK_TK30 clone 1: '''c = 486 ng/µL'''
+
-
*P82 = pAAV_RFC25_mGMK_TK30 clone 2: '''c = 426 ng/µ'''L
+
-
*P83 = pAAV_RFC25_mGMK_TK30 clone 3. '''c = 457 ng/µL'''
+
-
<br>
+
-
'''Test digestion of pAAV_RFC25_mGMK_TK30 clone 1 to 3:'''<br>
+
-
*P81 = pAAV_RFC25_mGMK_TK30 clone 1
+
-
*P82 = pAAV_RFC25_mGMK_TK30 clone 2
+
-
*P83 = pAAV_RFC25_mGMK_TK30 clone 3
+
-
<br>
+
-
{| border="1"
+
-
| components  || align="right" |volume of '''P81'''/µl ||volume of '''P82'''/µL||volume of '''P83/'''µL
+
-
|-
+
-
| DNA  ||  align="right" |2 ||2||2
+
-
|-
+
-
| BSA (100x) ||  align="right" |1,5 ||1,5||1,5
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" |1,5 ||1,5||1,5
+
-
|-
+
-
|PstI ||  align="right" |0,5||0,5||0,5
+
-
|-
+
-
|XbaI ||  align="right" |0,5||0,5||0,5
+
-
|-
+
-
|H2O||  align="right" |9||9||9
+
-
|-
+
-
|'''Total volume /µl'''||  align="right" |15||15||15
+
-
|}
+
-
<br />
+
-
'''Expected sizes:'''
+
-
*mGMK_TK30:  1700bp
+
-
*pAAV_RFC25: 4600bp
+
-
<br>
+
-
<p style="font-size:13px; color:#11bb88;">'''Results of samples loaded 1% agarose gel and ran 50 minutes at 110 V:''' </p>
+
-
[[File:Freiburg10 Test digestion of pAAV RFC25 mGMK TK30 cut with XbaI and AgeI 23 07 2010001.png|400px|thumb|left|]]
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
<br>
<br>
-
<p style="font-size:13px; color:#11bb56;">'''Sequencing of pAAV_RFC25_mGMK_TK30''' </p>
+
[[File:Freiburg10 ITRprimer.jpg]]
-
70ng/µL were sent to GATC from each clone. They were labeled:
+
-
*AF_P81 (clone 1)
+
-
*AF_P82 (clone 2)
+
-
*AF_P83 (clone 3)
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Mini-Prep of pSB1C3_His6'''</p>====
+
===33. Labortag 17.06.2010:===
-
'''Investigator: Adrian'''<br>
+
-
pSB1C3_6xHis clone 1 = P84 : 107,8 ng/µl (eluted with 50µl)<br>
+
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Primer designing: VP1 primer for pKEX forward/reverse </u></p>
-
pSB1C3_6xHis clone 2 = P85 : 122,8 ng/µl (eluted with 50µl)<br>
+
Investigator: Volker<br>
-
pSB1C3_6xHis clone 3 = P86 : 98,8 ng/µl  (eluted with 50µl)<br>
+
The construnts that we receieved from PD Dr. Kleinschmidt (DKFZ) are mainly in the pKEX backbone. The sequences of the backbone and the inserts are not availible, for this reason we decided to sequence the constructs. The first step is to sequence from one construct into the backbone. In the second step we will designe primers that bind in the backbone and point into the direction of the insert.
 +
These primers will then be used to sequence the inserts of all the constructs.<br>
 +
'''Forward primer pKEX in VP1 from bp 4124 to 414'''
 +
*VP1 primer for pKEX forward: 5' - CAACAAGTCTGTTAATGTGGAC - 3' 22bp; TM: 50°C; CG% 41%
 +
'''Reverse primer pKEX in VP1 from bp 2081 to 2100'''
 +
*VP1 primer for pKEX reverse: 5' - GTGGGCCAGGTTTGAGCTTC - 3' 20bp; TM: 54°C CG%: 60%
 +
The amplicon that should  be produced by the primers is 199 bp long.
 +
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Primer designing: CMV_forward/reverse_qPCR </u></p>
 +
Investigator: Volker<br>
 +
Primers for the titering of the CMV region from the literature [Rohr et al., 2002] and [Rohr et al., 2005] were compared and analysed.
 +
The sequences from 2002 showed a differce in one nucleotide compared to the other primer and to our sequence. For this reason the second set [Rohr et al., 2005] was ordered.<br>
-
=== 68. Labortag 24.7.2010 ===
+
*CMV_forward_qPCR: 5' - GGGACTTTCCTACTTGGCA - 3'
-
====<p style="font-size:17px; background-color:#66bbff;">'''Cell culture: Seeding of HEK293 for Transfektion with P81, P82 and P83'''</p>====
+
*CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'
-
Investigator: Adrian
+
-
*unfortunately the T75 flask with HEK-cells was overpopulated => to much cells =>yellow medium and differentiation of the HEK-cells => thrown away
+
-
* I had to thaw cells, (P4) so there'll be no transfection at Monday :(
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Cell culture: Transduction of HT1080 with AAVs'''</p>====
+
[[File:Freiburg10_Binding of the CMV_qPCR primer in the vector plasmid.jpg|900px|left|thumb|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]<br>
-
Investigator: Adrian
+
 +
<p style="clear:both;">These primers will be used in a quantitative PCR assay with Sybr-green to measure the genomic titer and the infectious titer of the viral particles we will produce in the future.</p>
-
I. Plate I(A is up)
+
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Ordering of required reagents: </u></p>
-
{| border="1"
+
Investigator: Volker<br>
-
| control: no virus added|| align="right" |virus without GOI added|| align="right" | virus with 10µg amount of GOI added
+
-
|-
+
-
| control: no virus added||  align="right" |virus without GOI added||  align="right" | virus with 10µg amount of GOI added
+
-
|-
+
-
|}
+
 +
*Nuclease S1 was ordered from Promega (10000Units for 36,00€)
 +
*Proteinase K was ordered from Sigma  (5mg for 31,30€; BioUltra, ≥30 units/mg protein, lyophilized powder)
 +
These reagents are required for the procedure to determine the genomic and the infectious titer.<br><br>
-
 
+
===34. Labortag 18.06.2010: Transfection===
-
II. Plate II(A is up)
+
====Transfection====
-
{| border="1"
+
Transfection via calcium phosphat with the prepared solutions (31. Labortag 15.06.2010)
-
| control: no virus added|| align="right" |virus without GOI added|| align="right" | virus with 10µg amount of GOI added
+
-
|-
+
-
| control: no virus added||  align="right" |virus without GOI added||  align="right" | virus with 10µg amount of GOI added
+
-
|-
+
-
|}
+
-
 
+
-
 
+
-
III. Plate II(A is up)
+
-
{| border="1"
+
-
| control: no virus added|| align="right" |virus without GOI added|| align="right" | virus with 10µg amount of GOI added
+
-
|-
+
-
| control: no virus added||  align="right" |virus without GOI added||  align="right" | virus with 10µg amount of GOI added
+
-
|-
+
-
|}
+
-
 
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Discussion round nr. 4'''</p>====
+
-
Investigators: Adrian and his evil twins
+
<br>
<br>
-
* adrian created a poster
+
'''investigators:''' Chris W., Hanna, Patrick, Adrian, Volker<br>
 +
Transfections with the following plasmids:
-
====<p style="font-size:17px; background-color:#66bbff;">'''Stocktaking of superior goods'''</p>====
+
1)
 +
* pAAV_iGEM_mVenus_YFP (glycerol stock B34, P39) P39 has the correct sequence (confirmed)
 +
* pHelper
 +
* pAAV_RC
 +
2)
 +
* pAAV_iGEM_mVenus_YFP (glycerol stock B33, P38) P38 (we dont know if P39 has the correct sequence!)was used because the amount of P39 ''[[was not sufficient enough]]'' for four Transfections!
 +
* pHelper
 +
* pAAV_RC
-
Investigator: Adrian
+
Plasmid concentrations: <br>
-
<br>
+
pAAV_RC: 1 µg/µl <br>
-
superior goods:
+
pHelper: 280 ng/µl <br>
-
<br>
+
pAAV_iGEM_mVenus_YFP, P39: 180,83 ng/µl <br>
-
* DYT/LB medium
+
pAAV_iGEM_mVenus_YFP, P38: 179,75 ng/µl <br>
-
* tips
+
-
* LB-agar
+
-
=== 69. Labortag 25.7.2010 ===
+
Cellculture clone 1 and 2 were transfected with P39. Cellculture clone 3 and 4 were transfected with P38. <br>
-
====<p style="font-size:17px; background-color:#66bbff;">'''Clone picking from pSB1C3_hgH and pSB1C3_betaglobin'''</p>====
+
-
'''Investigator: Bea'''<br>
+
-
<p style="font-size:13px; color:#11bb88;">'''Comments: Clones were very small and not many clones could be detected. Possible reasons: <br>
+
-
1) The ratio for a proper ligation need to be 3:1 insert: vector. There was not enough plasmid of the digested vector pSB1C3. <br>
+
-
2) The digested fragments of the PCR products hGH and beta-globin and the cutted vector were stored at -20°C. This could lead to the bad results of the transformation, because the overhangs were degraded. ''' </p>
+
-
<br>
+
-
Two clones were picked of each trafo plate:
+
-
*pSB1C3_hGH
+
-
*pSB1C3_betaglobin
+
-
They were inoculated in 10mL DYT medium containing 10µL chloramphenicol and put into 37°C room for incubating. The reason for picking only two clones was that not many more clones could be detected easily.
+
-
=== 70. Labortag 26.7.2010 ===
+
Deviations from the standard protocol (currently incomplete):
-
====<p style="font-size:15px; background-color:#66bbff;">'''Mini Prep and test digestion  pSB1C3_hgh and pSB1C3_beta-globin '''</p>====
+
We could only pipet 3,3 µg (instead of 10 µg) from each of the 3 plasmids into the 15 ml falcons due to insufficient amount of plasmid.
-
'''Investigators: Anissa, Kerstin'''<br>
+
-
* Glycerol stock were prepared:
+
Adrian tried to examine the precipation of the CaCl2+ DNA Clusters. We have to optimize the pH of our 2xHBS at the moment it is 11.12
-
** B69-B71
+
-
*Plasmids
+
-
** pSB1C3_hgh clone1: 139 ng/µl  p89
+
-
** pSB1C3_hgh clone2: 209,4 ng/µl  p90
+
-
** pSB1C3_beta-globin clone1: 217,5 ng/µl  p91 <br>
+
-
<br> Incubation time: 1,5h Incubation temperature:37°C
+
-
 
+
-
Test digestion with Xba and PstI to check if hgh and beta-globin were cloned succesfully into the pSB1C3, respectively.
+
-
[[File:Test digestion of pSB1C3 hgh and pSB1C3 beta-globin cut with XbaI and PstI 26 07 2010002.jpg |300px|thumb|left|]]
+
<br>
<br>
-
{| border="1"
+
====Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick====
-
| components  || align="right" |p89 /µl || align="right" |p90 /µl || align="right" |p91/µl
+
'''investigator''': Bea <br />
-
|-
+
'''idea:'''  
-
| DNA  ||  align="right" | 4,3||  align="right" |4,3|| align="right" |4,1
+
<ul>
-
|-
+
<li>Digest vector in order to obtain two fragments which contain the left and the right ITR respectively. </li>
-
| BSA (10x) ||  align="right" |1,5 ||  align="right" | 1,5||  align="right" | 1,5
+
<li>Separation (Agarose-gel) and gel extraction of fragments</li>
-
|-
+
<li>Perform PCR with iGEM-Primers (forward primer contains EcoRI and Xbai; reverse primer contains SpeI and PstI)</li>
-
| Buffer 4 (10x)||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5
+
<li>to do:</li>
-
|-
+
* design primers
-
 
+
* digestion of pAAV_MCS etc.
-
 
+
</ul>
-
|H2O||  align="right" | 6,7||  align="right" | 6,7||  6,9
+
'''Theoretical:''' Digestion of pAAV_MCS with AlwNI produces two fragments which can be separated by agaorse gel.
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | '''15'''||  align="right" | '''15'''||  align="right" | '''15'''
+
-
|}
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
<br>
<br>
 +
[[File:Freiburg10 pAAV MCS fragments cut with AlwNI preparation for PCR.jpg|900px|thumb|left|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]
<br>
<br>
<br>
<br>
Line 3,898: Line 1,322:
<br>
<br>
-
====<p style="font-size:15px; background-color:#66bbff;">'''Test digestion  P87: pAAV_RC_PstI-301-4073 clone 1 and P88: pAAV_RC_PstI-301-4073 clone 2 '''</p>====
+
===35. Labortag 19.06.2010: Literature seminar===
-
'''Investigators: Chris W.'''<br>
+
-
*Plasmids
+
'''Investigators: Bea, Hanna, Melanie, Denis, Volker, Christian W., Adrian and Achim'''
-
** pAAV_RC_PstI-301-4073 clone1: 44,2 ng/µl  p87
+
-
** pAAV_RC_PstI-301-4073 clone2: 83,2 ng/µl  p88
+
-
** pAAV_RC: 429,8 ng/µl  p50 <br>
+
-
<br> Incubation time: 1,5h Incubation temperature:37°C
+
-
Test digestion with PstI 0,5µl
+
Topics:
 +
*The ITRs
 +
*The Cap
 +
===36.Labortag 20.06.2010: Picking clones of sequenced pAAV_igEM_mVenus_YFP===
 +
'''Investigators: Bea and Chris W'''
 +
<ul>
 +
<li>Incoluate 250 mL  DYT medium (add 250µL ampiciliin) with B34 (glycerol stock: BL-21 E.coli cells with P39 plasmid: pAAV-iGEM_mVenus_YFP </li>
 +
<li>Incubate on rotary shaker over-night (o/n) at 37°C </li>
 +
<li>to do: perform Midi-Prep tomorrow (21.06.2010)</li>
 +
</ul>
-
{| border="1"
+
===37.Labortag 21.06.2010: Second Transfection, Transduction===
-
| components  || align="right" |p87 /µl || align="right" |p88 /µl || align="right" |p50/µl
+
-
|-
+
-
| DNA  ||  align="right" | 13,6||  align="right" |7,2|| align="right" |0,72
+
-
|-
+
-
| BSA (10x) ||  align="right" |1,5 ||  align="right" | 1,5||  align="right" | 1,5
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" | 1,5||  align="right" | 1,5||  align="right" | 1,5
+
-
|-
+
 +
2x HBS was steril filtrated into two 50 ml flacons. The falcons were put into the cellculture fridge.
-
|H2O||  align="right" | 2,9||  align="right" | 9,3||  15,78
+
New medium is prepared:
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | '''20'''||  align="right" | '''20'''||  align="right" | '''20'''
+
-
|}
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Oligos for hTERT promoter'''</p>====
+
DMEM-Medium
-
'''Investigator: Bea'''<br>
+
*500ml DMEM with Glutamax
-
<br>
+
*10% FCS (50 ml)
 +
*5 ml 100x Pen/Strep
 +
*5 ml 100x NaPyruvat
-
Oligos were ordered to modify hTERt promoter in order to obtain hTERT in the iGEM RFC10 standard.
+
H-DMEM-Medium
-
[[File:Freiburg10 Primers for hTERT promoter 26 07 2010.jpg|1000px|thumb|left|Ordered oligos at Sigma-Aldrich for amplifying hTERT promoter.]]
+
*400 ml DMEM with Glutamax
-
<br>
+
*90 ml FCS
-
<br>
+
*5 ml 100x Pen/Strep
-
<br>
+
*5 ml 100x NaPyruvat
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Retrafo with pTVvector containing the CMV promoter '''</p>====
+
Investigators: Patrick, Johannes
-
'''Investigator: Bea'''<br>
+
-
<p style="font-size:13px; color:#11bb88;">'''Comments''': In order to obtain the CMV promoter in the correct RFC10 standard, oligos werde designed and ordered. For using the plasmid obtained from the iGEM team 2008, a retrafo has to be performed.  </p>
+
-
<p style="font-size:14px;"> Re-transformation: </p>
+
-
*Construct used: expressionvector + CMV (BBa_TV_CMV)
+
-
**clone 7
+
-
**clone 8
+
-
*concentration measureed with NanoDrop:
+
-
**clone 7 (Bba_TV_VMV_7): c = 334, 65 ng/µL
+
-
**clone 8 (Bba_TV_VMV_8): c = 183,77 ng/µL
+
-
*Plasmid need to be diluted in order to obatain the final 100pg. <br>
+
-
*Dilution: 1:1000
+
-
*Volume needed of 1:1000 dilution of each clone:
+
-
**clone 7 (Bba_TV_VMV_7): v = 0,29 µL
+
-
**clone 8 (Bba_TV_VMV_8): v = 0,54 µL
+
-
*100 µL aliquot of '''XL1-B''' were thawed on ice and divided into 50µL each. The proper amount of each clone was added.
+
-
<br>
+
-
====<p style="font-size:17px; background-color:#fuchsia;">'''Continuation: ITRs'''</p>====
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Feching dry ice for the experiments </u></p>
-
'''Investigator: Hanna'''<br>
+
Volker
-
<br>
+
-
In order to convert also the left ITR into RFC10 standard, the FANCY method was repeated with the newly arrived oligos (präfix and suffix).
+
-
<br>
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Practical Cloning: Digestion of pAAV_MCS with AlwNI</u></p>
+
-
*plasmid: P9 (270 ng/µL) = pAAV_MCS
+
-
*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:120) AlwNI
+
-
<br />
+
-
'''Comments:''' No.
+
-
<br />
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
+
-
{| border="1"
+
-
| components  || align="right" | Volume [µL]
+
-
|-
+
-
| DNA  ||  align="right" | 15
+
-
|-
+
-
| BSA (100x) ||  align="right" | 0.2
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" | 2
+
-
|-
+
-
|Enzyme AlwNI (no.Lab:120)||  align="right" | 2
+
-
|-
+
-
|H2O||  align="right" | 0.8
+
-
|-
+
-
|'''Total volume'''||  align="right" | 20
+
-
|}
+
-
*Incubation: 1 h 20 minutes
+
-
<br /><br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
-
<br />
+
-
0.5 g Agarose, 50 mL TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 50 minutes
+
-
<br />
+
-
<br />
+
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (6x)/µl
+
-
!Expected size 1 (Geneious)
+
-
!Expected size 2 (Geneious)
+
-
|--
+
-
|P9
+
-
|20 µl
+
-
|4 µl
+
-
|1674 bp = left ITR
+
-
|2982 bp = right ITR
+
-
|}
+
-
{| align=right
+
-
|}
+
-
<br />
+
-
*Marker: GeneRuler ladder mix
+
-
{| border="1"
+
-
|
+
-
!Marker [µL]
+
-
!Sample P9 [µL]
+
-
|-
+
-
!Lane
+
-
|8
+
-
|24
+
-
|-
+
-
|}
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
+
-
<br />
+
-
Gel measurement:
+
-
<br />
+
-
{| border="1"
+
-
| align="left" | '''Sample''' ||align="left"| '''weight''' ||align="left"| '''concentration'''
+
-
|-
+
-
| align="left" | left ITR fragment ||align="left"| 0.07 g ||align="left"| 35.65 ng/µL
+
-
|-
+
-
| align="left" | right ITR fragment ||align="left"| 0.15 g ||align="left"| 66.05 ng/µL
+
-
|}
+
-
<br /><br />
+
-
<br>
+
-
<br>
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Practical Cloning: Digestion of left ITR fragment with NotI + PstI</u></p>
+
-
*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 NotI-HF; Enzyme 2 PstI-HF
+
-
<br />
+
-
'''Comments:''' Due to the digestion of an gelex- and very small fragment (ITR ~ 150 bp), the whole gelex-volume was used for digestion.
+
-
<br />
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
+
-
{| border="1"
+
-
| components  || align="right" | Volume [µL]
+
-
|-
+
-
| DNA  ||  align="right" | 19 µL = 0.68 µg
+
-
|-
+
-
| BSA (100x) ||  align="right" | 0.25
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" | 2.5
+
-
|-
+
-
|Enzyme NotI-HF ||  align="right" | 1
+
-
|-
+
-
|Enzyme PstI-HF ||  align="right" | 1
+
-
|-
+
-
|H2O||  align="right" | 1.25
+
-
|-
+
-
|'''Total volume'''||  align="right" | 25
+
-
|}
+
-
*Incubation: 1 h 15 minutes
+
-
<br /><br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
-
<br />
+
-
1.3 g Agarose, 65 mL TAE (2 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes
+
-
<br />
+
-
<br />
+
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (5x)/µl
+
-
!Expected size 1 (Geneious)
+
-
!Expected size 2 (Geneious)
+
-
|--
+
-
|left ITR fragment
+
-
|25 µl
+
-
|4 µl
+
-
|145 bp = left ITR
+
-
|}
+
-
{| align=right
+
-
|}
+
-
<br />
+
-
*Marker: GeneRuler ladder mix
+
-
{| border="1"
+
-
|
+
-
!Marker [µL]
+
-
!Sample left ITR [µL]
+
-
|-
+
-
!Lane
+
-
|8
+
-
|29
+
-
|-
+
-
|}
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
+
-
<br />
+
-
Gel measurement:
+
-
<br />
+
-
{| border="1"
+
-
| align="left" | '''Sample''' ||align="left"| '''weight''' ||align="left"| '''concentration'''
+
-
|-
+
-
| align="left" | left ITR ||align="left"| 0.09 g ||align="left"| 3.59 ng/µL
+
-
|}
+
-
<br /><br />
+
-
<br>
+
-
<br>
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Practical Cloning: Digestion of pGA14_Präfix-rITR with EcoRI + PstI</u></p>
+
-
*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 EcoRI-HF; Enzyme 2 PstI-HF
+
-
<br />
+
-
'''Comments:''' No.
+
-
<br />
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
+
-
<br>
+
-
Plasmid: P63.1; c = 501.14 ng/µL
+
-
{| border="1"
+
-
| components  || align="right" | Volume [µL]
+
-
|-
+
-
| DNA  ||  align="right" | 4
+
-
|-
+
-
| BSA (100x) ||  align="right" | 0.2
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" | 2
+
-
|-
+
-
|Enzyme NotI-HF ||  align="right" | 1
+
-
|-
+
-
|Enzyme PstI-HF ||  align="right" | 1
+
-
|-
+
-
|H2O||  align="right" | 11.8
+
-
|-
+
-
|'''Total volume'''||  align="right" | 20
+
-
|}
+
-
*Incubation: 1 h 15 minutes
+
-
<br /><br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
-
<br />
+
-
1.3 g Agarose, 65 mL TAE (2 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes
+
-
<br />
+
-
<br />
+
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (5x)/µl
+
-
!Expected size 1 (Geneious)
+
-
!Expected size 2 (Geneious)
+
-
|--
+
-
|Präfix - right ITR
+
-
|20 µl
+
-
|3.5 µl
+
-
|165 bp = left ITR
+
-
|}
+
-
{| align=right
+
-
|}
+
-
<br />
+
-
*Marker: GeneRuler ladder mix
+
-
{| border="1"
+
-
|
+
-
!Marker [µL]
+
-
!Sample Präfix-rITR [µL]
+
-
|-
+
-
!Lane
+
-
|8
+
-
|23
+
-
|-
+
-
|}
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
+
-
<br />
+
-
Gel measurement:
+
-
<br />
+
-
{| border="1"
+
-
| align="left" | '''Sample''' ||align="left"| '''weight''' ||align="left"| '''concentration'''
+
-
|-
+
-
| align="left" | Präfix-rITR ||align="left"| 0.08 g ||align="left"| 7.55 ng/µL
+
-
|}
+
-
<br /><br />
+
-
<br>
+
-
Gel picture of left ITR fragment and Präfix-rITR fragment: <br>
+
-
<br>
+
-
[[File:26.07.ITRs.JPG|400px]] <br>
+
-
<br>
+
-
'''Comment:''' The left ITR fragment was, as expected, nearly not detectable. Nevertheless it was cut out of the gel, because the same probleme occured during the first fancy-performance, which turned out to be successful!
+
-
<br>
+
-
<br>
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Practical Cloning: Digestion of pGA14 with EcoRI + NotI </u></p>
+
-
*plasmid: P61 (200 ng/µL) = pGA14_Cerulean
+
-
*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 = EcoRI-HF; Enzyme 2 = NotI-HF
+
-
<br />
+
-
'''Comments:''' This digested vector used used for both ligation approaches.
+
-
<br />
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
+
-
{| border="1"
+
-
| components  || align="right" | Volume [µL]
+
-
|-
+
-
| DNA  ||  align="right" | 10
+
-
|-
+
-
| BSA (100x) ||  align="right" | 0.3
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" | 3
+
-
|-
+
-
|Enzyme EcoRI-HF ||  align="right" | 1.5
+
-
|-
+
-
|Enzyme NotI-HF ||  align="right" | 1.5
+
-
|-
+
-
|H2O||  align="right" | 13.7
+
-
|-
+
-
|'''Total volume'''||  align="right" | 30
+
-
|}
+
-
*Incubation: 1 h 15 minutes
+
-
<br /><br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
-
<br />
+
-
0.5 g Agarose, 50 mL TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 60 minutes
+
-
<br />
+
-
<br />
+
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (5x)/µl
+
-
!Expected size 1 (Geneious)
+
-
|--
+
-
|pGA14
+
-
|30 µl
+
-
|4 µl
+
-
|2887 bp
+
-
|}
+
-
{| align=right
+
-
|}
+
-
<br />
+
-
*Marker: GeneRuler ladder mix
+
-
{| border="1"
+
-
|
+
-
!Marker [µL]
+
-
!Sample pGA14 [µL]
+
-
|-
+
-
!Lane
+
-
|8
+
-
|34
+
-
|-
+
-
|}
+
-
<br />
+
-
<br>
+
-
[[File:26.07.pGA14 E+N.JPG]]
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
+
-
<br />
+
-
Gel measurement:
+
-
<br />
+
-
{| border="1"
+
-
| align="left" | '''Sample''' ||align="left"| '''weight''' ||align="left"| '''concentration'''
+
-
|-
+
-
| align="left" | pGA14 ||align="left"| 0.08 g ||align="left"| 13.63 ng/µL
+
-
|}
+
-
<br /><br />
+
-
<br>
+
-
<br>
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Hybridization of ITR-Oligos</u></p>
+
-
<br>
+
-
'''left ITR:'''
+
-
* 10 µL Oligo 1 (O100 = lITR_'''Präfix'''_RFC10_for bzw. O104 = rITR_'''Suffix'''_RFC10_for)
+
-
* 10 µL Oligo 2 (O101 = lITR_'''Präfix'''_RFC10_rev bzw. O105 = rITR_'''Suffix'''_RFC10_rev)
+
-
* 4 µL 100 mM TrisHCl pH8
+
-
* 8 µL 5 mM MgCl2
+
-
* 8 µL H2O
+
-
Total: 40 mL
+
-
<br>
+
-
Because some of the oligos produce strong secondary structures, we used the ORIGAMI1 program:<br>
+
Dry ice can be fetched from the department for macromolecular chemistry. The chemical depot is located in the second basement. The dry ice can be retrieved from monday to friday from 11:00 to 11:30 and from 14:15 to 14:30. The requestforms for this institute can be found in the iGEM folder and should be filled out, signed by an advisor and taken to the chemical depot. A styrofoam container is required for the transport.<br>
-
1) initial denaturation: 99°C, 7 minutes<br>
+
-
2) 99°C, 1 minute<br>
+
-
3) 73 x repetition of 2) -> -1°C, R = 0.3 °C/sec<br>
+
-
4) hold 4°C<br>
+
-
<br>
+
-
<p style="font-size:20px; font-weight: bold; color: blue;"><u>Ligation</u></p>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Annotation of the BRs and the PLA2 domains </u></p>
-
<br>
+
Volker<br>
-
1. Ligation of left ITR + Präfix + pGA14:
+
The Bacis Regions which are important for the nuclear localisation were annotated in the protein sequences of VP 1-3 according to:
-
* Präfix-Oligos: 1 µL
+
[[Media:Freiburg10_Separate basic region motifs within the adeno-associated virus capsid proteins are essential for infectivity and assembly.pdf|[Grieger et al, 2006]]]<br>
-
* left ITR: 8 µL
+
-
* pGA14: 8 µL
+
-
* Buffer: 2 µL
+
-
* T4 Ligase: 1 µL
+
-
Total: 20 µL <br>
+
-
<br>
+
-
2. Ligation of Präfix-rITR  + Suffix+ pGA14:
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Endotoxin-free Midi-Prep of pAAV_iGEM_mVenus-YFP </u></p>
-
* Präfix-Oligos: 1 µL
+
Chris W., Hanna (guided by Sven) <br>
-
* Präfix-rITR: 8 µL
+
Midi-Prep was performed following standard protocol: [[File:Freiburg10 Endotoxinfreie Midi.pdf]] <br>
-
* pGA14: 8 µL
+
DNA concenration was measured: 507 ng/µL <br>
-
* Buffer: 2 µL
+
Plasmid was further used for a... <br>
-
* T4 Ligase: 1 µL
+
-
Total: 20 µL <br>
+
-
<br>
+
-
The ligation approaches were incubated at 16°C over night (thermocycler).
+
-
<br>
+
-
<br>
+
-
====<p style="font-size:17px; background-color:#66bbff;">'''Biobrick of GMK'''</p>====
+
-
'''Investigators: Stefan''' <br>
+
-
'''aim:''' Biobrick construction of pAAV_RFC25_gmk for further addition of TK30.<br>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>... Second Transfection</u></p>
-
'''result:''' Transformation worked out, clones can be picked. <br>
+
Six transfections were performed according to the standart protocol: [[Media:Freiburg10_Transfection_protocoll.pdf]]<br>
-
expected construct:<br>
+
Three 10 cm cellcluture dishes with 293 cells were transfected with 10 µg DNA (3,33 µg each plasmid) and the other three 10 cm cellculture dishes with 30 µg DNA (10 µg DNA each plasmid).
-
[[File:Freiburg10 pAAV RFC25 gmk biobrick construction.png|400px]]<br>
+
-
Digestion with XbaI and AgeI and ligate into vector which was digested with XbaI and AgeI as well.<br>
+
Plasmids:
 +
* pAAV_iGEM-MCS_mVenus (P41), 507 ng/µl
 +
* pAAV_RC , 1000 ng/µl
 +
* pHelper , 280 ng/µl
 +
Investigators: Patrick, Johannes
-
PCR of gmk:
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Preparing Viral Stocks</u></p>
-
*DNA template: puB6_V5_His6_clone1 + TK/GMK; concentration: 493,7 ng/µl
+
-
<br />
+
-
*PCR program: GMK
+
-
<br />
+
-
{| border="1"
+
-
| '''components'''  || align="right" |'''volume in µl''' 
+
-
|-
+
-
| 5x Phusion HF buffer  ||  align="right" |10
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" |1
+
-
|-
+
-
|pmGMK_TK30_prefix_RFC25_for (082) (1:10 dilution)||  align="right" |2,5 (0,5 µM) 
+
-
|-
+
-
|pmGMK_suffix_RFC25_rev (080) (1:10 dilution)||  align="right" |2,5 (0,5 µM)
+
-
 
+
-
|-
+
-
|DNA template: puB6_V5_His6_clone1 + TK/GMK (1:100)||  align="right" | 0,5 µL of 1:100 dilution 
+
-
|-
+
-
|DMSO||  align="right" | - 
+
-
|-
+
-
|Phusion polymerase||  align="right" |0,5 
+
-
|-
+
-
|H2O||  align="right" |33 µL
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" |50
+
-
|}
+
-
<br />
+
 +
... according to the standart protocol (see AAV Helper-free System manual). No dilution was performed.
 +
Investigators: Johannes, Patrick
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>HT1080 Transduction</u></p>
-
<p style="font-size:17px; font-weight: bold; color: blue;">Digestion of pAAV_RCF25:</p>
+
Four 10 cm cellculture dishes with HT1080 cells have been provided for the transduction.
 +
*1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 1. Note: the virus solution (buffer) showed a yellow coloration.
 +
*1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 2. Note: the virus solution showed (buffer) an orange coloration.
 +
*1 ml of the AAV-2-mVenus (derived from P 38) was pipeted to into dish 3. Note: the virus solution showed (buffer) an orange coloration.
 +
*1 ml of the AAV-2-mVenus (derived from P 38) was pipeted to into dish 4. Note: the virus solution showed (buffer) an orange coloration.
-
*DNA-Concentration: 321,5 ng/µl
+
Apart from the dilution, the transduction was performed according to the standart protocol.
-
<br />
+
-
{| border="1"
+
Investigators: Johannes, Patrick
-
| components  || align="right" |volume of vector /µl
+
-
|-
+
-
| DNA  ||  align="right" |4
+
-
|-
+
-
| BSA (10x) ||  align="right" |3
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" |3
+
-
|-
+
-
|AgeI ||  align="right" |1
+
-
|-
+
-
|XbaI ||  align="right" |1
+
-
|-
+
-
|H2O||  align="right" |18
+
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" |30
+
-
|}
+
-
<br /><br />
+
-
<p style="font-size:17px; font-weight: bold; color: blue;">Gel running of digested vector and PCR products</p>
+
===38.Labortag 22.06.2010: Midiprep of pHelper plasmid; cloning of the rfc25 MCS===
-
* 1% Agarose gel
+
Investigators: Bea, Chris W, Adrian, Achim
-
* 3 µl Gelred, 8 µl DNA-Ladder-Mix
+
-
* 125 Volt, running time: 60 minutes
+
-
<br />
+
-
Sample of Hanna was loaded as well, see extra journal entry.<br>
+
-
{| border="1"
+
*Hybridisation of o'''ligos RFC25 EcoR1+BglII for & RFC25 EcoR1+BglII rev'''
-
| '''Sample/µl  || align="right" |''' Loading dye (5x)/µl || align="right" |''' Expected size/bp
+
**Programm ORIGAMI1 was modified for normal oligos:
-
|-
+
***1 95°C 7'
-
| Vector/ 30 || align="right" |6 ||  align="right" |4636
+
***2 95°C 1'
-
|-
+
***-1°C R=0,3°s
-
| gmk/    50 || align="right" |10 || align="right" |603
+
***Rep 70
-
|-
+
-
|}
+
-
<br />
+
-
[[File:Freiburg10 pAAV RFC25 digestion and PCR of gmk.jpg|400px]]
+
*conc of Oligos: 138,3µg/µl
 +
<br> '''Digestion'''
-
<p style="font-size:17px; font-weight: bold; color: blue;">Gelextraction</p>
 
-
*Gel extraction performed following standard protocol provided by Qiagen
 
-
<br />
 
-
{| border="1"
 
-
| '''Sample/  || align="right" | Weight/g || align="right" | QG buffer/µl 
 
-
|-
 
-
| pAAV_RFC25  ||  align="right" |0,15 ||  align="right" |450
 
-
|-
 
-
| gmk  ||  align="right" |0,21 ||  align="right" |630
 
-
|-
 
-
|}
+
<li> plasmid: name: pAAV_MCS number: P9 production date: 01.06.2010 origin: Adrian, Hanna, Bea
-
<br /><br />
+
<li> new vector name: pAAV_RFC25
 +
<li> buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:23) EcoRI ; Enzyme 2 (no.Lab:15) BglII
 +
<li> DNA concentration (vector): 261,6 ng/µL
-
<p style="font-size:17px; font-weight: bold; color: blue;">Digestion of PCR products</p>
 
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl  
+
| components  || align="right" |volume of vector /µl || align="right" |volume of insert /µl  
|-
|-
-
| DNA  ||  align="right" |30
+
| DNA  ||  align="right" | 5,8||  align="right" | none
|-
|-
-
| BSA (10x) ||  align="right" |4
+
| BSA (100x) ||  align="right" | none ||  align="right" | none
|-
|-
-
| Buffer 4 (10x)||  align="right" |4
+
| Buffer 3 (10x)||  align="right" |3 ||  align="right" | none
|-
|-
-
|AgeI ||  align="right" |1  
+
|Enzyme EcoRI (no.Lab:23)||  align="right" |1,5 ||  align="right" | none
|-
|-
-
|XbaI ||  align="right" |1  
+
|Enzyme BglII (no.Lab:15)||  align="right" |1,5||  align="right" | none
|-
|-
-
|H2O||  align="right" |0
+
|H<sub>2</sub>O||  align="right" | 18,2||  align="right" | none
|-
|-
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" |40
+
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | 30||  align="right" | none
|}
|}
-
<br /><br />
 
-
<p style="font-size:17px; font-weight: bold; color: blue;">Purification of PCR products, Ligation, Transformation</p>
+
<li> Incubation: 1,5 h
-
'''Purification has been followed by a different protocol (see Sven); has to be added in the standard protocols !
 
 +
*A 1% agarose gel was prepared for plasmid separation
-
*Measure DNA-concentration with Nanodrop:
+
* Production of antibiotika-stock-solutions (10 x 1ml AMP)
-
c(pAAV_RFC25) = 35,46 ng/µL <br />
+
-
c(gmk) = 72,84 ng/µL <br />
+
-
*Calculation of volume needed for ligation:
+
-
c(pAAV_RFC25) = 7,56 µL <br />
+
-
c(gmk) = 1,44 µL<br>
+
-
=== 71. Labortag 27.7.2010 ===
+
* Midi Prep of pAAV-Helper: concentration. 732,6 µg/µl
-
====<p style="font-size:15px; background-color:#66bbff;">'''Cloning of linkers in pSB1C3_RFC25_CFP1.1 '''</p>====
+
-
Investigator: Jessica<br>
+
-
'''Linkers longlinker, SEG and GSAT should be cloned into the RFC25-standard'''<br>
+
-
* P66: GSAT_linker_pMA 242,7 ng/µl
+
-
* P67: LonglinkerA50_pMA 230,4 ng/µl
+
-
* P71: SEG_pMA 211,8 ng/µl
+
-
* P51: pSB1C3_RFC25_CFP1.1 230,1 ng/µl
+
-
all linkers and pSB1C3_RFC25_CFP1.1 are digested with AgeI and XbaI for 2 hours
 
-
{| border="1"
 
-
| components  || align="right" |volume of vector /µl (P66) || align="right" |volume of insert /µl (P67)|| align="right" |volume of insert /µl (P71)|| align="right" |volume of insert /µl (P51)
 
-
|-
 
-
| DNA  ||  align="right" |8,2 ||  align="right" | 8,7||  align="right" | 9,4||  align="right" | 8,7
 
-
|-
 
-
| BSA (10x) ||  align="right" |2||  align="right" | 2||  align="right" | 2||  align="right" | 2
 
-
|-
 
-
| Buffer 4 (10x)||  align="right" |2 ||  align="right" | 2||  align="right" | 2||  align="right" | 2
 
-
|-
 
-
|AgeI ||  align="right" |1 ||  align="right" | 1||  align="right" | 1||  align="right" | 1
 
-
|-
 
-
|XbaI ||  align="right" |1 ||  align="right" | 1||  align="right" | 1||  align="right" | 1
 
-
|-
 
-
|H2O||  align="right" |5,8 ||  align="right" | 5,3||  align="right" | 4,6||  align="right" | 5,3
 
-
|-
 
-
|'''Total volume '''||  align="right" |20 ||  align="right" | 20 µl||  align="right" | 20 µl||  align="right" | 20 µl
 
-
|}
 
-
<br>
 
-
* 1% Agarose gel
 
-
* 3 µl Gelred,  µl DNA-Ladder-Mix for P51, Low range for P66,67,71
 
-
* 130 Volt, running time: 45 minutes for P51, 90 Volt, running time 30 minutes for P66,67,71
 
-
<br />
 
-
{| border="1"
+
Ligation of Oligos: RFC25 and pAAV-MCS.
-
| '''Sample/µl ''' ||''' Expected size/bp
+
-
|-
+
-
| Vector P51  ||  align="right" |2078
+
-
|-
+
-
| Insert P66 ||  align="right" |126
+
-
|-
+
-
| Insert P67 ||  align="right" |54
+
-
|-
+
-
| Insert P71 ||  align="right" |126
+
-
|-
+
-
|}
+
-
<br />
+
-
* weight of P66 gel extract: 0,04g
+
-
* weight of P67 gel extract: 0,09g
+
-
* weight of P71 gel extract: 0,1g
+
-
* weight of P51 gel extract: 0,15g
+
-
finally called:
+
* dilution of our Oligos RFC from 138,3 µg/µl 1:10 13,83 (71bp long)=> 0,64µl
-
* pSB1C3_RFC25_longlinker '''P96'''
+
* Vektor pAAV-MCS 23.3 µg/µl                                      => 8,36µl
-
* pSB1C3_RFC25_GSAT '''P97'''
+
* two plates are placed in the 37°C room
-
* pSB1C3_RFC25_SEG '''P98'''
+
-
'''Nanodrop'''
+
*Trafo has been performed following standard protocols
-
* Longlinker (P67): 2,1ng/µl
+
-
* SEG (P71): 3,7ng/µl
+
-
* GSAT (P66): 1,4ng/µl
+
-
* pSB1C3_RFC25: 29,6ng/µl<br>
+
-
'''Ligation'''
+
===39.Labortag 23.06.2010: Preparation of Viral Stock, Seeding cells===
-
*P51:P66 - 2,2µl:6,8µl
+
-
*P51:P67 - 2,53µl:6,47µl
+
-
*P51:P71 - 5,54µl:3,46µl<br>
+
-
'''Transformation'''
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Design of Primer</u></p>
-
* 4µl DNA was added to 50µl XL1b
+
Achim, Hanna
-
====<p style="font-size:15px; background-color:#66bbff;">'''Result sequencing of pAAV_RFC25_mGMK_TK30'''</p>====
+
In order to sequence the hGH (polyadenylation) sequence and in general the GOI (gene of interest :) ) primer were designed: [[File:Primer GOI+polyA pAAV iGEM-MCS mVenus YFP.pdf]]
-
'''Investigator: Bea'''<br>
+
-
<p style="font-size:13px; color:#66bbff;">'''Comments:''' Results of the PCR and cloning experiment from lab day: 23.07.2010 (Mini-Prep). The sucessful insertion of mGMK_ZK 30 into the vector pAAV_RFC25 can be confirmed and is ready for cell culture.</p>
+
-
<p style="font-size:14px;>Results sequencing of ''plasmid '''P81''''' (pAAV_RFC25_mGMK_TK30 clone 1)<br></p>
+
<br>
<br>
-
[[File:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P81.JPG|1000px]]
+
These primer will be used in order to sequence P38 (pAAV_iGEM_mVenus-YFP) which delivered fluorescencing HT1080 cells - in comparison to the already sequenced P39 clone. Further on they can be used in general for sequencing any GOI. <br>
 +
These oligos were ordered at sigma aldrich as E@sy Oligos.
<br>
<br>
 +
P38 was send for sequencing with GATC_std_pTESp-1 primer: 12 µL P39 (180 ng/µL) + 18 µL H<sub>2</sub>O
<br>
<br>
 +
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of pKEX-VP1</u></p>
 +
Achim, Hanna, Adrian, Chris W.
<br>
<br>
 +
Primer:
 +
* VP1 primer for pKEX forward: V = 3 µL + 27 µL H<sub>2</sub>O
 +
* VP1 primer for pKEX reverse: V = 3 µL + 27 µL H<sub>2</sub>O
 +
Vector:
 +
* pKEX-VP1 (P27.2): c = 693 ng/µL, V = 3 µL + 27 µL H<sub>2</sub>O
<br>
<br>
-
<p style="font-size:14px;>Results sequencing of ''plasmid '''P82''''' (pAAV_RFC25_mGMK_TK30 clone 2)<br></p>
 
-
[[File:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P82.jpg]]
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<br>
 
-
<p style="font-size:14px;>Results sequencing of ''plasmid '''P83''''' (pAAV_RFC25_mGMK_TK30 clone 3)<br></p>
 
-
<br>
 
-
[[File:Freiburg10 Sequencing results for pAAV RFC25 mGMK TK30 P83.JPG]]
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Quickchange @ Pst in RepX 68 and RepX 78 '''</p>====
 
-
Investigator: Kira
 
-
'''PCR program''': PstI
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Thaw HT1080 and AAV-293 cells </u></p>
-
<br />
+
Achim, Hanna (guided by Sven)<br>
-
{| border="1"
+
Thawing of HT1080 and AAV-293 cells was performed following this protocol: [[Media:Freiburg10 Thawing cells.pdf]]
-
| components  || align="right" |volume in µl 
+
-
|-
+
-
| 10x Phusion HF buffer  ||  align="right" | 2.5 µl
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" | 0.5 µl
+
-
|-
+
-
| __310 ____primer_for (1:10 dilution)||  align="right" |  0,39 µl
+
-
|-
+
-
| __310____primer_rev (1:10 dilution)||  align="right" |  0,39 µl
+
-
|-
+
-
|DNA template (1:20 dilution)||  align="right" |  0,5 µl
+
-
|-
+
-
|DMSO||  align="right" |  0 µl
+
-
|-
+
-
|Phusion polymerase||  align="right" |  0.5 µl
+
-
|-
+
-
|H2O||  align="right" | 20,22 µl
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 25 µl
+
-
|}
+
-
 
+
-
<br />
+
-
{| border="1"
+
-
| cycles  || align="right" |temperature || align="right" |time
+
-
|-
+
-
| 1 ||  align="right" |95 C ||  align="right" |2 min 
+
-
|-
+
-
| 20 ||  align="right" |95 C ||  align="right" |30 sec
+
-
|-
+
-
| ||  align="right" |66 C ||  align="right" |1 min
+
-
|-
+
-
|||  align="right" |68 C ||  align="right" |5 min
+
-
|}
+
-
<br />
+
-
* The PCR-products were digested with 0.5 µl DpnI
+
-
* Transformation was performed according to the standard protocol in XL1B cells
+
-
 
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Site-directed mutagenesis of pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) with BamHI and SalI'''</p>====
+
-
'''Investigator: Adrian, Bea'''<br>
+
-
<p style="font-size:13px; color:#66bbff;">'''Comments:''' Site-directed mutagenesis was perfomed with pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) in order to delete BamHI and SalI in the plasmid. These restriciton sites need to be removed because they are the single-cutter in the loops which will be used for targeting. </p>
+
<br>
<br>
-
'''Protocol: Different PCR programs were used for performing the Quickchange site-directed mutagenesis protocol.'''
 
-
# Longer elongation/extension time
 
-
# Shorter elongation/extension time
 
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Picking clones of pAAV_RFC25 and inoculating 250 mL DYT with pAAV_iGEM_mVenus-YFP (P38) for Midi-Prep </u></p>
 +
Achim, Chris W., Hanna<br>
 +
Bacteria cultures are stored in 37°C room over night.
<br>
<br>
-
<p style="font-size:13px; color:#25bbAA;">1. '''PCR reaction with PCR program with longer elongation time''': <br></p>
 
-
DNA template used: pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) = P87<br>
 
-
A dilution of 1:20 was prepared and it was calculated the amount of DNA template needed for each site-directed mutagenesis reaction.
 
-
<br />
 
-
{| border="1"
 
-
| '''components'''  || align="right" |'''volume in µl''' || align="right" |'''volume in µl'''|
 
-
|-
 
-
| 10x Phu Ultra HF II buffer  ||  align="right" | 2.5 µl||  align="right" | 2.5 µl
 
-
|-
 
-
| 10 mM dNTP mix ||  align="right" | 0.5 µl||  align="right" | 0.5 µl
 
-
|-
 
-
|  primer_for (1:10 dilution)||  align="right" | '''O68= SDM SalI: 0,67 µl'''||  align="right" |''' O66= SDM BamHI: 0,68 µl'''
 
-
|-
 
-
|  primer_rev (1:10 dilution)||  align="right" | '''O69= SDM SalI: 0,67 µl'''||  align="right" | '''O67= SDM BamHI: 0,72 µl'''
 
-
|-
 
-
|'''P87''' (DNA template) (1:20 dilution)||  align="right" |  0,83 µl||  align="right" |  0,83 µl
 
-
|-
 
-
|DMSO||  align="right" |  -||  align="right" |  -
 
-
|-
 
-
|Phusion polymerase||  align="right" |  0.5 µl||  align="right" |  0.5 µl
 
-
|-
 
-
|H2O||  align="right" | 19,33 µl||  align="right" | 18,77 µl
 
-
|-
 
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 25 µl||  align="right" | 25 µl
 
-
|}
 
-
<br />
 
-
<p style="font-size:13px; color:#25bbAA;">'''Used PCR programs for both SDMs''': </p>
+
Adrian, Sven
-
'''Comment:''' Program has a long extension time because Quikchange Kit (Stratagene) recommends 1 minute per kb. Our vector has a length of 7300 bp therefore 7 minutes and 30 seconds were chosen for proper elongation of the whole vector.
+
<gallery widths=500px heights=300px perrow=2 caption="Results of transduction, ~ 1% of the HT1080 showed expression of mVenus.">
 +
File:YFP-Transduction-1.jpg|Bright light image 1
 +
File:YFP-Transduction-2.jpg|Fluoresce microscopy image 1
 +
File:YFP-Transduction-3.jpg|Bright light image 1
 +
File:YFP-Transduction-4.jpg|Fluoresce microscopy image 1
 +
</gallery>
-
{| border="1"
 
-
| '''Rounds'''  || align="right" |'''Temperature''' || align="right" |'''Time'''
 
-
|-
 
-
|1 || align="right" |95°C || align="right" |2'
 
-
|-
 
-
|20 || align="right" |95°C || align="right" |30''
 
-
|-
 
-
|  || align="right" |60°C || align="right" |1'
 
-
|-
 
-
|  || align="right" |68°C || align="right" |7 min 30 sec
 
-
|-
 
-
|  Hold || align="right" |4°C || align="right" |
 
-
|-
 
-
|}
 
-
<br />
 
-
<p style="font-size:13px; color:#25bbAA;">'''2. PCR reaction with PCR program with shorter elongation time''': <br></p>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Preparation of viral stocks</u></p>
-
DNA template used: pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) = P87<br>
+
Johannes, Bea
-
A dilution of 1:20 was prepared and it was calculated the amount of DNA template needed for each site-directed mutagenesis reaction.
+
Please fill in!!!
-
<br />
+
<br>
-
{| border="1"
+
Steril filtration of virus particles was performed (guided by Sven). Viral stocks are stored at -80°C.
-
| '''components'''  || align="right" |'''volume in µl''' || align="right" |'''volume in µl'''|
+
-
|-
+
-
| 10x Phu Ultra HF II buffer  ||  align="right" | 2.5 µl||  align="right" | 2.5 µl
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" | 0.5 µl||  align="right" | 0.5 µl
+
-
|-
+
-
|  primer_for (1:10 dilution)||  align="right" | '''O68= SDM SalI: 0,67 µl'''||  align="right" |''' O66= SDM BamHI: 0,68 µl'''
+
-
|-
+
-
|  primer_rev (1:10 dilution)||  align="right" | '''O69= SDM SalI: 0,67 µl'''||  align="right" | '''O67= SDM BamHI: 0,72 µl'''
+
-
|-
+
-
|'''P87''' (DNA template) (1:20 dilution)||  align="right" |  0,83 µl||  align="right" |  0,83 µl
+
-
|-
+
-
|DMSO||  align="right" |  -||  align="right" |  -
+
-
|-
+
-
|Phusion polymerase||  align="right" |  0.5 µl||  align="right" |  0.5 µl
+
-
|-
+
-
|H2O||  align="right" | 19,33 µl||  align="right" | 18,77 µl
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 25 µl||  align="right" | 25 µl
+
-
|}
+
-
<br />
+
-
<p style="font-size:13px; color:#25bbAA;">'''Used PCR programs for both SDMs''': </p>
+
===40.Labortag 24.06.2010: Labmeeting, Presentation/Update by Patrick and Adrian, Midi Prep of pAAV_iGEM_mVenus-YFP, Mini Prep pAAV_RFC25===
-
'''Comment:''' Quikchange Protocol (Stratagene) recommends 30 seconds per kb chosing a elongation temperature of 68°C. Our vector has a length of 7300 bp therefore 4 minutes were chosen for proper elongation of the whole vector. In order to see wheter this PCR program works aswell the same PCR ingredients were chosen as it can be seen in the table above.
+
-
{| border="1"
+
Delivery of:
-
| '''Rounds'''  || align="right" |'''Temperature''' || align="right" |'''Time'''
+
<br>
-
|-
+
-
|1 || align="right" |95°C || align="right" |2'
+
-
|-
+
-
|20 || align="right" |95°C || align="right" |30''
+
-
|-
+
-
|  || align="right" |60°C || align="right" |1'
+
-
|-
+
-
|  || align="right" |68°C || align="right" |4'
+
-
|-
+
-
|  Hold || align="right" |4°C || align="right" |
+
-
|-
+
-
|}
+
-
<br />
+
-
'''Summary''': Four site-directed mutagenesis have been performed with the plasmid pAAV_RC_PstI_310+4073 (pAAV_RC_1.1) = P87.
+
Proteinkinase K (will be used for the degradation of the viral capsid prior to qPCR)
-
*Site-directed mutagenesis in order to delete restriction site BamHI
+
-
**with shorter elongation time (modified protocol)
+
-
**with longer elongation time
+
-
*Site-directed mutagenesis in order to delete restriction site SalI
+
-
**with shorter elongation time (modified protocol)
+
-
**with longer elongation time
+
-
*The samples  were digested with 0,5µL DpnI after site-directed mutagenesis were performed in order to remove bacterial DNA template.
+
-
*Trafos have been performed with all four samples. Trafo plates are containing ampicillin.
+
<br>
<br>
 +
Benzonase (will be used fur viral stock preparation)
<br>
<br>
 +
Primer for for ITR-Conversion to iGEM-Standart
-
====<p style="font-size:15px; background-color:#66bbff;">'''Cell culture'''</p>====
 
-
Investigator: Adrian
 
-
<br>
 
-
* 3 x 6er dishes for Transduction were seeded and passaged(P14)
 
-
====<p style="font-size:15px; background-color:#fuchsia;">'''ITRs: Trafo of overnight-ligation approaches'''</p>====
+
*Presentations of Adrian and Patrick: [[File:Adrian.ppt]] [[File:Patrick.ppt‎]]
-
'''Investigator: Hanna'''<br>
+
-
<p style="font-size:13px; color:#Fuchsia;">'''Comments:''' Cloning approach was continued: RFC10-Präfix_rightITR was ligated to RFC10-Suffix and pGA14 and leftITR was ligated to RFC10-Präfix and pGA14 over night. Trafo of these samples was performed in order to pick clones tomorrow.   </p>
+
<br>
<br>
-
Trafo was performed following the standard protocol. Abberance: 4 µL DNA was added to BL21 cells. <br>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Midi-Prep of pAAV_iGEM_mVenus-YFP</u></p> <br>
 +
Investigators: Hanna, Chris W (Adrian inserted RNAse and Ethanol into Buffers)
 +
* new kit from Qiagen was used
 +
* 35 ml of the over-night culture was filled into a 50 mL falcon and centrifuged at '''5000 g''' at '''4°C''' for '''5 minutes'''.
 +
* supernatant was discarded
 +
* Midi-prep was performed according to manual of Qiagen
 +
* final concentrations: 380,4 µg/µl
 +
* Name of eppi: '''P44'''
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Mini Prep of P42 and P43 pAAV-RFC-25</u></p>
 +
Investigator: Bea
 +
* Mini-Prep was performed following standard protocols
 +
* conc: P42: 321,5 µg/µl
 +
* conc: P43: 310,1 µg/µl
<br>
<br>
 +
====ITR modification via PCR====
 +
*Primers for ITR modification were resuspended and labeled: left forward: o24, left reverse: o25, right forward: o26, right reverse: o27
 +
 +
====Work on pKEX backbones====
 +
Volker
-
====<p style="font-size:15px; background-color:#fuchsia;">'''PCR: beta-Globin'''</p>====
+
The sequencing data was evaluated and BLAST searches were carried out on NCBI to answer the question weather the sequence belongs to the backbone pKEX. This question could be answered positively. <br>
-
'''Investigator: Hanna'''<br>
+
There are standard Primers from GATC that prime in the sequence. The three expression plasmids from PD Kleinschmidt will therefor be sequenced tomorrow.<br>
-
Because sequencing delivered, that cloning of the beta-globin intron into pSB1C3 didn't work (Cerulean was still in the vector), the PCR was performed one more time: <br>
+
Additionnaly nine primers for sequences in the AAV Rep and Cap genes were disigned.
 +
'
<br>
<br>
-
<br />
+
 
-
{| border="1"
+
===41.Labortag 25.06.2010: PCR of ITRs, Splitting HT1080 and AAV-293 cells, Seeding of HT1080 cells, Creating Virus Stock Economics, Medium check===
-
| components  || align="right" |volume [µl] 
+
-
|-
+
-
| 5x Phusion HF buffer  ||  align="right" | 10
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" | 1
+
-
|-
+
-
| beta-globin_primer_for||  align="right" | 2,5
+
-
|-
+
-
| beta-globin_primer_rev||  align="right" | 2,5
+
-
|-
+
-
|DNA template||  align="right" | 1 ng = 2.8 µL of 1:1000 dilution of pAAV_MCS, c=360 ng/µL
+
-
|-
+
-
|DMSO||  align="right" | -
+
-
|-
+
-
|Phusion polymerase||  align="right" | 0,5
+
-
|-
+
-
|H2O||  align="right" | 30.7 
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 50
+
-
|}
+
-
<br /><br />
+
<br>
<br>
-
'''PCR program:''' <br>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Preparation for PCR of ITRs </u></p>
-
* 98°C, 1'
+
-
<br>
+
-
* 98°C, 30''
+
-
* 63°C, 25''
+
-
* 72°C, 15''
+
-
-> 8x <br>
+
-
<br>
+
-
* 98°C, 30''
+
-
* 72°C, 20''
+
-
-> 20x <br>
+
-
<br>
+
-
* 1 x 72°C, 5'
+
-
* Hold: 4°C
+
-
<br>
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Repetition of PCR for hGH BioBrick Production'''</p>====
+
-
'''Investigator: Bea'''<br>
+
-
<p style="font-size:13px; color:#25bbAA;">'''Comments:''' Sequencing of pSB1C3_hGH did not reveal any insertion of hGH into pSB1C3. Instead of hGH CFP was found in the vector indicating that undigested or partially digested vector religated. Therefore a new pCR for generating the BioBrick was performed over night.  </p>
+
-
PCR reaction:
+
-
{| border="1"
+
-
| components  || align="right" |volume [µl] 
+
-
|-
+
-
| 5x Phusion HF buffer  ||  align="right" | 10
+
-
|-
+
-
| 10 mM dNTP mix ||  align="right" | 1
+
-
|-
+
-
| hGH_primer_for||  align="right" | 2,5
+
-
|-
+
-
| hGH-globin_primer_rev||  align="right" | 2,5
+
-
|-
+
-
|DNA template||  align="right" | 1 ng = 2.8 µL of 1:1000 dilution of pAAV_MCS, c=360 ng/µL
+
-
|-
+
-
|DMSO||  align="right" | -
+
-
|-
+
-
|Phusion polymerase||  align="right" | 1
+
-
|-
+
-
|H2O||  align="right" | 30.7 
+
-
|-
+
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 50
+
-
|}
+
-
<br /><br />
+
-
<p style="font-size:13px; color:#25bbAA;">'''Used PCR programs''': </p>
+
==== '''Digestion of pAAV_MCS (P9)''' ====
-
'''Comment:''' PCR will be performed over night.<br>
+
-
{| border="1"
+
-
| '''Rounds'''  || align="right" |'''Temperature''' || align="right" |'''Time'''
+
-
|-
+
-
|1 || align="right" |98°C || align="right" |1'
+
-
|-
+
-
|8 || align="right" |98°C || align="right" |30''
+
-
|-
+
-
|  || align="right" |58°C || align="right" |25''
+
-
|-
+
-
|  || align="right" |72°C || align="right" |12''
+
-
|-
+
-
|17 || align="right" |98°C || align="right" |30''
+
-
|-
+
-
|  || align="right" |69°C || align="right" |25''
+
-
|-
+
-
|  || align="right" |72°C || align="right" |12''
+
-
|-
+
-
|  Hold || align="right" |4°C || align="right" |
+
-
|-
+
-
|}
+
-
<br />
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones from pAAV_RFC25_mGMK '''</p>====
+
-
'''Investigator: Bea'''
+
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:'''  Trafo plate looked good. On control plate only few clones grown in contrary to the XL1-B{pAAV_RFC25-mGMK} plate. Two clones were picked.</p>
+
-
*10 mL containing 10µL  ampiciliin were inoculated.
+
-
*Put into 37°C room on shaker.
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones from Retrafo of pTV_CMV clone 7 and clone 8 '''</p>====
+
-
'''Investigator: Bea'''
+
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:'''  Trafo plates looked good. Enough clones grown. Two clones of each plate were picked</p>
+
-
*10 mL containing 10µL  ampiciliin were inoculated with each clone respectively.
+
-
*Put into 37°C room on shaker.
+
-
 
+
-
=== 72. Labortag 28.7.2010 ===
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Results Trafo pAAV_RC_1.1_BamHI and pAAV_RC_1.1_SalI'''</p>====
+
-
'''Investigator: Bea'''<br>
+
-
<p style="font-size:13px; color:#25bbAA;">'''Results:''' Too many bacteria grown resulting in a bacterial lawn. Possible reasons could be some problems with the new prepared ampicillin because trafo from Hanna containing the ITRs had the same results. Trouble shooting done by Hanna. </p>
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Proceed with BioBrick Production of hGH and beta-globin'''</p>====
+
<li> experiment date: 25.06.2010
-
'''Investigator: Bea'''<br>
+
<li> name of investigator: Bea
-
<p style="font-size:13px; color:#25bbAA;">'''Comments:''' PCR was started yesterday and conducted over night.</p>
+
<li> plasmid: name: pAAV_MCS number: P9 production date: 08.05.2010 origin: SH
-
'''Proceeding:'''
+
<li> buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:113) NgoMIV ; Enzyme 2 (no.Lab:120) AlwNI
-
*Prepare 1% agarose gel and load samples on gel.  
+
<li> DNA concentration (vector): 267,9 ng/µL
-
*Run time: 45 minutes
+
<br>
<br>
-
<p style="font-size:15px; color:#25bbAA;">'''Result of gel:''' <br></p>
+
In order to receive the best PCR-results, two digestion reactions/approaches have been performed. <br>  
-
Marker did not resolute very good. Expected sizes of PCR products:
+
The first digestion was cut only with AlwNI, the second digestion was cut with AlwNI and NgomIV.<br>
-
*hGH = 510 bp
+
-
*beta globin intron: 524 bp
+
-
It can be seen (or estimated) that two intensive bands are visible at around 500 bp. Therefore these two bands were cut out and a gel extraction was performed. The lower visible band at around 100 bp of hGH is an additional band generated at the pCR reaction. The two intensive blurred bands belong to the loading dye added to the samples.
+
<br>
<br>
-
<br>
 
-
[[File:Freiburg10 PCR of hGH and Bet a globin repeat agaorse gel 28 07 2010008.jpg|400px]]
 
-
<br>
 
-
<br>
 
-
<br>
 
-
After gel extraction was performed, the PCR prdoucts hGH and beta-globin were digested:
 
-
<p style="font-size:15px; color:#25bbAA;">DIGESTION of PCR products</p>
 
{| border="1"
{| border="1"
-
| '''components'''   || align="right" |'''hGH/µl''' || align="right" |'''beta-globin /µL'''
+
| components  || align="right" |v(pAAV_MCS 1) /µl || align="right" |v(pAAV_MCS 2) /µl
|-
|-
-
| pSB1C3_CFP ||  align="right" |29 ||  align="right" |29
+
| DNA ||  align="right" | 4||  align="right" | 4
|-
|-
-
| BSA (100x) ||  align="right" | 0,4||  align="right" | 0,4
+
| BSA (100x) ||  align="right" |none ||  align="right" | none
|-
|-
-
| Buffer 4 (10x)||  align="right" |4||  align="right" |4
+
| Buffer 4 (10x)||  align="right" | 2||  align="right" | 2
|-
|-
-
|XbaI ||  align="right" |1 ||  align="right" |1  
+
|Enzyme AlwNI (no.Lab: 120)||  align="right" |1 ||  align="right" | 1
|-
|-
-
|PstI ||  align="right" |1 ||  align="right" |1
+
|Enzyme NgoMIV (no.Lab:113)||  align="right" | none ||  align="right" | 1
|-
|-
-
|H2O||  align="right" |4,6||  align="right" |4,6
+
|H<sub>2</sub>O||  align="right" | 13,0||  align="right" | 12,0
|-
|-
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" |'''40''' ||  align="right" |'''40'''
+
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | '''20'''||  align="right" | '''20'''
|}
|}
-
<br />
 
-
*Incubate for 2h at 37°C
 
-
*Perform PCR purification following standard protocols
 
-
*Elute in 20µL EB-buffer, put on 50°C for 3 minutes before centrifugating
 
-
*Measure DNA with NanoDrop:
 
-
**c(hGH) = 58,14 ng/µL
 
-
**c(ß-globin) = 83,10ng/µL
 
<br>
<br>
-
In the meantime prepare the '''digestion of vector pSB1C3_CFP''' (P51)
+
<li> Incubation:1,5h
-
<p style="font-size:15px; color:#25bbAA;">DIGESTION of pSB1C3_CFP</p>
+
<li> 1% agarose gel has been prepared. Running the gel at 110 V for 45 minutes.
-
{| border="1"
+
<li> Loading plan: Marker (8 µL), pAAV_MCS 1 (24 µL), paav_MCS 2 (24 µL)
-
| '''components'''  || align="right" |'''volume /µl'''
+
-
|-
+
-
| pSB1C3_CFP  ||  align="right" |5
+
-
|-
+
-
| BSA (10x) ||  align="right" |2
+
-
|-
+
-
| Buffer 4 (10x)||  align="right" |2
+
-
|-
+
-
|XbaI ||  align="right" |1
+
-
|-
+
-
|PstI ||  align="right" |1
+
-
|-
+
-
|H2O||  align="right" |9
+
-
|-
+
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" |'''20'''
+
-
|}
+
-
<br />
+
-
*Incubate for 2h at 37°C
+
-
*Load sample on 1% preparative agarose gel  
+
-
*Run for 45 minutes at 110 V
+
<br>
<br>
-
<p style="font-size:15px; color:#25bbAA;">'''Result of gel:''' <br></p>
 
-
The vector was digested with XbaI and PstI. Expected sizes have been:
 
-
*pSB1C3 = 2072bp
 
-
*CFP: 732bp
 
-
It can be seen that the vector pSB1C3_RFC25_CFP was digested and two visible bands can be seen on the gel. The lower band corresponds to the CFP fragment (~700 - 800 bp), the higher band corresponds to the plasmid backbone at around 2000-3000 bp. The higher band was cut out and extracted by gel extraction.
 
-
<br>
 
-
<br>
 
-
[[File:Freiburg10 pSB1C3 CFP digestion 28 07 2010009.jpg|400px]]
 
-
*Perform gel extraction and measure DNA with NanoDrop
 
-
**c(psb1C3) = 29,52 ng/µL
 
-
<br>
 
-
<p style="font-size:15px; color:#25bbAA;">'''LIGATION of pSB1C3 with hGH and beta-globin''' <br></p>
 
-
Calculated ratio of pSB1C3 (vector) and hgh(insert) or betaglobin (insert)
 
-
<br>
 
-
[[File:Freiburg10 Ligation ration of pSB1C3 hGH and betaglobin 28 07 2010.jpg]]
 
-
<br>
 
-
<br>
 
-
The ligated samples
 
-
*pSB1C3_hGH
 
-
*pSB1C3_betaglobin
 
-
were transformed with XL1B and incubated on agar-plates containing chloramphenicol over night at 37°C.
 
-
====<p style="font-size:15px; background-color:#hotpink;">'''Results of ITR Trafo'''</p>====
 
-
'''Investigator: Hanna''' <br>
 
-
Because (as mentioned above) there was a bacteria lawn on the right-ITR plate and many colonies on the left-ITR plate three different approaches were performed: <br>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Splitting of HT1080 and AAV-293 cells, Seeding of HT1080 cells </u></p>
 +
Investigator: Hanna <br>
-
'''1. Trafo''' of rightITR-RFC25_pGA14 and leftITR-Präfix_pGA14 was conducted one more time:<br>
+
'''HT1080:'''
-
 
+
* Cells showed 80 % confluence
-
Abberances: <br>
+
* Cells were washed with PBS, detached with Trypsine
-
* 3µL DNA-sample was added to 50 µL cells (BL21).
+
* 10 mL DMEM was added, cell suspension was centrifuged for '''5 minutes''' at 200 g.
-
* Cells were incubated on ice for just 10 minutes.
+
* Supernatant was discarded, pellet was resuspended with 8 mL DMEM.
-
* Heat shock: 42 seconds at 42°C.
+
* '''Cells were counted: 47.5  µL Trypan blue (stains dead cells) and 2.5 µL cell suspension were mixed and applied onto a Neubauer counting chamber''' -> 2.2 x 20 x 10^-4 cells per mL
-
* Incubation for just 35 minutes at 37°C, rotating (800 rpm).
+
* Therefore 27 µL of the cellsuspension was added to each 3 mL DMEM in the 6-well plates. '''-> 2 6-well plates were prepared for transduction!'''
-
* Agar plates were prepared with Lab-Ampicillin.
+
* Further on cells were splitted: 110 µL cell suspension was pipetted into 2 75T flasks each containing 20 mL DMEM and stored in the 37°C incubator.
-
Incubation at 37°C -> Picking clones in the evening. <br>
+
-
<br>
+
-
'''2. Control:''' Bacteria were taken from the right-ITR-lawn an resuspended in 100 µL DYT. They were plated on "LabAmp-plates" and stored at 37°C. <br>
+
-
-> If something is wrong with our Ampicillin the non-transformed bacteria have progeny-advantages and will crowd out the transformed cells. This means: If there will be no colonies detectable on the new plates, something is wrong with our Ampicillin! <br>
+
-
Analysis: Tonight.<br>
+
-
<br>
+
-
''' 3. Picking clones of the left ITR plate:''' Two large and two small clones were picked from the left ITR plate and each was resuspened in 50 µL DYT. An "LabAmp-plate" was quartered and the four resuspened colonies were individualized each on one quarte of the plate. <br>
+
-
Analysis: Tonight.<br>
+
<br>
<br>
-
 
+
'''AAV-293 cells:'''
-
====<p style="font-size:15px; background-color:#66bbff;">'''Trafo evaluation Rep 68&78 Pst'''</p>====
+
* Cells showed ~ 50% confluence
-
Investigator: Kira
+
* Cells were splitted following the standard protocol.
-
 
+
-
Both plates Rep 68 & Rep 78 contain lots of colonies. Approx. 4 colonies from each plate will be picked and inoculated for Mini prep tomorrow.
+
<br>
<br>
-
====<p style="font-size:15px; background-color:#66bbff;">'''Cellculture'''</p>====
 
-
HEK were split according to the standard protocol in 5 flasks<br>
 
-
Investigator: Jessica
 
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Creating Virus Stock Economics</u></p>
 +
Investigators: Adrian
-
====<p style="font-size:17px; background-color:#66bbff;">'''Mini-Prep and Test digestion of pAAV_RFC25_mgmk and pTV_CMV_7 and pTV_CMV_8 '''</p>====
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Medium check </u></p>
-
'''Investigator: Stefan''' <br>
+
Investigator: Adrian
-
<p style="font-size:13px; color:#68bbff;">'''''Comments:'''''<br>
+
*three little culture bottles got prepared (H-DMEM, DMEM and PBS) and set into the incubator. In the following days they'll get checked for bacerial growth.<br>
-
mgmk was brought into iGEM standard vector. To verify the construct it will be sent for sequencing.<br>
+
-
pTV_CMV_7 and pTV_CMV_8 are clones we recieved from the iGEM 2008 team. Because there are mistakes in the prefix and suffix a PCR will have to be done. They will be sent for sequencing as well. </p><br>
+
-
Mini-Prep of pAAV_RFC25_mgmk clone 1 and 2:
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing results of pAAV_RFC25 </u></p>
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
investigators: Adrian, Bea, Hanna<br>
-
*pAAV_RFC25_mgmk clone 1: c = 326,0 ng/µl
+
-
*pAAV_RFC25_mgmk clone 2: c = 411,3 ng/µl
+
-
 
+
-
Mini-Prep of pTV_CMV_7 clone 1 and 2:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pTV_CMV_7 clone 1: c = 378,2 ng/µl
+
-
*pTV_CMV_7 clone 2: c = 412,9 ng/µl
+
-
 
+
-
Mini-Prep of pTV_CMV_8 clone 1 and 2:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pTV_CMV_8 clone 1: c = 337,6 ng/µl
+
-
*pTV_CMV_8 clone 2: c = 366,6 ng/µl
+
 +
[[File:Freiburg10 SeqAnalysis pAAV RFC25 25 06 2010.jpg|900px|thumb|left|SpeI restriction site deletion in sequenced data (on bottom).]]
 +
<br>
 +
<p style="clear:both;">'''sequenced sample''': pAAV_RFC25 clone 2 (P43)</p>
 +
'''used primer''': GATC_std_pTeSp-1.ab1 <br>
 +
The alignment with the theoretical construct showed, that there's a exchange of one base in the RFC25-multiple cloning site. This substitution leads to the deletion of the SpeI restriction site. <br>
 +
Therefore we checked the order sheet (everything OK!).<br>
 +
We sent the second clone (P42) for sequencing (Hanna).
 +
* V(Plasmid) = 6.5 µL
 +
* V(H<sub>2</sub>O) = 23.5 µL
 +
* Primer: pTESP-1
<br>
<br>
-
'''Test digestion:'''<br>
 
-
pAAV_RFC25_mgmk was digested with XbaI and AgeI.
 
-
pTV_CMV_7 and pTV_CMV_8 were digested with XbaI and PstI.
 
-
*P99 = pAAV_RFC25_mgmk clone 1
 
-
*P100 = pAAV_RFC25_mgmk clone 2
 
-
*P101 = pTV_CMV_7 clone 1
 
-
*P102 = pTV_CMV_7 clone 2
 
-
*P103 = pTV_CMV_8 clone 1
 
-
*P104 = pTV_CMV_8 clone 2
 
<br>
<br>
-
{| border="1"
 
-
| components  || align="right" |volume of '''P99'''/µl ||volume of '''P100'''/µL||volume of '''P101/'''µL ||volume of '''P102'''/µl ||volume of '''P103'''/µL||volume of '''P104/'''µL
 
-
|-
 
-
| DNA  ||2,5 ||2 ||2,5 ||2 ||2,5 ||2,5
 
-
|-
 
-
| BSA (10x) ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5
 
-
|-
 
-
| Buffer 4 (10x)||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5
 
-
|-
 
-
|XbaI ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5
 
-
|-
 
-
|AgeI ||0,5 ||0,5 ||/ ||0/ ||/ ||/
 
-
|-
 
-
|PstI ||/ ||/ ||0,5 ||0,5 ||0,5 ||0,5
 
-
|-
 
-
|H2O||8,5 ||9 ||9 ||8,5 ||8,5 ||8,5
 
-
|-
 
-
|'''Total volume /µl'''||15 ||15 ||15 ||15 ||15 ||15
 
-
|}
 
-
<br />
 
-
'''Expected sizes:'''
 
-
*mgmk:  603bp
 
-
*pAAV_RFC25: 4636bp<br>
 
 +
====Annotation and studies of the AAV structure====
 +
Investigator: Volker
-
*CMV: 679bp
+
The NGR- and the HPSG motif were annotated in the gene sequences according to [[Media: Freiburg10_Michelfelder Trepel 2009 AAV and Their Redirection to Cell-Type Specific Receptors.pdf|[Michelfelder & Trepe; 2009]]]
-
*pTV: 3408bp
+
The pdb sequence were visualized with the programm [http://www.pymol.org| PyMOL] and the important motifs were highlighted.
 +
<gallery widths=500px heights=300px perrow=2 caption="Impressions from PyMOL">
 +
File:Freiburg10_The viral structure of AAV-2.png|thumb|left| The viral structure of AAV-2
 +
File:Freiburg10_Sturcture of a single AAV-2 VP2 monomer.png|900px|thumb|left| Sturcture of a single AAV-2 VP2 monomer
 +
File:Freiburg10_B-Factor indicating mobility in the crystal.png|900px|thumb|left| B-Factor indicating mobility in the crystal
 +
File:Freiburg10_HPSG-binding-motif.png|900px|thumb|left| HPSG-binding-motif
 +
File:Freiburg10_Residues of the HPSG-binding-motif zoom.png|900px|thumb|left| Residues of the HPSG-binding-motif
 +
File:Freiburg10_NGR-motif.png|900px|thumb|left| The NGR-motif that is responsible for the integrin a5β1 binding
 +
</gallery>
<br>
<br>
-
<p style="font-size:13px; color:#11bb88;">'''Results of samples loaded 1% agarose gel and ran ~50 minutes at 115 V:''' </p>
 
-
[[File:Freiburg10 pAAV RFC25 mgmk and pTV CMV 7 and pTV CMV 8 small.jpg|400px|thumb|left|]]
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
 
-
<p style="font-size:13px; color:#11bb56;">'''Sequencing''' </p>
 
-
70ng/µL were sent to GATC from each clone. They were labeled:
 
-
*SB 1 (pAAV_RFC25_mgmk clone 2 (P100))
 
-
*SB 2 (pTV_CMV_7 clone 1 (P101))
 
-
*SB 3 (pTV_CMV_8 clone 1 (P103))<br>
 
-
For SB 1 there was sent the GOI_forward primer (O30) as well.
 
-
 
<br>
<br>
-
====<p style="font-size:15px; background-color:#66bbff;">'''Site-directed mutagenesis of SspI and PvuII in pSB1C3_CFP '''</p>====
+
===42.Labortag 26.06.2010===
-
'''Investigator: Jessica'''<br>
+
-
<p style="font-size:13px; color:#66bbff;">'''Comments:''' Site-directed mutagenesis was perfomed with pSB1C3_CFP in order to delete SspI and PvuII in the plasmid. These restriciton sites need to be removed because they are also in the loop we want to modify.  </p>
+
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Transduction of HT1080 cells</u></p>
 +
Investigator: Adrian
-
<p style="font-size:13px; color:#25bbAA;"> '''PCR reaction with PCR program with SspI and PvuII''': <br></p>
+
* Transduction of 2x6 wells was successfully done (14.25)
-
DNA template used: ppSB1C3_CFP = P51<br>
+
* one six well is transduced with 10µg the other with 30µg DNA amount (see HEK293 infection protokoll for further information)<br>
 +
(A is up)
{| border="1"
{| border="1"
-
| '''components'''  || align="right" |'''volume in µl''' || align="right" |'''volume in µl'''|
+
| stock solution  || align="right" |1:10 Dilution || align="right" |1:50 Dilution
|-
|-
-
| 10x PfuUltra II buffer ||  align="right" | 2.5 µl||  align="right" | 2.5 µl
+
| 1:100 Dilution ||  align="right" | 1:500 Dilution||  align="right" | control (500µl DMEM)
|-
|-
-
| 10 mM dNTP mix ||  align="right" | 0.5 µl||  align="right" | 0.5 µl
 
-
|-
 
-
|  primer_for (1:10 dilution)||  align="right" | '''O107= SDM SspI: 0,55 µl'''||  align="right" |''' O109= SDM PvuII: 0,58 µl'''
 
-
|-
 
-
|  primer_rev (1:10 dilution)||  align="right" | '''O106= SDM SspI: 0,55 µl'''||  align="right" | '''O108= SDM PvuII: 0,59 µl'''
 
-
|-
 
-
|'''P51''' (DNA template) )||  align="right" |  0,43 µl||  align="right" |  0,43 µl
 
-
|-
 
-
|DMSO||  align="right" |  -||  align="right" |  0,5µl
 
-
|-
 
-
|PfuUltra II Fusion||  align="right" |  0.5 µl||  align="right" |  0.5 µl
 
-
|-
 
-
|H2O||  align="right" | 16,1 µl||  align="right" | 15,53 µl
 
-
|-
 
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 25 µl||  align="right" | 25 µl
 
|}
|}
-
<br />
 
-
 
-
<p style="font-size:13px; color:#25bbAA;">'''Used PCR programs for  SDMs''': </p>
 
-
'''1) PvuII'''<br>
 
-
{| border="1"
 
-
| '''Rounds'''  || align="right" |'''Temperature''' || align="right" |'''Time'''
 
-
|-
 
-
|1 || align="right" |95°C || align="right" |2'
 
-
|-
 
-
|20 || align="right" |95°C || align="right" |30''
 
-
|-
 
-
|  || align="right" |78°C || align="right" |1'
 
-
|-
 
-
|  || align="right" |68°C || align="right" |2 min 50 sec
 
-
|-
 
-
|  Hold || align="right" |4°C || align="right" |
 
-
|-
 
-
|}
 
-
<br />
 
-
'''2) SspI'''<br>
 
-
{| border="1"
 
-
| '''Rounds'''  || align="right" |'''Temperature''' || align="right" |'''Time'''
 
-
|-
 
-
|1 || align="right" |95°C || align="right" |2'
 
-
|-
 
-
|20 || align="right" |95°C || align="right" |30''
 
-
|-
 
-
|  || align="right" |79°C || align="right" |1'
 
-
|-
 
-
|  || align="right" |68°C || align="right" |2 min 40 sec
 
-
|-
 
-
|  Hold || align="right" |4°C || align="right" |
 
-
|-
 
-
|}
 
-
<br />
 
-
* Transformation was prepared according to the standard protocol
 
-
 
-
====<p style="font-size:15px; background-color:#hotpink;">'''Affibody'''</p>====
 
-
'''Investigator: Hanna''' <br>
 
-
In order to target the EGF-receptor (EGFR/ErbB-1/Her1) an affibody molecule can be fused to the N-terminus of e.g. VP2, which is expressed in trans. The ZEGFR:1907 was chosen for this approach. Because just the amino acid sequence is published by Friedman et al., 2008, the sequence was translated with Mr. Gene's help :) and optimized for mammalian expression. <br>
 
-
<br>
 
-
'''Strategy:'''
 
-
<br>
 
-
[[File:Freiburg10AffiStrategy.jpg]]
 
-
<br>
 
<br>
<br>
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones from Trafo pSB1C3_RFC25_longlinker, pSB1C3_RFC25_GSAT, pSB1C3_RFC25_SEG '''</p>====
+
*the delution steps (1:10, 1:50, 1:100, 1:500) are placed upon the virus stocks in the -80°C freezer in 15 ml falcons.
-
'''Investigator: Jessica'''
+
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:'''  Trafo plates looked good. Enough clones grown. Two clones of each plate were picked</p>
+
-
*10 mL containing 10µL  chloramphenicol were inoculated with each clone respectively.
+
-
*Put into 37°C room on shaker.
+
<br>
<br>
-
====<p style="font-size:15px; background-color:#66bbff;">'''Preparation for competent XL1b '''</p>====
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Did primers for sequencing GOI arrive?</u></p>
-
'''Investigator: Jessica'''
+
-
15 ml DYT was prepared with tetracyclin and XL1b from glycerolstock and incubates over night. goes on on thursday.
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''ReTrafo of pGL3_hTERT'''</p>====
+
====Paper reading session====
-
'''Investigator: Bea'''<br>
+
Investigators: Igor, Anna, Patrick, Stefan and Volker
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:''' pGL3_hTERT received from Kira. Contains ampiciliin restitance. Retrafo was performed in order to obtain enough DNA to conduct PCR for add-on tails.</p>
+
-
<p style="font-size:14px;"> Re-transformation: </p>
+
-
*Construct used: pGL3_hTert
+
-
*concentration c = 276ng/µL
+
-
*Plasmid need to be diluted in order to obatain the final 100pg. <br>
+
-
*Dilution: 1:1000
+
-
*Volume needed of 1:1000 dilution of pGL3_hTert:
+
-
**v = 0,37µL
+
-
*100 µL aliquot of '''XL1-B''' were thawed on ice and the plasmid DNA was added.
+
-
<br>
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Trafo of PAAV_RC_1.1 SDM of BamHI and SalI'''</p>====
+
Several papers were read and infomation on cap-modifications were extracted.
-
'''Investigator: Bea'''<br>
+
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:''' Trafo did not work (see above) therefore th etRafo have been performed again<br>
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones from the 2. Trafo of left and right ITR (Hanna)'''</p>====
+
*Trasitions of seven Tyrosines (252, 272, 444, 500, 700, 704 and 730) to Phenylalanines as described in [[Media:Freibur10_Next_generation_of_adeno-associated_virus_2_vectors-_point_mutations_in_tyrosines_lead_to_high-efficiency_transduction_at_lower_doses.pdf|[Zhong et al. 2008]]]
-
'''Investigator: Jessica'''
+
*Transitions of two amino acids (R459D and N551D) leading to reduced sero prevalence as described in [[Media:Designer_Gene_Delivery_Vectors-_Molecular_Engineering_and_Evolution_of_Adeno-Associated_Viral_Vectors_for_Enhanced_Gene_Transfer.pdf|[Inchan Kwonand, David V. Schaffer]‎]]
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:'''  Trafo plates looked good. Enough clones grown. Four clones of each plate were picked</p>
+
[[File:Freiburg_Results from the journal club at the 26th june.png|900px|thumb|left|Proposed transitions Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F in red & R459D and N551D in green]]
-
*10 mL containing 10µL  Amp were inoculated with each clone respectively.
+
-
*Put into 37°C room on shaker.
+
<br>
<br>
-
<p style="font-size:13px; color:#25bbAA;">'''Comment @Hanna:''' also on control plate are clones grown... not on the quartered plate. back in the 37°C room</p>
 
-
 
-
=== 73. Labortag 29.7.2010 ===
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Mini-Prep and Test digestion of Rep 68 and Rep 78 '''</p>====
 
-
'''Investigator: Kira''' <br>
 
-
 
-
3 clones from each plate were picked and inoculated. The mini prep DNA extraction revealed followed DNA concentrations:
 
-
 
-
Rep 68
 
-
clone 1: 470 ng/μl
 
-
clone 2: 556,15 ng/μl
 
-
clone 3: 686,40 ng/μl
 
-
 
-
Rep 78
 
-
clone 1: 566,78 ng/μl
 
-
clone 2: 519,68 ng/μl
 
-
clone 3: 521,88 ng/μl
 
-
 
-
All 6 samples were test digested with PstI to check if the site directed mutagenesis was successful.
 
-
 
-
{| border="1"
 
-
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix'''
 
-
|-
 
-
| align="left" | DNA ||align="left"| Variable (800 ng) ||align="left"| -
 
-
|-
 
-
| align="left" | BSA (10x) ||align="left"| 1 ||align="left"| 6
 
-
|-
 
-
| align="left" | Buffer no. 4  (10x) ||align="left"| 1 ||align="left"|6
 
-
|-
 
-
| align="left" | Enzyme 1 ( PstI    ) ||align="left"| 0,5 ||align="left"| 3
 
-
|-
 
-
| align="left" | H2O ||align="left"| variable ||align="left"| -
 
-
|-
 
-
| align="left" | '''Total volume''' ||align="left"| '''10''' ||align="left"| -
 
-
|}
 
-
<br />
 
-
 
-
*Incubation: 1h @ 37 C
 
-
 
-
1% agarose gel
 
-
 
-
*Marker: GeneRuler ladder mix
 
-
{| border="1"
 
-
|
 
-
!Marker /µl
 
-
!Sample Rep 68 clone 1 /µl
 
-
!Sample Rep 68 clone 2 /µl
 
-
!Sample Rep 68 clone 3 /µl
 
-
!Sample Rep 78 clone 1 /µl
 
-
!Sample Rep 78 clone 2 /µl
 
-
!Sample Rep 78 clone 3 /µl
 
-
|-
 
-
!Lane
 
-
|7
 
-
|12
 
-
|12
 
-
|12
 
-
|12
 
-
|12
 
-
|12
 
-
|-
 
-
|}
 
-
<br />
 
-
[[File:Freiburg10 Rep test digestion PstI(310).png|400px]]<br />
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Results sequencing of pTV_CM clone 7 and 8 (received from iGEM team 2008)'''</p>====
 
-
'''Investigator: Bea''' <br>
 
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:'''  Sequencing results obtained from the Mini-Prep performed yesterday from the constructs pTV_CMV_7 and pTV_CMV_8 received of the iGEM Freiburg team 2008. A Retrafo has been performed and obtained plasmids of this retrafo have been send for sequencing. </p>
 
<br>
<br>
-
'''Results:''' Seqeuncing reads look good. Plasmids contain expected CMV promoter which is already in the iGEM RFC10 standard but with one missing "G" in the prefix.
 
<br>
<br>
<br>
<br>
-
<p style="font-size:16px;">Results prefix RFC10:</p>
 
-
[[File:Freiburg10 Sequencing results of pTV CMV prefix 29 07 2010.jpg|400px]]
 
<br>
<br>
-
<p style="font-size:16px;">Results pTV_CMV_7:</p>
 
-
[[File:Freiburg10 Sequencing results of pTV VMC 7 29 07 2010.jpg|600px]]
 
<br>
<br>
<br>
<br>
<br>
<br>
-
<p style="font-size:16px;">Results pTV_CMV_8:</p>
 
-
[[File:Freiburg10 Sequencing results of pTV VMC 8 29 07 2010.jpg|620px]]
 
-
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Sequencing results of pAAV_RFC25_mGMK'''</p>====
 
-
'''Investigator: Bea''' <br>
 
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:'''  Sequencing results of pAAV_RFC25_mGMK. A PCR has been perfomed in order to obtain the desired mGMK construct in the RFC25 standard. After Mini-Prep has been perfomed clone 1 has been sent to GATC for sequencing.</p>
 
<br>
<br>
<br>
<br>
-
[[File:Freiburg10 Sequencing results of pAAV RFC25 mGMK 29 07 2010.jpg|600px]]
 
<br>
<br>
<br>
<br>
<br>
<br>
-
'''Conclusion:''' The PCR amplification with designed primers to insert prefix and suffix in RFC25 standard can be verified. No nucleotide transitions can be detected. The prefix and suffix are in the designed standards. Additionally it can be confirmed that the mGMK was inserted successfully into the pAAV_RFC25 plasmid and do NOT contain any iGEM restriction sites When receiving the ordered tk30 from Mr.Gene it can be fused to the mGMK and will the be ready for using and sending to the IGEM registry (maybe this needed to be cloned into pSB1C3).
 
-
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Stock solution of Ampicilin'''</p>====
 
-
'''Investigators: Johannes, Stefan'''<br>
 
-
 
-
0,3g Ampicilin were dissolved in 3ml Millipore H20. PCR tubes were filled with 60 µl each and stored at -20 °C.
 
<br>
<br>
<br>
<br>
-
====<p style="font-size:15px; background-color:#fuchsia;">'''Mini-Prep and Test digestion of ITR constructs'''</p>====
 
-
'''Investigator: Hanna''' <br>
 
<br>
<br>
-
The RFC10-Prefix was fused to the '''left ITR''' and cloned into the pGA14_Cerulean plasmid. 4 clones of the second trafo (the first trafo didn't work due to wrong preparation of the Ampicillin stock solution, see 28.7.2010) were picked yesterday. Mini-Prep was performed today. <br>
 
-
Plasmid-no.: (pGA14_10Prefix_lITR) <br>
 
-
P111: 321.91 ng/µL <br>
 
-
P112: 489.96 ng/µL<br>
 
-
P113: 341.49 ng/µL<br>
 
-
P114: 402.3 ng/µL<br>
 
-
Glycerol stock were prepared: B85.1 - B85.1.
 
<br>
<br>
-
 
-
The "Intermediate-Step-Suffix" was fused to the '''RFC10-Prefix-rITR''' construct and cloned into pGA14. 4 clones of the second trafo were picked yesterday. Mini-Prep was performed today. <br>
 
-
Plasmid-no.: (pGA14_10Prefix_PreSuffix_rITR)<br>
 
-
P115: 401.07 ng/µL<br>
 
-
P116: 291.7 ng/µL<br>
 
-
P117: 312.98 ng/µL<br>
 
-
P118: 326.78 ng/µL<br>
 
-
Glycerol stock were prepared: B84.1 - B84.1.
 
<br>
<br>
<br>
<br>
-
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
 
-
*buffer used: 4 ; Restriction-enzymes used: Enzyme NotI-HF
 
-
*Plasmid: P111 - P118
 
-
 
<br>
<br>
-
Pipetting scheme for for each digestion:
 
-
<br />
 
-
<br />
 
-
{| border="1"
 
-
| align="left" | '''Components''' ||align="left"| '''Volume/µL'''
 
-
|-
 
-
| align="left" | DNA ||align="left"| 4 µL
 
-
|-
 
-
| align="left" | BSA (100x) ||align="left"| 0.1
 
-
|-
 
-
| align="left" | Buffer no.4 (10x) ||align="left"| 1
 
-
|-
 
-
| align="left" | Enzyme NotI-HF ||align="left"| 1
 
-
|-
 
-
| align="left" | H2O ||align="left"| 3.9
 
-
|-
 
-
| align="left" | '''Total volume''' ||align="left"| '''10'''
 
-
|}
 
-
<br />
 
<br>
<br>
-
*Incubation: 55 minutes
 
-
<br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
 
-
<br />
 
-
0.8 g Agarose, 55 mL TAE (1.45 %), 3 µL GELRED, at 115 Volt, running time: 35 minutes
 
-
<br />
 
-
<br />
 
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
 
-
!Sample
 
-
!Sample/µl]
 
-
!Loading dye (5x)/µl
 
-
!Expected size 1 (Geneious)
 
-
!Expected size 2 (Geneious)
 
-
|--
 
-
|pGA14_Prefix_lITR clone 1
 
-
|10 µl
 
-
|2 µl
 
-
|~ 150 bp
 
-
|~ 2900 bp
 
-
|--
 
-
|pGA14_Prefix_lITR clone 2
 
-
|10 µl
 
-
|2 µl
 
-
|~ 150 bp
 
-
|~ 2900 bp
 
-
|--
 
-
|pGA14_Prefix_lITR clone 3
 
-
|10 µl
 
-
|2 µl
 
-
|~ 150 bp
 
-
|~ 2900 bp
 
-
|--
 
-
|pGA14_Prefix_lITR clone 4
 
-
|10 µl
 
-
|2 µl
 
-
|~ 150 bp
 
-
|~ 2900 bp
 
-
|--
 
-
|pGA14_Prefix_PreSuffix_rITR clone 1
 
-
|10 µl
 
-
|2 µl
 
-
|145 bp
 
-
|~ 2900 bp
 
-
|--
 
-
|pGA14_Prefix_PreSuffix_rITR clone 2
 
-
|10 µl
 
-
|2 µl
 
-
|145 bp
 
-
|~ 2900 bp
 
-
|--
 
-
|pGA14_Prefix_PreSuffix_rITR clone 3
 
-
|10 µl
 
-
|2 µl
 
-
|145 bp
 
-
|~ 2900 bp
 
-
|--
 
-
|pGA14_Prefix_PreSuffix_rITR clone 4
 
-
|10 µl
 
-
|2 µl
 
-
|145 bp
 
-
|~ 2900 bp
 
-
|--
 
-
|}
 
-
{| align=right
 
-
|}
 
-
<br />
 
-
*Marker: GeneRuler ladder mix
 
-
{| border="1"
 
-
|
 
-
!Marker /µl
 
-
!Sample pGA14_Prefix_lITR clone 1 /µl
 
-
!Sample pGA14_Prefix_lITR clone 2 /µl
 
-
!Sample pGA14_Prefix_lITR clone 3 /µl
 
-
!Sample pGA14_Prefix_lITR clone 4 /µl
 
-
!Sample pGA14_Prefix_PreSuffix_rITR clone 1 /µl
 
-
!Sample pGA14_Prefix_PreSuffix_rITR clone 2 /µl
 
-
!Sample pGA14_Prefix_PreSuffix_rITR clone 3 /µl
 
-
!Sample pGA14_Prefix_PreSuffix_rITR clone 4 /µl
 
-
|-
 
-
!Lane
 
-
|6
 
-
|12
 
-
|12
 
-
|12
 
-
|12
 
-
|12
 
-
|12
 
-
|12
 
-
|12
 
-
|-
 
-
|}
 
-
<br />
 
-
'''Comments:'''Because samples can be sent to GATC just until 7 p.m., gel run was checked already after 15 minutes:
 
<br>
<br>
-
 
-
[[File:Test digestion ITRs 290710002.jpg|700px]]<br>
 
<br>
<br>
-
No bands can be detected at the expected sizes. The fragment size seems to be inbetween the expectation of either 150 and 750 bp. Further on there is also an additional band visible. Because of that it's not possible to say, whether cloning worked. Therefore the three clones marked in the picture were sent to GATC for sequencing: <br>
 
-
* pGA14_Prefix_lITR clone 1: 6.5 µL plasmid + 23.5 µL H2O = "Hanna 1"
 
-
* pGA14_Prefix_lITR clone 4: 5.2 µL  plasmid + 24.8 µL H2O = "Hanna 2"
 
-
* pGA14_Prefix_PreSuffix_rITR clone 1: 5.2 µL  plasmid + 24.8 µL H2O = "Hanna 3"
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones of pGL3_hTERT'''</p>====
 
-
'''Investigator: Bea''' <br>
 
-
<p style="font-size:13px; color:#25bbAA;">'''Comments:''' Clones will be picked from trafo plate in order to obatin single colonies in order to perform Mini-prep tomorrow.</p>
 
-
*Bacterial strain used: XL1-B
 
-
*Two clones were picked of trafo plate
 
-
*Inoculating of 10 mL DYT medium containing 10µL ampicillin
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones of pAAV_RC_1.1 SDM of BamHI and SalI'''</p>====
 
-
'''Investigator: Bea''' <br>
 
-
<p style="font-size:13px; color:#25bbAA;">'''Comments:''' All trafo plates looked good, enough clones grew, aside from trafo plate '''XL1-B {pAAV_RC_1.1_SalI}''': long PCR, where no clones grew on plate. Clones will be picked from each trafo plate in order to obatin single colonies in order to perform Mini-Prep tomorrow. </p>
 
-
*Bacterial strain used: XL1-B
 
-
*Two clones were picked of each trafo plate
 
-
**'''XL1-B {pAAV_RC_1.1_BamHI}''': long PCR
 
-
**'''XL1-B {pAAV_RC_1.1_BamHI}''': short PCR
 
-
**'''XL1-B {pAAV_RC_1.1_SalI}''': short PCR
 
-
*Inoculating of 10 mL DYT medium containing 10µL ampicillin
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones of pSB1C3_hGH and pSB1C3_betaglobin'''</p>====
 
-
'''Investigator: Bea''' <br>
 
-
<p style="font-size:13px; color:#25bbAA;">'''Comments:''' Clones will be picked from trafo plate in order to obatin single colonies in order to perform Mini-Prep tomorrow.</p>
 
-
*Bacterial strain used: XL1-B
 
-
*Two clones were picked of each trafo plate
 
-
**'''XL1-B {pSB1C3_hGH}'''
 
-
**'''XL1-B {pSB1C3_betaglobin}'''
 
-
*Inoculating of 10 mL DYT medium containing 10µL chloramphenicol
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''PCR with pTV_CMV with designed oligos for amplifying CMV in RFC10 standard'''</p>====
 
-
'''Investigator: Bea''' <br>
 
-
<p style="font-size:13px; color:#25bbAA;">'''Comments:''' Retrafo of th epTV_CMv constructs has been performed and seqeuncing revealed that the plasmid contains the CMV promoter. Therefore, PCR in order to add prefix and suffix in RFC10 standard can be performed. </p>
 
-
*Plasmid used: pTV_CMV_7 clone 2 (P102)
 
-
*Plasmid has to be diluted to provide the possibilty of pipetting the volume.
 
-
**1:1000 dilution of 412ng/µL --> c(new) = 0,412ng/µL
 
-
*Primer used:
 
-
**pCMV_prefix_RFC10_for (1:10)
 
-
**pCMV_suffix_RFC10_rev (1:10)
 
-
<br />
 
-
'''PCR reaction:'''
 
-
{| border="1"
 
-
| '''components'''  || align="right" |'''volume /µl''' 
 
-
|-
 
-
| 5x Phusion HF buffer  ||  align="right" | 10
 
-
|-
 
-
| 10 mM dNTP mix ||  align="right" | 1
 
-
|-
 
-
| pCMV_prefix_for_RFC10 (1:10)||  align="right" | 2,5
 
-
|-
 
-
| pCMV_suffix_for_RFC10 (1:10)||  align="right" | 2,5
 
-
|-
 
-
| pTV_CMV_7 clone 1 (P102)||  align="right" | 1.8 ng = 4,5 µL of 1:1000 dilution of P102, c=412 ng/µL
 
-
|-
 
-
|DMSO||  align="right" | -
 
-
|-
 
-
|Phusion polymerase||  align="right" | 0,5
 
-
|-
 
-
|H2O||  align="right" | 29 
 
-
|-
 
-
|'''Total volume (e.g. 50 µl)'''||  align="right" | 50
 
-
|}
 
-
<br /><br />
 
-
 
-
'''Used PCR programs''': <br/ >
 
-
<p style="font-size:13px; color:#25bbAA;">'''Comment:''' PCR will be performed over night. </p>
 
-
{| border="1"
 
-
| '''Rounds'''  || align="right" |'''Temperature''' || align="right" |'''Time'''
 
-
|-
 
-
|1 || align="right" |98°C || align="right" |1'
 
-
|-
 
-
|30 || align="right" |98°C || align="right" |15''
 
-
|-
 
-
|  || align="right" |70°C || align="right" |25''
 
-
|-
 
-
|  || align="right" |72°C || align="right" |12''
 
-
|-
 
-
|  Hold || align="right" |4°C || align="right" |
 
-
|-
 
-
|}
 
-
<br />
 
-
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Mini-Prep and Test digestion of pSB1C3_RFC25_longlinker, pSB1C3_RFC25_SEG and pSB1C3_RFC25_GSAT  '''</p>====
 
-
'''Investigator: Jessica''' <br>
 
-
'''Nanodrop'''
 
-
* pSB1C3_RFC25_longlinker clone1: 187,8 ng/µl '''P105'''
 
-
* pSB1C3_RFC25_longlinker clone2: 197,4 ng/µl '''P106'''
 
-
* pSB1C3_RFC25_SEG clone1: 185,6 ng/µl '''P107'''
 
-
* pSB1C3_RFC25_SEG clone2: 182,6 ng/µl '''P108'''
 
-
* pSB1C3_RFC25_GSAT clone1: 179,5 ng/µl '''P109'''
 
-
* pSB1C3_RFC25_GSAT clone2: 202,5 ng/µl '''P110'''<br>
 
<br>
<br>
-
'''Test digestion''' 1µg DNA
 
-
{| border="1"
 
-
| components  || align="right" |P105 /µl || align="right" |P107 /µl || align="right" |P109 /µl
 
-
|-
 
-
| DNA  ||  align="right" | 5,3||  align="right" |5,3|| align="right" |5,6
 
-
|-
 
-
| BSA (10x) ||  align="right" |1 ||  align="right" | 1||  align="right" | 1
 
-
|-
 
-
| Buffer 4 (10x)||  align="right" | 1||  align="right" | 1||  align="right" | 1
 
-
|-
 
-
 
-
 
-
|H2O||  align="right" | 2,2||  align="right" | 2,2||  align="right" |1,9
 
-
|-
 
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | '''10'''||  align="right" | '''10'''||  align="right" | '''10'''
 
-
|}
 
<br>
<br>
-
agarose gel: 2%, digestion: 45 minutes, 37°C
 
<br>
<br>
-
[[File:Freiburg10 test digestion of linkers.jpg|400px|thumb|left|]]
 
<br>
<br>
<br>
<br>
Line 5,568: Line 1,713:
<br>
<br>
<br>
<br>
 +
 +
===43.Labortag 28.06.2010: Checking HT1080 for YFP-Expression, Creating plan: urgent things to do===
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Checking HT1080 for YFP-Expression </u></p>
 +
*Hannas 2*6 wells (24.6) transduced by (Adrian 25.6)
 +
Investigator: Sven, Patrick, Adrian
 +
 +
<gallery widths=500px heights=300px perrow=2 caption="Results of transduction nr.2">
 +
File: Freiburg10_2Transd10µg_unverd_2_(c1).JPG|10µg_unverd_2_(c1).JPG 48h post transduction
 +
File: Freiburg10_2Transd10µg_unverd_1_(c1).JPG|10µg_unverd_1_(c1).JPG 48h post transduction
 +
File: Freiburg10_2Transd30µg_unverd_2_(c1).JPG|30µg_unverd_2_(c1).JPG 48h post transduction
 +
File: Freiburg10_2Transd30µg_unverd_(c1).JPG  |30µg_unverd_(c1).JPG 48h post transduction
 +
File: Freiburg10_2Transd30µg_unverd_4_(c1).JPG|30µg_unverd_4_(c1).JPG 48h post transduction
 +
File: Freiburg10_2Transd30µg_unverd_3 (c1).JPG|30µg unverd 3 (c1).JPG 48h post transduction
 +
File: Freiburg10_2Transd30µg_unverd_6_(c1).JPG|30µg_unverd_6_(c1).JPG 48h post transduction
 +
File: Freiburg10_2Transd30µg_unverd_5_(c1).JPG|30µg_unverd_5_(c1).JPG 48h post transduction
 +
 +
 +
</gallery>
 +
* The transduced cells will be checked again (29.6.).
<br>
<br>
 +
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing results of P42</u></p>
 +
Hanna <br>
 +
Sequencing of pAAV_RFC25 (P42):
 +
[[File:Freiburg10 P42.jpg]]
 +
Sequencing delivered, that there weren't any base exchanges or deletions in this clone. Therefore P43 was dismissed (Plasmid and glycerol stock). <br>
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Theoretical construction of our biobricks</u></p>
 +
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Theoretical cloning</u></p>
 +
Investigators: Hanna, Adrian, Chris W, Patrick, Volker
 +
 +
Urgent Things to do:
 +
 +
*Modification CAP:
 +
**HSPG -> 2 AS
 +
**Targeting (585,588...) -> 2 AS -> 1 or 2 restriction sites?! Investigator: Volker
 +
** Seroprevalence -> 2 AS
 +
** thyrosine for ubiquitination Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F
 +
**Primer: start codons
 +
**EGF-Rezeptor: A431-Zellinie
 +
***Affibody: order the Gensequence
 +
***bispecific AK -> order Diabodys (are there any restriction sites?) Investigator: kristian???
<br>
<br>
 +
*Ordering the ITRs Investigator: Hanna
 +
**Stratagene: right and left
 +
**wild-type
<br>
<br>
 +
*Modification: REP Investigator: Volker
 +
** 3 restriction sites -> site directed mutagenisis vs. synthetic? ->order (check which is the cheaper approach)
<br>
<br>
 +
*HGH Investigator: Hanna
 +
** restriction sites? -> are there any available biobricks?
 +
**biobrick production
<br>
<br>
 +
*Beta-globin: what is the function? -> cut out?
 +
**where is the start and the end?
 +
**restriction sites?
 +
**biobrick production
<br>
<br>
 +
*GMK-TK
 +
**restriction sites: primer
 +
**biobrick production
 +
**ordering the SR39
<br>
<br>
 +
*tumor specific promotors
 +
**more Information!!!
 +
** telomerase specific promoters!!!
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Continuation of ITR PCR</u></p>
 +
Hanna, Chris W., Adrian <br>
 +
* Analytic gel was run: 1.7 µL loading dye (6x) was added to 8.3 µL of each sample (left ITR: 5 µL DMSO + 10 µL DMSO; right ITR: 5 µL DMSO + 10 µL DMSO).
 +
* 110 V, 35 minutes
 +
* No ITr bands were detectable - just 2 weak "primer-bands"
 +
Conclusion: PCR didn't work. Because of that new primers were designed and ordered (Achim), which are longer and posses therefore higher annealing temperatures.
<br>
<br>
 +
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>ITRs (theoretical)</u></p>
 +
Adrian, Achim, Hanna <br>
 +
* trs sequences (GTTGG) are present in both ITRs (Stratagene)!
 +
* assumption: transcription despite of ITR-secondary structure - no single-strand nick at trs-sequence in transduced cells ?
<br>
<br>
-
'''P105, P107 and P109 are sent for sequenzing with Reverse Primer (VR2)'''
 
-
<p style="font-size:13px; color:#68bbff;">'''''Comments:'''''this is no satisfying result. we can't imagine what this bands stand for. maybe the CFP is still in the pSB1C3 and the digestion of the pSB1C3_RFC25_CFP didn't work. P105, P107 and P109 are sent for sequenzing to look for the CFP respectively the linkers  </p><br>
 
-
====<p style="font-size:15px; background-color:#66bbff;">'''Picking clones of pSB1C3_CFP w/o SspI and PvuII'''</p>====
 
-
'''Investigator: Jessica''' <br>
 
-
*Bacterial strain used: XL1-B
 
-
*Four clones were picked of trafo plate
 
-
*Inoculating of 10 mL DYT medium containing 10µL chloramphenicol<br>
 
-
'''Hanna will do the Mini Prep tomorrow'''<br>
+
===44.Labortag 29.06.2010: Discussionround 3, Seeding HEK293 cells for transfection and titering ===
-
====<p style="font-size:15px; background-color:#66bbff;">'''Inoculation of pSB1C3_RFC25_CFP'''</p>====
+
-
'''Investigator: Jessica '''
+
-
* 200ml DYT was prepared with 200µl chloramphenicol and the glycerol stock no. B39
+
-
* stored in the 37°C room over night for Midi Prep tomorrow
+
-
=== 74. Labortag 30.7.2010 ===
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>DISCUSSIONROUND</u></p>  
-
====<p style="font-size:15px; background-color:#66bbff;"><b>Continuation of PCR with pTV_CMV and digestion of pSB1C3</b></p>====
+
-
<p><b>Investigator: Bea</b> <br></p>
+
-
<p style="font-size:13px; color:#68bbff;"><b>Comments:</b> Retrafo of the pTV_CMv constructs has been performed and sequencing revealed that the plasmid contains the CMV promoter. Therefore, PCR was be performed overnight. After PCR the PCR product was loaded on a 1% preparative agarose gel. While PCR was separated by the agarose gel, digestion of pSB1C3_CFP was performed.</p>
+
-
<p><b>Proceeding:</b> </p>
+
-
<ul>
+
-
<li>Prepare 1% agarose gel and load samples on gel. </li>
+
-
<li>Run time: 45 minutes</li>
+
-
</ul>
+
-
<p style="font-size:15px; color:#68bbff;"><b>Result of gel:</b></p>
+
-
Expected sizes of PCR products:
+
-
<ul>
+
-
<li>CMV = 681 bp</li>
+
-
</ul>
+
 +
*Affibodys
 +
**Investigator: Anna
 +
***Affibodys are 6-7kD Proteins derived from Protein A/Z
 +
***they are binding to domain 3 from IGFR
 +
***13 AS are replaceable for changing the tropism
<br>
<br>
-
[[File:Freiburg10 PCR with pTV CMV 30 07 2010.jpg|400px]]
+
*Tyrosine Mutants
 +
**Investigator: Adrian
 +
***replacements are done in VP3! => Volker?!
 +
***no multi-mutants are available (instead of single mutations many Y->F)
 +
***best candidates are: Y730F and Y444F.
<br>
<br>
 +
*Second strand DNA-synthesis in Transduced cells
 +
**Investigator: Achim
 +
*** Dual strand synthesis is the main limiting for transduction/transgen expression.
 +
<br>
<br>
-
<br>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Seeding HT-cells for transfection and titering</u></p>
-
After gel extraction was performed, the PCR prdouct CMV was digested:
+
Investigators: Sven, Adrian, Bea
-
<p style="font-size:15px; color:#68bbff;">DIGESTION of PCR products</p>
+
*The pellet was resolved in 4ml we had a 550.000 cells/ml
-
<table border="1">
+
* 2x6 well dishes got prepared:
-
<tr>
+
-
  <th><b>Components</b></th>
+
-
  <th><b>Volume/µL</b></th>
+
-
</tr>
+
-
<tr>
+
-
  <td>PCR product: CMV</td>
+
-
  <td>29</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>BSA (100x)</td>
+
-
  <td>0,4</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>Buffer 4 (10x)</td>
+
-
  <td>4</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>Enzyme XbaI</td>
+
-
  <td>1</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>Enzyme PstI</td>
+
-
  <td>1</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>H20</td>
+
-
  <td>4,6</td>
+
-
</tr>
+
-
<tr>
+
-
  <td><b>Total volume</b></td>
+
-
  <td><b>40</b></td>
+
-
</tr>
+
-
</table>
+
-
<ul>
+
-
<li>Incubate for 2h at 37°C</li>
+
-
<li>Perform PCR purification following standard protocols</li>
+
-
<li>Elute in 20µL EB-buffer, put on 50°C for 3 minutes before centrifugating</li>
+
-
<li>Measure DNA with NanoDrop:</li>
+
-
<ul>
+
-
<li>c(CMV) = 87,4ng/µL</li>
+
-
</ul>
+
-
</ul>
+
-
<br>
+
-
In the meantime prepare the <b>digestion of vector pSB1C3_CFP</b> (P51)
+
-
<p style="font-size:15px; color:#68bbff;">DIGESTION of pSB1C3_CFP</p>
+
-
<table border="1">
+
-
<tr>
+
-
  <th><b>Components</b></th>
+
-
  <th><b>Volume/µL</b></th>
+
-
</tr>
+
-
<tr>
+
-
  <td>pSB1C3_CFP</td>
+
-
  <td>6</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>BSA (10x)</td>
+
-
  <td>2</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>Buffer 4 (10x)</td>
+
-
  <td>2</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>Enzyme XbaI</td>
+
-
  <td>1</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>Enzyme PstI</td>
+
-
  <td>1</td>
+
-
</tr>
+
-
<tr>
+
-
  <td>H20</td>
+
-
  <td>8</td>
+
-
</tr>
+
-
<tr>
+
-
  <td><b>Total volume</b></td>
+
-
  <td><b>20</b></td>
+
-
</tr>
+
-
</table>
+
-
<br />
+
-
<ul>
+
-
<li>Incubate for 2h at 37°C</li>
+
-
<li>Load sample on 1% preparative agarose gel </li>
+
-
<li>Run for 45 minutes at 110 V</li>
+
-
</ul>
+
-
<br>
+
-
<p style="font-size:15px; color:#68bbff"><b>Result of gel:</b> <br></p>
+
-
<p>The vector was digested with XbaI and PstI. Expected sizes have been:</p>
+
-
<ul>
+
-
<li>pSB1C3 = 2072bp</li>
+
-
<li>CFP: 732bp</li>
+
-
</ul>
+
-
<br>
+
-
[[File:Freiburg10 Digestion of pSB1C3 CFP with XbaI and PstI 30 07 2010.jpg|400px]]
+
-
<br/ >
+
-
<br/ >
+
-
<ul>
+
-
<li>Proceed with ligation of pSB1C3 and CMV</li>
+
-
<ul>
+
-
<li>v (vector) = 7,37µL </li>
+
-
<li>v (insert)= 1,63µL </li>
+
-
</ul>
+
-
<li> Trafo has been performed with XL1B cells. </li>
+
-
<ul>
+
-
<li>100µL if XL1B cells have been transformed with 2µL of pSB1C3_CMV</li>
+
-
<li>Transformed cells have been plated on agar plates containing chloramphenicol</li>
+
-
</ul>
+
-
</ul>
+
-
<p><b>Next steps: Picking clones of trafo plate and performing Mini-Prep. When all BioBricks are ready conduct assembly strategy and test constructs.</b> </p>
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbff;">'''Repetition of test digestion of Rep 68 and Rep 78 '''</p>====
+
-
'''Investigator: Kira''' <br>
+
 +
1. Plate I(A is up)
{| border="1"
{| border="1"
-
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix'''
+
| 3x10^5 cells || align="right" |3x10^5 cells || align="right" |3x10^5 cells
|-
|-
-
| align="left" | DNA ||align="left"| Variable (800 ng) ||align="left"| -
+
| 3x10^5 cells  || align="right" | 3x10^5 cells|| align="right" | 3x10^5 cells
|-
|-
-
| align="left" | BSA (10x) ||align="left"| 1 ||align="left"| 6
 
-
|-
 
-
| align="left" | Buffer no. 4  (10x) ||align="left"| 1 ||align="left"|6
 
-
|-
 
-
| align="left" | Enzyme 1 ( PstI    ) ||align="left"| 0,5 ||align="left"| 3
 
-
|-
 
-
| align="left" | H2O ||align="left"| variable ||align="left"| -
 
-
|-
 
-
| align="left" | '''Total volume''' ||align="left"| '''10''' ||align="left"| -
 
|}
|}
-
<br />
 
-
*Incubation: 1h @ 37 C
+
<br>
-
 
+
-
1% agarose gel
+
-
 
+
-
*Marker: GeneRuler ladder mix
+
-
 
+
-
1/3 of the digested solution was diluted in 2/3 water because the agarose gel from yesterday showed very distinct bands
+
 +
2. Plate II (A is up)
{| border="1"
{| border="1"
-
|
+
| about 3x10^5 cells  || align="right" |only medium|| align="right" |only medium
-
!Marker /µl
+
-
!Sample Rep 68 wt
+
-
!Sample Rep 68 clone 1 /µl
+
-
!Sample Rep 68 clone 2 /µl
+
-
!Sample Rep 68 clone 3 /µl
+
-
!Sample Rep 78 clone 1 /µl
+
-
!Sample Rep 78 clone 2 /µl
+
-
!Sample Rep 78 clone 3 /µl
+
-
!Sample Rep 78 wt
+
|-
|-
-
!Lane
+
| about 3x10^5 cells  || align="right" |only medium|| align="right" |only medium
-
|7
+
-
|12
+
-
|12
+
-
|12
+
-
|12
+
-
|12
+
-
|12
+
-
|12
+
-
|12
+
|-
|-
|}
|}
 +
<br>
 +
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Seeding HT1080-cells for transduction and qPCR</u></p>
 +
Hanna  <br>
 +
* Cell density was determined with trypan blue and counting chamber: 2 x 20 x 10^4 cells/mL
 +
* wanted: 5 x 10^4 cells --> 125 µL cell suspension per well
 +
* Cells were seeded into a 24-well-plate (row C and D!): 1.5 mL DMEM + 125 µL cell suspension per well
 +
* cells were incubated for 1 hour at 37°C
 +
<br>
 +
Further on, cells were splitted: ~ 3 mL cell suspension was added to ~ 17 mL DMEM
 +
<br>
 +
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Transduction of HT1080 cells for qPCR</u></p>
 +
Chris W. <br>
-
TAE buffer was changed before start, the samples have been diluted to 1/3 but the bands are still very distinct. However, it is possible to analyse the gel. Rep 68 contains no PstI restriction sites anymore, while Rep 78 shows one band, which might be due to the additional PstI restiction site.
+
===45.Labortag 30.06.2010: Titering Procedure via qPCR, Transduction of 6well plates nr.4, (Seeding HEK293 for Transfection?), further Gene-Order-Investigation ===
-
[[File:Freiburg10 test digestion PstI.png|400px|]]
 
-
clone1_Rep68 and clone1_ Rep78 were sent for sequencing
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Harvesting cells for qPCR</u></p>
 +
Investigators: Chris W, Hanna <br>
 +
Transduced HT1080 cells were harvested following Sven's standard protocol.
-
====<p style="font-size:15px; background-color:#FF00FF;">'''Continuation: left ITR'''</p>====
 
-
'''Investigator: Hanna''' <br>
 
<br>
<br>
-
GATC didn't manage to do the sequencing of the left ITR-Präfix construct until now. This can be interpreted as positive news, because this increases the fact that the ITR is in the plasmid (very strong secondary structures!). Therefore cloning will  be continued today:
 
-
<br>
 
-
<br>
 
-
<p style="font-size:20px; font-weight: bold; color: fuchsia;"><u>Practical Cloning:</u></p>
 
-
<br />
+
<p style="font-size:15px; font-weight: bold; color: blue;"><u>Transduction of 2 x 6well plates nr.4</u></p>  
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pGA14_Cerulean (P61) and of pGA14_10Präfix-lITR (P111)</p>
+
Investigators: Bea, Adrian...
 +
 
 +
*Master plan: Different Transduction Mechanisms
 +
**rise the amount of transduced particels, instead of 500µl, 1000µl of the AAV-stock getting pipetted into each well.
 +
**the second plate gets stimulated via UV-light to boost the expression of DNA-Repair mechanisms. This should enhance the second strand synthesis of our ssDNA-GOI => a rise of YFP Expression!
 +
 
 +
1. Plate I(A is up)
{| border="1"
{| border="1"
-
| components  || align="right" |volume of pGA14_Cerulean (P61) /µl || align="right" |volume of pGA14_10Präfix-lITR (P111) /µl
+
| 3x10^5 cells  || align="right" |3x10^5 cells || align="right" |3x10^5 cells
|-
|-
-
| DNA ||  align="right" | 7.5 ||  align="right" | 9.3
+
| 3x10^5 cells ||  align="right" | 3x10^5 cells||  align="right" | 3x10^5 cells
|-
|-
-
| BSA (100x) ||  align="right" | 0.2 ||  align="right" | 0.2
 
-
|-
 
-
| Buffer 4 (10x)||  align="right" | 2 ||  align="right" | 2
 
-
|-
 
-
|Enzyme 1 ||  align="right" | PstI-HF: 1 ||  align="right" | NotI-HF: 1
 
-
|-
 
-
|Enzyme 2 ||  align="right" | XbaI: 1 ||  align="right" | XbaI: 1
 
-
|-
 
-
|H2O||  align="right" | 8.3 ||  align="right" | 6.5
 
-
|-
 
-
|'''Total volume'''||  align="right" | 20 ||  align="right" | 20
 
|}
|}
-
*Incubation: ~2 h
+
Transduction:
-
<br /><br />
+
<br>  
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Agarose-Gel:</p>
+
-
<br />
+
-
'''P61:''' <br>
+
-
0.5 g Agarose, '''50 mL TBE!!!''' (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes<br>
+
-
'''P111:''' <br>
+
-
0.8 g Agarose, '''50 mL TBE!!!''' (1.45 %), 3 µL GELRED, at 115 Volt, running time: 35 minutes
+
-
<br />
+
-
<br />
+
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (5x)/µl
+
-
!Expected size 1 (Geneious)
+
-
!Expected size 2 (Geneious)
+
-
|--
+
-
|P61
+
-
|20 µl
+
-
|5 µl
+
-
|2896 bp
+
-
|~ 750 bp
+
-
|--
+
-
|P111
+
-
|20 µl
+
-
|5 µl
+
-
|151 bp
+
-
|~ 2890 bp
+
-
|--
+
-
|}
+
-
{| align=right
+
-
|}
+
-
<br />
+
-
*Marker: GeneRuler ladder mix
+
-
<br />
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Gelextraction</p>
 
-
<br />
 
-
Gel measurement:
 
-
<br />
 
{| border="1"
{| border="1"
-
| align="left" | '''Sample''' ||align="left"| '''Concentration'''
+
| 1000 µl of Viral Stock  DROPPED || align="right" |1000 µl of Viral Stock gently resuspended|| align="right" |1500 µl of Viral Stock hard resuspending
|-
|-
-
| align="left" | P61 ||align="left"| 12.44 ng/µL
+
| 1000 µl of Viral Stock  DROPPED ||  align="right" | 1000 µl of Viral Stock gently resuspended|| align="right" | no Transduction
|-
|-
-
| align="left" | P111 ||align="left"| 11.21 ng/µL
 
|}
|}
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Oligo-Hybridization</p>
 
-
<br />
 
-
'''RFC10-Suffix of left ITR:'''<br>
 
-
* 10 µL Oligo 1 (O102)
 
-
* 10 µL Oligo 2 (O103)
 
-
* 4 µL 100 mM TrisHCl pH8
 
-
* 8 µL 5 mM MgCl2
 
-
* 8 µL H2O
 
-
Total: 40 mL
 
-
<br>
 
-
<br>
 
-
'''Thermocycler program: ORIGAMI1'''<br>
 
-
1. 99°C, 7' <br>
 
-
2. 99°C, 1' <br>
 
-
73 x, -1°C; R = 0.3 °/s <br>
 
-
3. Hold 4°C
 
-
<br>
 
-
<br /><br />
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Ligation</p>
 
-
<br />
 
-
* left ITR fragment: 6.2 µL
 
-
* Suffix: 1 µL
 
-
* pGA14: 11.5 µL
 
-
* Buffer: 2.2 µL
 
-
* T4 Ligase: 1 µL
 
-
'''Total:''' 21.9 µL
 
-
<br>
 
-
Sample will be incubating over night in the thermocycler at 16°C.
 
-
 
-
<br />
 
-
====<p style="font-size:15px; background-color:#FF00FF;">'''Continuation: right ITR'''</p>====
 
-
'''Investigator: Hanna''' <br>
 
-
<br>
 
-
Sequencing results delivered that the right ITR was succesfully ligated to the pGA14 plasmid. Unfortunately just about 100 bp were successfully sequenced. Within the ITR region sequencing seemed one more time not to be possible due to the very strong secondary structures which hinder the polymerase to read through. Therefore we can just validate that the ITR with the prefix is inside pGA14, but it's not possible to give a statement about the ITR quality or whether the suffix was successfully fused to the sequence. Theoretically the digested plasmid is not able to religate without ITR and Suffix sequence. But noone knows what our ''E.colis'' are able to achieve :)
 
<br>
<br>
-
[[File:Freiburg10 pGA14 rITR-Prefix PreSuffix.jpg|900px]] <br>
+
2. Plate II (A is up)
-
<br>
+
-
 
+
-
Nevertheless we decided to continue with the experiment: <br>
+
-
<br>
+
-
<br>
+
-
<p style="font-size:20px; font-weight: bold; color: fuchsia;"><u>Practical Cloning:</u></p>
+
-
 
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Digestion of pGA14_Cerulean (P61) and of pGa14_Präfix-PreSuffix-rITR (P115)</p>
+
{| border="1"
{| border="1"
-
| components  || align="right" |volume of pGA14_Cerulean (P61) /µl || align="right" |volume of pGa14_Präfix-PreSuffix-rITR (P115) /µl
+
| about 3x10^5 cells  || align="right" |only medium|| align="right" |only medium
|-
|-
-
| DNA ||  align="right" | 7.5 ||  align="right" | 7.5
+
| about 3x10^5 cells ||  align="right" |only medium||  align="right" |only medium
|-
|-
-
| BSA (100x) ||  align="right" | 0.2 ||  align="right" | 0.2
 
-
|-
 
-
| Buffer 4 (10x)||  align="right" | 2 ||  align="right" | 2
 
-
|-
 
-
|Enzyme 1 ||  align="right" | EcoRI-HF: 1 ||  align="right" | EcoRI-HF: 1
 
-
|-
 
-
|Enzyme 2 ||  align="right" | SpeI: 1 ||  align="right" | SpeI: 1
 
-
|-
 
-
|H2O||  align="right" | 8.3 ||  align="right" | 8.3
 
-
|-
 
-
|'''Total volume'''||  align="right" | 20 ||  align="right" | 20
 
|}
|}
-
*Incubation: ~2 h
+
<br>
-
<br /><br />
+
Transduction:
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Agarose-Gel:</p>
+
<br>
-
<br />
+
-
'''P61:''' <br>
+
-
0.5 g Agarose, '''50 mL TBE!!!''' (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes<br>
+
-
'''P115:''' <br>
+
-
0.8 g Agarose, '''50 mL TBE!!!''' (1.45 %), 3 µL GELRED, at 115 Volt, running time: 35 minutes
+
-
<br />
+
-
<br />
+
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (5x)/µl
+
-
!Expected size 1 (Geneious)
+
-
!Expected size 2 (Geneious)
+
-
|--
+
-
|P61
+
-
|20 µl
+
-
|5 µl
+
-
|2895 bp
+
-
|~ 750 bp
+
-
|--
+
-
|P115
+
-
|20 µl
+
-
|5 µl
+
-
|171 bp
+
-
|~ 2890 bp
+
-
|--
+
-
|}
+
-
{| align=right
+
-
|}
+
-
<br />
+
-
*Marker: GeneRuler ladder mix
+
-
 
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Gelextraction</p>
+
-
<br />
+
-
Gel measurement:
+
-
<br />
+
{| border="1"
{| border="1"
-
| align="left" | '''Sample''' ||align="left"| '''Concentration'''
+
|  1500 µl of Viral Stock gently resuspended  || align="right" |no Transduction|| align="right" |no Transduction
|-
|-
-
| align="left" | P61 ||align="left"| 16.65 ng/µL
+
| 1500 µl of Viral Stock gently resuspended  ||  align="right" |no Transduction|| align="right" |no Transduction
|-
|-
-
| align="left" | P115 ||align="left"| 7.95 ng/µL
 
|}
|}
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;">Ligation</p>
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>(Seeding HEK293 for Transfection?)</u></p>  
-
<br />
+
Investigators: ...
-
* right ITR fragment: 2.2 µL
+
-
* pGA14: 5.8 µL
+
-
* Buffer: 1 µL
+
-
* T4 Ligase: 1 µL
+
-
'''Total:''' 10 µL
+
-
<br>
+
-
Sample will be incubating over night in the thermocycler at 16°C.
+
-
<br />
 
-
<br>
 
-
====<p style="font-size:15px; background-color:#FF00FF;">'''ITR gel pictures'''</p>====
+
<p style="font-size:15px; font-weight: bold; color: blue;"><u>beta-globin intron</u></p>  
-
'''Hanna'''
+
Investigators: Adrian, Bea
<br>
<br>
-
[[File:PGA14 30072010006.jpg|300px]]
+
We found some interesting literature which point out that introns have an influence on the eucaryotic gene expression on DNA and RNA level. Next steps are going to be the designing of the beta-globin intron and maybe further analysis of the other mentioned introns. Maybe two or three more introns can be ordered.
<br>
<br>
-
 
+
[[Media:Freiburg10_LeHir_et_al_How_introns_influence_and_enhance_eukaryotic_gene_expression_2003.pdf]]
-
Digestion worked. The marked bands were cut out. <br>
+
<br>
<br>
-
[[File:ITRs 30072010007.jpg|300px]]
+
[[Media:Freiburg10_Noe_et_al_An_intron_is_required_dro_dihydrofolate_reductase_protein_stability_2008.pdf]]
<br>
<br>
-
 
+
[[Media:Freiburg10_Mashadrizeh_et_al_A_systematic_study_of_the_function_of_the_human_beta-globin_introns_on_the_expression_of_the_human_coagulation_factor_in_cultured_Chinese_hamster_ovary_cells_2009.pdf‎]]
-
Digestion of the right ITR fragment worked well. Unfortunately the left ITR fragment is too large. The ecpectation was ~ 151 bp. It seemed to consist of ~ 300 bp. --> Two ITRs in tandem??? Hopefully GATC will find a way in order to sequence the ITRs!
+
<br>
<br>
 +
* [[Media:Chicken_beta-globin_insulator_overcomes_variegation_of_transgenes_in_Xenopus_embryos.pdf‎]]
<br>
<br>
-
 
-
====<p style="font-size:15px; background-color:#FF00FF;">'''ZEGFR:1907'''</p>====
 
-
Sven, Hanna <br>
 
-
<br>
 
-
The Affibody-BioBrick (RFC25) was ordered at Geneart. The sequence does not contain any iGEM restriction sites. We'll receive the DNA in ~ 8 work days. <br>
 
-
'''Strategy:''' See Lab day 28.07.2010. <br>
 
-
'''More information:''' See [[Informationssammlung zum AAV]] and [[Theoretical cloning]] !!
 
<br>
<br>
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>hGH sequence</u></p>
 +
Hanna 
 +
* orientation in pAAV_MCS is reverse annotated... but in the same orientation as in human growth hormone I gene!
 +
* Blast and alignment with other expression vectors and the human growth hormone I revealed that Stratagene annotated 1 bp too much
 +
* "A common feature of mRNA in higher eukaryotes (but not in yeast) is the presence of the highly conserved sequence AAUAAA in the region from 11-30 nucleotides upstream of the site of poly(A) addition. (...) The signal is needed for both cleavage and polyadenylation." (Genes VIII, Lewin, P. 720)
 +
* good news: There're no iGEM restriction sites in the sequence (RFC25)
 +
* Conclusion: Instead of ordering the whole sequenc in iGEM standard it would be probably easier (and cheaper) to perform a PCR.
 +
* '''Done''': Oligos were designed for PCR!
<br>
<br>
-
====<p style="font-size:17px; background-color:#66bbff;">'''Mini-Prep and Test digestion of pSB1C3_SDM_SspI, pSB1C3_SDM_PvuII, pSB1C3_beta-globin, pSB1C3_hgH, pAAV_RC_1.1_BamHI long PCR, pAAV_RC_1.1_BamHI short PCR,pGL3_hTERT and pAAV_RC_1.1_SalI (short PCR), pAAV_RC_1.1_BamHI long PCR, pAAV_RC_1.1_BamHI short PCR, '''</p>====
+
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>ITRs: new strategy</u></p>
-
'''Investigator: Anissa, Stefan''' <br>
+
Hanna <br>
-
<p style="font-size:13px; color:#68bbff;"><b>Comments: There are some (SspI, PvuII, BamHI, SalI) restriction sites in our standard vector which are also present in the viral loops. Therefore, the sites in the vector have to be removed.
+
Plan:
-
The beta-globin and hGH constructs are BioBricks for sending to iGEM headquarters. Sequencing is needed. hTERT is  tumor-specific promotor we obtained from Kira. Sequencing is needed.</b></p><br>
+
* Digest pAAV_MCS with AlwNI. Result: one large fragment containing the left ITR + a small fragment containing right ITR.
-
 
+
* Digest both fragments with NotI and PstI.
-
Mini-Prep of pSB1C3_SDM_SspI clone 1 to 4:
+
* Hybridize oligos containing RFC10 restriction sites (designed by Hanna), ligate them via intermediate steps (ligating into a vector) with ITRs . Comment: One oligo posseses a blunt end - therefore "intermediate step-vector" needs to be digested with an enzyme producing a blunt site.
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
*''' Done:''' Oligos were designed. Need to be checked!
-
*pSB1C3_SDM_SspI clone 1 (=P125): c = 321,9 ng/µl
+
-
*pSB1C3_SDM_SspI clone 2 (=P126): c = 290,3 ng/µl
+
-
*pSB1C3_SDM_SspI clone 3 (=P127): c = 309,0 ng/µl
+
-
*pSB1C3_SDM_SspI clone 4 (=P128): c = 298,1 ng/µl<br>
+
-
 
+
-
 
+
-
Mini-Prep of pSB1C3_SDM_PvuII clone 1 to 4:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pSB1C3_SDM_PvuII clone 1 (=P129): c = 308,4 ng/µl
+
-
*pSB1C3_SDM_PvuII clone 2 (=P130): c = 316,9 ng/µl
+
-
*pSB1C3_SDM_PvuII clone 3 (=P131): c = 445,6 ng/µl
+
-
*pSB1C3_SDM_PvuII clone 4 (=P132): c = 445,4 ng/µl<br>
+
-
 
+
-
 
+
-
Mini-Prep of pSB1C3_beta-globin clone 1 and 2:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pSB1C3_beta-globin clone 1 (=P133): c = 221,9 ng/µl
+
-
*pSB1C3_beta-globin clone 2 (=P134): c = 206,3 ng/µl<br>
+
-
 
+
-
 
+
-
Mini-Prep of pSB1C3_hgH clone 1 and 2:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pSB1C3_hgH clone 1 (=P135): c = 245,5 ng/µl
+
-
*pSB1C3_hgH clone 2 (=P136): c = 226,2 ng/µl<br>
+
-
 
+
-
 
+
-
Mini-Prep of pAAV_RC_1.1_BamHI (long PCR) clone 1 and 2:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pAAV_RC_1.1_BamHI (long PCR) clone 1 (=P137): c = 537,8 ng/µl
+
-
*pAAV_RC_1.1_BamHI (long PCR) clone 2 (=P138): c = 546,9 ng/µl<br>
+
-
 
+
-
 
+
-
Mini-Prep of pAAV_RC_1.1_BamHI (short PCR) clone 1 and 2:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pAAV_RC_1.1_BamHI (short PCR) clone 1 (=P139): c = 547,0 ng/µl
+
-
*pAAV_RC_1.1_BamHI (short PCR) clone 2 (=P140): c = 494,0 ng/µl<br>
+
-
 
+
-
 
+
-
Mini-Prep of pGL3_hTERT clone 1 and 2:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pGL3_hTERT clone 1 (=P141): c = 286,1 ng/µl
+
-
*pGL3_hTERT clone 2 (=P142): c = 319,9 ng/µl<br>
+
-
 
+
-
 
+
-
Mini-Prep of pAAV_RC_1.1_SalI (short PCR) clone 1 and 2:
+
-
After performing Mini-Preps concentration was measured with Nanodrop:
+
-
*pAAV_RC_1.1_SalI (short PCR) clone 1 (=P143): c = 480,0 ng/µl
+
-
*pAAV_RC_1.1_SalI (short PCR) clone 2 (=P144): c = 510,7 ng/µl<br>
+
-
 
+
-
 
+
<br>
<br>
-
'''Test digestion:'''<br>
 
-
pSB1C3_SDM_SspI was digested with SspI.<br>
 
-
pSB1C3_SDM_PvuII was digested with PvuII.<br>
 
-
pSB1C3_beta-globin was digested with XbaI and PstI.<br>
 
-
pSB1C3_hgH was digested with XbaI and PstI.<br>
 
-
pAAV_RC_1.1_BamHI (long PCR) was digested with BamHI.<br>
 
-
pAAV_RC_1.1_BamHI (short PCR) was digested with BamHI.<br>
 
-
pGL3_hTERT was digested with BglII and MluI.<br>
 
-
pAAV_RC_1.1_SalI (short PCR) was digested with SalI.<br>
 
 +
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of pAAV_iGEM-mVenus-YFP</u></p>
 +
Hanna, Chris W. <br>
 +
* 3 µL of O28, 29 and 30 each were mixed with 27 µL water -> primer fpr sequencing of GOI and of hGH sequence
 +
* 11.1 µL plasmid + 18.9 µL H<sub>2</sub>O
<br>
<br>
-
{| border="1"
 
-
| components  || align="right" |volume of '''P125'''/µl ||volume of '''P126'''/µl||volume of '''P127/'''µl ||volume of '''P128'''/µl ||volume of '''neg. control P51.1'''/µl||volume of '''P129'''/µl||volume of '''P130/'''µl ||volume of '''P131'''/µl||volume of '''P132/'''µl ||volume of '''neg. control P51.1'''/µl||volume of '''P133'''/µl||volume of '''P134'''/µl||volume of '''P135'''/µl||volume of '''P136/'''µl ||volume of '''P137'''/µl ||volume of '''P138'''/µl||volume of '''neg. control P53.3'''/µl||volume of '''P139/'''µl ||volume of '''P140'''/µl||volume of '''neg. control P53.2'''/µl||volume of '''P141/'''µl ||volume of '''P142'''/µl||volume of '''P143/'''µl||volume of '''P144'''/µl||volume of '''neg. control P53.1'''/µl
 
-
|-
 
-
| DNA  ||3 ||3 ||3 ||3 ||7 ||3 ||3 ||2 ||2 ||7 ||4 ||4 ||4 ||4 ||1,5 ||1,5 ||2 ||1,5 ||2 ||2 ||3 ||3 ||2 ||1,8 ||2
 
-
|-
 
-
| BSA (10x) ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5
 
-
|-
 
-
| Buffer 4 (10x)||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5 ||1,5
 
-
|-
 
-
|Enzyme 1 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5 ||0,5
 
-
|-
 
-
|Enzyme 2 ||/ ||/ ||/ ||/ ||/ ||/ ||/ ||/ ||/ ||/ ||0,5 ||0,5 ||0,5 ||0,5 ||/ ||/ ||/ ||/ ||/ ||/ ||0,5 ||0,5 ||/ ||/ ||/
 
-
|-
 
-
|H2O ||8,5 ||8,5 ||9,5 ||9,5 ||4,5 ||8,5 ||8,5 ||8,5 ||8,5 ||4,5 ||7 ||7 ||7 ||7 ||10 ||10 ||9,5 ||10 ||9,5 ||9,5 ||8 ||8 ||9,5 ||9,7 ||9,5
 
-
|-
 
-
|'''Total volume /µl'''||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15 ||15
 
-
|}
 
-
<br />
 
-
'''Expected sizes:'''<br>
 
-
pSB1C3_SDM_SspI
 
-
*no cut<br>
 
-
control:
 
-
*2072bp<br>
 
-
pSB1C3_SDM_PvuII
+
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Investigation of the Kleinschmidt sequencing</u></p>
-
*no cut<br>
+
Investigator: Volker
-
control:
+
[[File:Freiburg_VP3ex sequencing.png|800px|thumb|right|The CMV promoter sequence was found in front of the expression constructs of VP2 and VP3]]
-
*2072bp<br>
+
-
pSB1C3_beta-globin
+
The sequencing of den unknown backbone pKEX revealed that the construct VP1ex from the DKFZ seemed not to contain a regulatory region for the expresion of the VP1 ORF, but in the backbonesequence there were some standard primers from GATC that could be used to sequence the insert of all expression constructs.<br><br>
-
*756bp<br>
+
This sequencing was done at the 26.06.2010. The read into the construct VP1 showed a long homologous region with the ORF of VP1 where as the sequencing of VP2ex and VP3ex did not show a homologous region with the ORFs of VP2 and VP3. <br><br>
-
*2058bp<br>
+
The test weather primers of GATC bind to the unknown region gave a positive hit in both constructs with the primer GATC_std_CMV_f. This primer is specific for the sequence of the CMV promoter. After this indice the sequences VM_2 26.06. -pBR1.ab1 and VM_3 26.06. -pBR1.ab1 were aligned with the sequence of the CMV  promoter provieded in the stratagene kit in the plasmid pAAV-MCS. The majority of the sequence fitted well with CMV promoter as indicated in the image in purple. At the 5' end of the CMV promoter there were some missmatches in the alignment indicated in yellow.<br><br>
-
 
+
The fact that VP2ex and VP3ex contained a CMV promoter element which was not included in VP1ex was unexpected. The sequencing with the standard primer GATC_std_CMV_f which binds at the 3' end of the CMV promoter and will probably sequence the ORF of VP2ex and VP3ex was ordered.<br><br>
-
pSB1C3_hgH
+
-
*502bp<br>
+
-
*2058bp<br>
+
-
 
+
-
pAAV_RC_1.1_BamHI (long and short PCR):
+
-
*no cut<br>
+
-
control:
+
-
*811bp<br>
+
-
*6524bp<br>
+
-
 
+
-
pGL3_hTERT
+
-
*467bp<br>
+
-
*4801bp<br>
+
-
 
+
-
pAAV_RC_1.1_SalI (short PCR):
+
-
*no cut<br>
+
-
control:
+
-
*7331bp<br>
+
-
 
+
-
<br>
+
-
<p style="font-size:13px; color:#11bb88;">'''Results of samples loaded 1% agarose gel and ran ~50 minutes at 115 V:''' </p>
+
-
[[File:Freiburg10 Test digestion of P125-144.png|400px]]
+
-
 
+
-
 
+
-
 
+
-
<p style="font-size:13px; color:#11bb56;">'''Sequencing''' </p>
+
-
Sequencing will be done next week.
+
-
 
+
-
<br>
+
-
 
+
-
====<p style="font-size:15px; background-color:#66bbff;"><b>Midi-prep of pSB1C3_CFP</b></p>====
+
-
<p><b>Investigator: Anissa</b> <br></p>
+
-
<p style="font-size:13px; color:#68bbff;"><b>Comments:</b> The mini-prep of pSB1C3_CFP was depleted, so a double midi-prep was made for serving the pool. They were named p51.1 and p51.2. Both are from the glycerol-stock B39, which means they are sequenzed and ready to use.</p>
+
-
<br>
+
-
 
+
-
* concentration p51.1: 132,06 ng/µL
+
-
* concentration p51.2: 151,47
+
-
 
+
-
<br>
+
-
<br>
+
-
 
+
-
=== 75. Labortag 31.7.2010 ===
+
-
====<p style="font-size:15px; background-color:#FF00FF;"><b>Trafo of ITR-over-night ligations</b></p>====
+
-
<p><b>Investigator: Hanna</b> <br></p>
+
-
The last step of the ITR fancy method was done ytesterday. Means: If cloning worked, both ITRs should be in the RFC10 standard. Ligation was done over night and the referring trafo will be done today. <br>
+
-
<br>
+
-
Trafo was performed following the standard protocol. <br>
+
-
Abberations:<br>
+
-
3 µL sample was added to BL21 cells. Incubation time on ice was just 15 minutes. Incubation at 37°C for 45 minutes.
+
<html>
<html>
</div>
</div>
</html>
</html>

Revision as of 11:27, 6 September 2010

Contents

Archiv

18. Labortag 01.06.2010: Modifying MCS of pAAV_MCS vector


Investigators: Anissa, Adrian, Bea, Chris W., Hanna, Patrick, Volker, Sven

Oligos received from Sigma-Aldrich
(right ITR of pAAV_MCS, left ITR of pAAV_MCS and MCS RFC25 for pAAV)

  • Hybrization of received oligos: MCS RFC25 for pAAV (forward) and MCS RFC25 for pAAV (reverse)
  • Centrifuge tubes prior to open tubes (13.000 rpm, 30 sec)
    • MCS RFC25 for pAAV (forward): Add 92µL Millipore H2O (Volume on obtained sheet)
    • MCS RFC25 for pAAV (reverse): Add 394 µL Millipore H2O (Volume on obtained sheet)
  • Vortex the resuspended DNA
  • Make aliquots of both Oligos (1:10): 10 µL Oligo + 90 µLH2O (final volume usually 100 µl)
  • Mix together(into PCR-tube):


Volume/µL solution
10 (1:10)Oligo 1: MCS RFC25 for pAAV (forward)
10Oligo 2: MCS RFC25 for pAAV (reverse)
4 100mM TrisHCl pH8
85mM MgCl2
8 H20


  • Program: ORIGAMI 1 modified for long oligos:
    • 1 99°C 7’
    • 2 99°C 1’
    • -1°C R=0.3 °/s
    • Goto 2 rep 74
    • Hold 4°C


  • While hybridization of oligos is performed, digestion of pAAV_MCS vector can be conducted

following standard protocol for cloning.

  • Title: Ligation MCS_Oligo with pAAV_MCS
  • Plasmid: pAAV_MCS
  • Buffer used: 3
  • BSA: Yes
  • Measure DNA-concentration with Nanodrop
  • DNA-Concentration:260 ng/uL
  • Restriction-enzyms used: http://www.neb.com/nebecomm/DoubleDigestCalculator.asp

Enzyme1 (Nr. Lab: 152): ClaI Enzyme2 (Nr. Lab: 15): BglII

  • Digestion components :
components pAAV_MCS
DNA 4
BSA (10x) 3
Buffer 3 (10x)3
Enzyme: ClaI (no.Lab:152)2
Enzyme: BglII (no.Lab:15)1
H2O17
Total volume30
  • Incubate for 1,5 h at 37°C


  • 1% Agarose gel
    • 1% agarose gel was prepared, gel ran for 45 minutes( first: 90V, after 15 minutes: 115 V)


  • Amount of loading dye added
sample/µL loading dye/µL
marker: 8 contains loading dye
pAAV_MCS: 24 6


  • Expected size of fragments
sample expected size
pAAV_MCS: cut with ClaI and BglII4580 bp


19. Labortag 02.06.2010: Oligos (NotI)

Investigators: Adrian, Bea, Chris W., Hanna, Anissa

Practical work:
Control plate contained no clones. :) 4 colonies were picked and grown @ 37°C over night.
Theoretical work:
Oligos for site directed mutagenesis of the NotI restriction sites in pAAV_MCS (ITRs) were designed:File:Freiburg10 NotI ITR Oligos.pdf
Sponsoring work:
Sponsoring letter was adapted for Quiagen.

20. Labortag 03.06.2010: pAAV_RFC25_MCS -> problem

Investigators: Anissa, Bea, Melanie, Christian L.

Comment: Continue with Mini-Prep and test digestion of pAAV_RFC25_MCS
Mini-Prep and test digestion have been performed:

Problem: Designed oligos (MCS_RFC25) for altering the MCS of the pAAV_MCS vector cannot be used.
Two startcodons are in the MCS.

Oligo MCS_RFC25: contains 2 Startcodons. the "wrong" Codon is the first ATG which results in peptide chain with 30 aa. The second ATG is the right ATG which is right before the Gene of Interest.










The two startcodons are not in the same open reading frame (ORF). Therefore two proteins will be produced. The Gene of Interest and the short peptide (30 aa).
The idea of the oligos was to ligate the oligos into the pAAV_MCS vector. The oligos contained two overhangs which correspond to the sequences of the two restriction sites ClaI and BglII:
The pAAV_MCS vector was digested with ClaI and BglII and then we ligated the oligo and the vector. Problem was that we did not notice that the overhang of ClaI and the sequence of EcoRI of the MCS_RFC25 resulted in another ATG startcodon.

Possible Solutions:

    1. first: modify MCS with ordered oligos of Sven (shorter MCS which cannot be used for pEX)and clone mVenus
    2. Perform site-directed-mutagenesis (QuikChange from Stratagene)
    3. Order new MCS-oligos and consider that no new ATG is produced. For example: add another base between ClaI overhang and EcoRI sequence. -----ATXG---- This solution is the more possible one we are going to perform.


Practical work

    • Preparing four glycerol stocks (2:1)
      • numbers: B4 - B7 (for details see nomenclature)
      • stored in -80°C, Box 1
  • MiniPrep
    • Nanodrop concentrations


Sample Concentration/ng*µl-1
P11 340,5
P12 364,0
P13 358,5
P14 284,4


  • Test digestion


Components Volume µl Mastermix µl
DNA 800 --
BSA (10x) 1,5 7,5
Buffer No.2 (10x) 1,5 7,5
Enzyme 1 (no.Lab:45) Nde I 0,5 2,5
Enzyme 2 (no.Lab:71) Spe I 0,5 2,5
H2O variable --
Total volume 15 20


Sample Volume/ µl H2O / µl
P11 2,3 8,7
P12 2,2 8,8
P13 2,2 8,8
P14 2,8 8,2
  • Incubation: 1,5 h


  • Agarose-Gel
    • Materials
    0,5 g Agarose, 50 ml TAE, 3µl GELRED, at 100 Volt, running time: 45 minutes
    Sample Sample/µl] Loading dye (5x/6x)/µl Expected size 1 (Geneious) Expected size 2 (Geneious)
    P11 15 µl 3 µl 3677 bp 974 bp
    P12 15 µl 3 µl 3677 bp 974 bp
    P13 15 µl 4 µl 3677 bp 974 bp
    P14 15 µl 4 µl 3677 bp 974 bp


    Marker Sample P11 /18 µl Sample P12 /18 µl Sample P13 /19 µl Sample P14 /19 µl
    Lane 1 3 5 7 9

    Results of agarose-gel:

      • Expected fragments of 3677 bp and 974 bp can be cerified. The insertion of the RFC25_MCS has been inserted.
      For further verification the insert has to be sequenced has to be conducted (to do for 04.06.2010).


    Picking clones of Thymindinkinase of Amor

      • 5 clones of the XL-1 Blue colonies containing the plasmid pUB6/HV5/His6 with the thymidinkinase have been picked from LBamp-agarplates
      • 1 clone of the XL-1 Blue colonies containing the plasmid pUB6/HV5/His6 without the thymidinkinase (control) has been picked from LBamp-agarplates
      • all clones have been inoculated in 10 mL LB containing 10 µL Amp. Incubation: 37°C over-night.
      • to do: Mini-Prep of pUB6/HV5/His6 with the thymidinkinase and pUB6/HV5/His6 without the thymidinkinase (control)


    Idea

      • Insertion of Kozak consensus sequence before MCS to enhance gene expression (cloning consideration in Stratagene manual)
        • New RFC standard with Kozak sequence for eucaryotes??

      21. Labortag 04.06.2010: DKFZ plasmid Retrafos, TK/GMK Mini-Prep

      Investigators: Adrian, Bea, Chris W., Hanna

      DKFZ

      Comments: Plasmids of PD Kleinschmidt of the DKFZ arrived. The DNA was dried on a whatman paper.
      Plasmids received:

      • pXX6 alle Adenovirus Helfer Gene ohne AAV Gene; Plasmid von J. Samulski; evtl. Anfragen für Benutzererlaubnis
      • pKEX-2XL.Rep40 Expressionsplasmide für das Rep Proteine 40
      • pKEX-2XL.Rep 52 Expressionsplasmide für das Rep Proteine 52
      • pKEX-2XL.Rep 68 Expressionsplasmide für das Rep Proteine 68
      • pKEX-2XL.Rep 78 Expressionsplasmide für das Rep Proteine 78
      • pCMV-VP(HS) Expressionsplasmid der drei VP Proteine in Kombination (assemly kompetent
      • pKEX-VP1 Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
      • pKEX-VP2Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
      • pKEX-VP3Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
      • pTRUF_CMV_eGFPEinzelstrang Vektor zur Expression von eGFP
      • dsAAV_CMV_eGFP"self complementary" Expressionsvektor von X. Xiao; evtl. anfragen wegen Benutzererlaubnis
      • pTAV2 (gesamtes AAV Genom im "blue script" Vektor)
      • pDG komplettes Helferplasmid zur Vektorherstellung; Grimm et al. 1998


      • In order to obtain the DNA following steps have been performed:
        • cut out the spot where the DNA is spotted with a clean scalpel (note: scalpel should not have any contamination).
        • put a 0,5 mL Eppi in a 1,5 mL Eppi. Put little holes in the smaller eppi.
        • transfer Whatman paper into Eppi
        • add 50 µL TE-EF (Redissolving buffer) to whatman paper and wait 15 minutes
        • centrifuge eppis at 2000 rpm, 10 minutes
      • Transformation with obtained plasmids was performed.


    Fusion Enzyme: Thymidinkinase/Guanylate Kinase (TK/GMK)

    Plasmid Mini-Prep

    • experiment date: 04.06.2010 ; time: 3,5h
    • name of investigator: Adrian, Bea, ChrisW.,Hanna
    • new vector name: pUB_V5_His6 + TK/GMK (fusionenzyme)


    Glycerol Stocks

    Clone 1 Clone 2 Clone 3 Clone 4 Clone 5Control
    Bacteria strain XL-1 Blue XL-1 Blue XL-1 Blue XL-1 Blue XL-1 Blue XL-1 Blue
    Plasmidname pUB_V5_His6 + TK/GMK pUB_V5_His6 + TK/GMK pUB_V5_His6 + TK/GMK pUB_V5_His6 + TK/GMK pUB_V5_His6 + TK/GMK pUB_V5_His6 + TK/GMK
    Date 04.06.2010 04.06.2010 04.06.2010 04.06.2010 04.06.2010 04.06.2010
    given number B8 B9 B10 B11 B12 B13


    Given Plasmid-Number

    Clone 1 Clone 2 Clone 3 Clone 4 Clone 5 Control
    given number P15 P16 P17 P18 P19 P20


    Nanodrop concentration

    • Plasmid
      • Given Plasmid-Number: P15; DNA concentration: 493,7 ng/µL ;
      • Given Plasmid-Number: P16; DNA concentration: 464,4 ng/µL;
      • Given Plasmid-Number: P17; DNA concentration: 445,6 ng/µL;
      • Given Plasmid-Number: P18; DNA concentration: 562,9 ng/µL;
      • Given Plasmid-Number: P19; DNA concentration: 528,1 ng/µL;
      • Given Plasmid-Number: P20; DNA concentration: 499,9 ng/µL;


    Comments:A Plasmid-Mini Prep with the received Fusionenzyme Thymidinkinase/Guanylate Kinase (TK/GMK)from Amor has been performed.
    The DNA will be sent to GATC for sequencing.

    • pUB6_V5_His6 - clone 1 (P15) (3 µL added to 27µL H20) has been sent to GATC.
    • Expected results: Saturday



    22. Labortag 05.06.2010: Insertion of iGEM expression parts into pAAV_MCS

    Investigators: Adrian, Bea, Melanie, Hanna

    Hybridization:

    • Hybridization of received oligos: iGEM expression parts (RFC25 without EcoRI, NotI)
    • Prior to opening the tubes, they were centrifugated at 13.000 rpm for 30 sec.
      • expression part MCS_for (charge-no: ST00114065): 108 µL Millipore H2O (Volume on obtained sheet)were added.
      • expression part MCS_for (charge-no: ST00114066): 165 µL Millipore H2O (Volume on obtained sheet)were added.
    • Resuspended DNA was vortexted.
    • Aliquots of both Oligos (1:10) were prepared: 10 µL Oligo + 90 µL H2O (final volume usually 100 µl).
    • Mix together(into PCR-tube):


    Volume/µL solution
    10 (1:10)Oligo 1: expression part MCS_for (charge-no: ST00114065)
    10 (1:10)Oligo 2: expression part MCS_for (charge-no: ST00114066)
    4 100 mM TrisHCl pH8
    85 mM MgCl2
    8 H20


    • Program: ORIGAMI 1 modified for long oligos:
      • 1 99°C 7’
      • 2 99°C 1’
      • -1°C R=0.3 °/s
      • Goto 2 rep 74
      • Hold 4°C


    • While hybridization of oligos was performed, digestion of pAAV_MCS vector was conducted

    following standard protocol for cloning.

    Digestion:

    • Title: Ligation iGEM expression parts (="iGEM-MCS") with pAAV_MCS
    • Plasmid: pAAV_MCS
    • Buffer used: 3
    • BSA: Yes
    • DNA-Concentration: 260 ng/uL
    • Restriction-enzyms used:

    Enzyme1 (Nr. Lab: 152): ClaI Enzyme2 (Nr. Lab: 15): BglII

    • Digestion components :
    components pAAV_MCS
    DNA 5.8 µL
    BSA (10x) 3 µL
    Buffer 3 (10x)2 µL
    Enzyme: ClaI (no.Lab:152)2 µL
    Enzyme: BglII (no.Lab:15)1 µL
    H2O16.2 µL
    Total volume30 µL
    • Mixture was incubated for 1,5 h at 37°C.


    Agarose-Gel:

    • 1% agarose gel was prepared, gel ran for 45 minutes(110 V)


    • Amount of loading dye added
    sample/µL loading dye/µL
    marker: 8 contains loading dye
    pAAV_MCS: 30 6 (6x loading dye)


    • Expected size of fragments
    sample expected size
    pAAV_MCS: cut with ClaI and BglII4580 bp


    </ul>

    Gelextraction:


    Gel measurement:

    Sample weight
    pAAV_MCS 60 mg
    • Gelextraction was performed following standard protocol.
    • DNA-concentrations were meassured: pAAV_MCS 18.2 ng/µL, Oligos: 136.7 ng/µL -> 1:10 dilution was prepared: 13.67 ng/µL



    Ligation:


    iGEM-MCS pAAV_MCS
    Volume/µl 0.4 8.6


    Trafo was performed (using XL1B cells) following standard protocol.

    23. Labortag 07.06.2010: Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)

    investigators: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea

    pAAV_iGEM-MCS

    Plasmid Mini-Prep

    • experiment date:07.06.2010; time: whole day
    • name of investigator: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea


    Glycerol Stocks

    Clone 1 Clone 2 Clone 3 Clone 4
    Bacteria strain XL1B XL1B XL1B XL1B
    Plasmidname pAAV_iGEM-MCS pAAV_iGEM-MCS pAAV_iGEM-MCS pAAV_iGEM-MCS
    Date 07.06.2010 07.06.2010 07.06.2010 07.06.2010
    given number - B27 B28 B29


    Given Plasmid-Number

    Clone 1 Clone 2 Clone 3 Clone 4
    given number - P34.2 P34.3 P34.4


    Test digestion

    • buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) NdeI
    • Plasmid
      • Given Plasmid-Number: P34.2; DNA concentration: 433.78 ng/µL ;
      • Given Plasmid-Number: P34.3; DNA concentration: 408.48 ng/µL ;
      • Given Plasmid-Number: P34.4; DNA concentration: 409.80 ng/µL ;


    Comments:Clone no.1 was dismissed...

    Test digestion:

    Components Volume/µL Mastermix
    DNA (clone 2) 1000 ng -
    BSA (10x) no -
    Buffer no. 4 (10x) 1.5 µL -
    Enzyme 1 (no. Lab: ) AgeI 0.75 µL -
    Enzyme 2 (no. Lab: ) NdeI 0.5 µL -
    H2O variable -
    Total volume 15 µL -


    Sample Volume sample/ µl Volume H2O / µl
    P34.2 2.3 9.95
    P34.3 2.4 9.85
    P34.4 2.4 9.85
    • Incubation: 45 min, 37°C


    Agarose-Gel:


    0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 110 Volt, running time: 45 minutes

    Sample Sample/µl] Loading dye (5x/6x)/µl Expected size 1 (Geneious) Expected size 2 (Geneious)
    P34.2 15 µl 3 µl 3686 bp 951 bp
    P34.3 15 µl 3 µl 3686 bp 951 bp
    P34.4 15 µl 3 µl 3686 bp 951 bp


    • Marker: GeneRuler ladder mix
    Marker Sample Sample Sample
    Lane 34.2 / 18 µl 34.3 / 18 µl 34.4 / 18 µl



    Kleinschmidt-plasmids

    Plasmid Mini-Prep

    • experiment date: 07.06.2010 ; time: 10 – 20 h
    • name of investigator: Kira, Achim, Jessy, Bea, Adrian, Hanna
    • Kleinschmidt-plasmids


    Glycerol Stocks

    Clone 1 Clone 2 Clone 3 Clone 4 Clone 5 Clone 6 Clone 7 Clone 8 Clone 9 Clone 10 Clone 11 Clone 12 Clone 13
    Bacteria strain XL1B XL1B XL1B XL1B XL1B XL1B XL1B XL1B XL1B XL1B XL1B XL1B XL1B
    Plasmidname pXX6 pKEX-2XL.Rep 40 pKEX-2XL.Rep 52 pKEX-2XL.Rep 68 pKEX-2XL.Rep 78 pCMV-VP(HS) pKEX-VP1 pKEX-VP2 pKEX-VP3 pTRUF_CMV_eGFP dsAAV_CMV_eGFP pTAV2 pDG
    Date 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010 07.06.2010
    given number B14 B15 B16 B17 B18 B19 B20 B21 B22 B23 B24 B25 B26


    Given Plasmid-Number

    Clone 1 Clone 2 Clone 3 Clone 4 Clone 5 Clone 6 Clone 7 Clone 8 Clone 9 Clone 10 Clone 11 Clone 12 Clone 13
    given number P21 P22 P23 P24 P25 P26 P27 P28 P29 P30 P31 P32 P33
    measured concentration 351,01 673,1 532,22 579,05 725,31 659,68 692,8 545,46 568,34 420,62 446,95 496,8 472,58



    Comments: Many things went wrong today!

    • Glycerol stocks must be vortexted!
    • Check mini-prep buffers - especially buffer PE (needs to contain ethanol!)
    • Always check volumes - try to estimate if volume makes sense (check pipettes!)
    • Don't discard bacteria cultures until glycerol stocks and mini-preps are successfully done!!!

    Today's conclusion: Better ask 2 times than do something wrong without asking!!!


    Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)


    Quickchange site directed mutagenesis: PCR reaction:

    • 2.5 µL 10x Pfu Ultra II buffer
    • 0.5 µL template (therefore the a 1:20 dilution of the pAAV_iGEM-MCS (433 ng/µL) was prepared) = 10.825 ng
    • 0.56 µL primer 1 (of 1:10 dilution)
    • 0.56 µL primer 2 (of 1:10 dilution)
    • 1 µL DMSO (primers form very strong secondary structures)
    • 0.5 µL dNTP
    • 18.88 µL dH2O
    • 0.5 µL PfuUltra II fusion (1.25 U)

    -> end volume: 25 µL

    PCR program:
    1 x : 2' 95°C (HotStart polymerase) 20 x : 30 s 95°C -> 1' 55°C -> 5' 68°C 1 x : 4°C (over night)
    Experiment will be continued tomorrow.

    24. Labortag 08.06.2010: Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis

    Investigators: Kira, Jessy, Hanna, Achim

    Analysis of iGEM-MCS sequence (RFC25 without EcoRI and NotI):


    Freiburg10 iGEM-MCS.jpg
    The alignment with the theoretical pAAV_iGEM-MCS delivered a "C-deletion" within the NgoMIV restriction site. Due to that the pAAV_iGEM-MCS lacks this site. We controlled the bill of delivery and noted that the deletion must be GATC's fault. All in all this doesn't matter, because parts which are in iGEM standard can be inserted and therefore they will deliver the lacking NgoMIV restriction site. Further on this could be an advantage because after digestion the fragment which is cut out can be better detected in the gel.

    Insertion of mVenus_YFP into pAAV_iGEM-MCS

    Digestion:

  • plasmid: insert: pGA14mVenusGeneart; number: - origin:Sven
  • plasmid: vector: pAAV_iGEM-MCS; number: P32.2 production date:05.06.2010 origin: ____
  • new vector name: pAAV_iGEM-MCS_mVenus
  • buffer used:4 ; Restriction-enzymes used: Enzyme AgeI (no. Lab:149); Enzyme XbaI (no. Lab: 63)
  • DNA concentration (vector):433,78ng/µl ; DNA concentration (insert): 530 ng/µl

    components V (pAAV_iGEM-MCS)/ µl I(pGA14mVenus_Geneart) / µl
    DNA 2,33,8
    BSA (10x) 22
    Buffer 3 (10x)22
    Enzyme: AgeI (no.Lab:149)1,251,25
    Enzyme: XbaI (no.Lab:63)0,750,75
    H2O11,710,2
    Total volume2020
  • Incubation: 1 1/2 h at 37°C
    0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 115 Volt, running time:

    Sample Sample/µl] Loading dye (6x)/µl Expected size 1 (Geneious) Expected size 2 (Geneious)
    P34.2 20 µl 4 µl 4617 bp 22 bp
    pGA14mVenus 20 µl 4 µl 2870 bp 774 bp



  • Gel loaded with vector and insert samples, 24 µl each & 8 µl marker
  • after 20 minutes, the insert band was cut out. Two overlapping bands were visible in the vector well, after 1 1/2 hours those bands were separated and both were cut out.

    Sample weight concentration
    Vektor_Oben 0,32 g 29,8 ng/µl
    Vektor_Unten 0,14 g 12,8 ng/µl
    Insert0,3 g 12,9 ng/µl



  • the exact volume of insert and vector was calculated with LabTools:
  • Ligation I with Vektor_Oben:
      • Vector: 4,16 µl
      • Insert: 4,84 µl
  • Ligation II with Vektor_Unten:
      • Vector: 6 µl
      • Insert: 3 µl


    continuation of site-directed mutagenesis

    Digestion with DpnI:

  • 0.5 µl DpnI added
  • incubated for 1 hour at 37°C

    Trafo:

  • Cells used for transformation: XL1B
  • Centrifugation for 3 min at 8000 rpm instead of 6000 rpm (accidentaly)
  • Plated on agar plate: pAAV_IGEM-MCS Mutagenese PST1 8.6.2010 AM XL1B
  • incubated over night

    25. Labortag 09.06.2010: pAAV_iGEM-MCS_mVenus-YFP, site-directed mutagenesis

    investigators: Jessy, Achim, Sven, Toby, Hanna

    No pAAV_iGEM-MCS_w/oPstI transformed bacteria (site-directed mutagensis) grew on the ampicillin agar plates over night!

    Experiment is conducted again by Toby (Thanks a lot!!!).


    Further on the cloning of mVenus-YFP into pAAV_iGEM-MCS seemed to fail:

    Only on the agar plate cotaining the bacteria transformed with the "vector_oben" ligation, which actually should be the "wrong" ligation (gelextraction of a band which contained fragments that were too large, see picture in lab journal), revealed colonies. Therefore this experiments is also conducted one more time by Sven (thanks also a lot!!!)


    Insertion of mVenus_YFP into pAAV_iGEM-MCS

    • experiment date: 9.6.2010
    • name of investigator: Sven
    • plasmid:
      • Vector: name: pAAV_iGEM-MCS number: 34.2 production date: 5.6.2010
      • Insert: name: pOG14_mVenus number: - production date: ____ origin: Sven :)
    • new vector name: pAAV_iGEM-MCS_mVenus-YFP
    • buffer used: NEB4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) XbaI
    • DNA concentration (vector): 433 ng/µL ; DNA concentration (insert): 530 ng/µL



    Digestion

    components volume of vector /µl volume of insert /µl
    DNA 2.83 2.77
    BSA (100x) 0.5 0.5
    Buffer NEB4 (10x) 3.0 3.0
    Enzyme 1 (AgeI) 1.75 1.75
    Enzyme 2 (XbaI) 1.25 1.25
    H2O20.73 20.67
    Total volume (e.g. 15,20,25,30 µl) 30 30



    Agarose-Gel:


    0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED (3-6µl), at 115 Volt

    Gelextraction


    • insert (mVenus-YFP): 26 ng/µL
    • vector (pAAV_iGEM-MCS): 30 ng/µL

    Ligation


    • vector: 5.85 µL
    • insert: 3.15 µL
    • ligase: 1 µL
    • buffer: 10 µL



    Test digestion of pAAV_iGEM-MCS

    p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>

    • buffer used: 1 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) NgoMIV
    • Plasmid
      • Given Plasmid-Number: P34.2 ; DNA concentration: 433.78 ng/µL;
      • Given Plasmid-Number: P34.3 ; DNA concentration: 408.48 ng/µL;
      • Given Plasmid-Number: P34.4 ; DNA concentration: 409.8 ng/µL;



    Components P34.2 [µL] P34.3 [µL] P34.4 [µL]
    DNA 2.3 2.5 2.4
    BSA (10x) 1 1 1
    Buffer no. 1 (10x) 1 1 1
    Enzyme 1 (no. Lab: 113) ngoMIV 1 1 1
    H2O 4.7 4.5 4.6
    Total volume 10 10 10
    • Incubation: 1 h, 37°C


    Agarose-Gel:


    0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes + 20 minutes

    Sample Sample/µl] Loading dye (6x)/µl Expected size 1 (Geneious) Expected size 2 (Geneious)
    P34.2 10 µl 2 µl 3728 bp 903 bp
    P34.3 10 µl 2 µl 3782 bp 903 bp
    P34.4 10 µl 2 µl 3782 bp 903 bp


    • Marker: GeneRuler ladder mix
    Marker Sample P34.2 /µl Sample P34.3 /µl Sample P34.4 /µl
    Lane 8 µL 10 µL 10 µL 10 µL


    Comments: Digestion of P34.2 delivered just one fragment size, revealing that - as expected after sequencing (C-deletion: no NgoMIV site in iGEM-MCS) - there was just one NgoMIV restriction site in the vector. In contrast to that the digestion of P34.3 and P34.4 delivered two bands - whereas the band of the smaller fragments looked like a smier. Because of this obscure and non-satisfying results (besides our assumption that there's something wrong with the marker :) )we decided to sequence the P34.3 vector:

    • c(P34.3): 408.48 ng/µL
    • Volume (plasmid): 5.14 µL
    • Volume (vector): 24.86 µL
    • Name of eppi: HW_34
    • Primer: GATC_std_pTeSp-1

    Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben

    • experiment date: 9.6.2010
    • name of investigator: Hanna, Achim
    • plasmid:
      • Vector: name: pAAV_iGEM-MCS_Vektor_oben
      • Insert: name: pOG14_mVenus
    • new vector name: pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben


    The Clones were picked and incubated in 10 mL LB-Medium containing 10µL ampicillin over night at 37°C on a rotary shaker.

    26. Labortag 10.06.2010:

    Site-directed mutagenesis of PstI in ITRs

    1. Site directed mutagenisis



    Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion

    2.1 Mini-Prep of pAAV_iGEM_mVenus_YFP


    Title: pAAV_iGEM_mVenus_
    investigator: Jessy, Achim
    Glycerol Stocks

    Clone 1 Clone 2
    Bacteria strain XL1 blue XL1 blue
    Plasmidname pAAV_iGEM_mVenus pAAV_iGEM_mVenus
    Date 10.06.2010 10.06.2010
    given number B30 B31


    Given Plasmid-Number

    Clone 1 Clone 2
    given number P35 P36


    Title: pAAV_iGEM_mVenus_YFP (guided by Sven)
    investigator: Bea Glycerol Stocks

    Clone 1 Clone 2 Clone 3 Clone 4
    Bacteria strain BL-21 BL-21 BL-21 BL-21
    Plasmidname pAAV_iGEM_mVenus_YFP pAAV_iGEM_mVenus_YFP pAAV_iGEM_mVenus_YFP pAAV_iGEM_mVenus_YFP
    Date 10.06.2010 10.06.2010 10.06.2010 10.06.2010
    given number B32 B33 B34 B35


    Given Plasmid-Number

    Clone 1 Clone 2 Clone 3 Clone 4
    given number P37 P38 P39 P40


    2.2 Test digestion

    • buffer used: 4 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme AgeI (no.Lab:___) ____
    • Plasmid
      • Given Plasmid-Number: P37; DNA concentration: 114,8 ng/µL ;
      • Given Plasmid-Number: P38 ; DNA concentration: 179,8 ng/µL;
      • Given Plasmid-Number: P39 ; DNA concentration: 180,8ng/µL ;
      • Given Plasmid-Number: P40; DNA concentration: 189,2 ng/µL;


    Comments: Clones were picked from trafo-plate in the morning and mini-prep was performed in the late afternoon. Due to this and the fact that bacterial strain was BL-21, DNA-concentrations are quite low.

    Investigators: Bea, Chris W.

    Components Volume/µL Mastermix Sample: P37 Sample: P38 Sample: P39 Sample: P40
    DNA 800 ng - 7,0 µL4,5 µL4,4 µL 4,2 µL
    BSA (10x) yes 1,5 µL 7,5 µL MM 4,5 µLMM 4,5 µLMM 4,5 µL MM 4,5 µL
    Buffer no. 4 (10x) 1.5 µL 7,5 µL """ "
    Enzyme 1 (no. Lab: ) AgeI 0.75 µL 3,75 µL """ "
    Enzyme 2 (no. Lab: ) XbaI 0.5 µL 2,5 µL """ "
    H2O variable - 3,75 µL0,25 µL6,35 µL 6,55 µL
    Total volume 15 µL - 15 µL15 µL15 µL 15 µL


    • Incubation: 45 min, 37°C


    27. Labortag 11.06.2010:

    in additon to

    Site directed mutagenisis

    on 10.06.10


    transformation
    transformation was performed according to the standard protocol Media:Freiburg10_Cloning Protocol.pdf
    Cells were plated on agar plates (2x 1:100; 2x pellet)containing ampicillin and stored over night at 37°C.

    Sequenzing

    p39 was send to GATC for sequenzing

    • p39: 180,83 ng*µl^-1
    • volume plasmid: 8,3 µl
    • volume water: 21,7 µl
    • primer: GATC_std_pTeSp-1

    28. Labortag 12.06.2010:

    Kira
    The plates were stored in the iGEM shelf @ 4 °C. Even if the transformation was not very successfull, some colonies can be picked and inoculated either tomorrow or on Monday. Note: Site-directed mutagenesis does not generate lots of intact plasmids, so few colonies are normal!! (Tobias)

    29. Labortag 13.06.2010:

    Jessy, Patrick, Hanna
    We weren't able to detect any colonies on the plates - just a few air bubbles :) To be entirely sure, we put them back into the 37°C room over night.

    30. Labortag 14.06.2010:

    pAAV_iGEM-mVenus-YFP:

    The sequencing data of pAAV_iGEM_mVenus-YFP was analyzed. The alignment with the "theoretical" pAAV_iGEM_mVenus-YFP showed that we successfully inserted mVenus-YFP into pAAV_iGEM-MCS. Freiburg10 mVenus-Alignment.jpg

    Site-directed mutagenesis:

    Also today no colonies were detectable on any plates!

    TK-GMK-Plasmid

    Adrian, Hanna
    puB6_V5_His6_clone1 + TK/GMK (P15) will be sequenced again:

    • name: AF 1
    • primer: GATC_std_BGH-reverse
    • volume(plasmid) = 4.25 µL
    • volume (H2O) = 25.75 µL

    Results (15.06.): Unfortunately just ~ 300 bp were sequenced.

    To do: Therefore more primers have to be designed in order to sequence the whole ~2000 bp TK-GMK fusion construct!


    Zellkultur

    AAV 293 and HT1080 Cells have been splitted and plated out on 10 cm dishes for transfektion. The Cells were accounted by using the Neubauer-Meteringchamber. After harvesting by following the standard protocol the pallet have been resuspendiated in 15ml of DTT medium. 2,5µl of this cell suspension have been mixed with 47.5µl of trypan blue.

    We counted 12,5x 10^6 cells/ml for the T293 AAV cell line and 10x10^6 cells /ml for the HT1080 cell line.

    The AAV 293 cells have been plated out on four dishes with 250µl of the cell suspension, on one plated with 1ml and on another dish with 1.5ml. note that that the date is wrong on the plates and the flasks! Cells have been already plated out on the 14th. of June.

    We also seated two flasks one for each cell line. Therefor we used 1ml of the HT1080 cell suspension and two ml of the the AAV293 cells.

    31. Labortag 15.06.2010:

    Adrian, Achim, Chris W., Hanna

    Solutions for transfection were prepared:

    • 1 x TE-Buffer: 1.2114 g TRIS, 0.2 mL EDTA, 81 mL milipore-H2O were mixed. pH was adjusted with HCl (1M and 5M) to 7.50. Volume was adjusted to 100 mL with milipore-H2O. Solution was autoclaved (sterilization by filtration is also possible).
    • 1 M CaCl2: 147.02 g CaCl2 x 2H2O (M = 147.02 g/mol) was solved in 1 Liter H2O and sterilized by filtration.
    • 2 x HBS: 0.027 g Na2HPO4, 1.636 g NaCl, 1.19155 g HEPES were dissolved in ~ 30 mL milipore-H2O. pH was adjusted to 7.10. Volume was adjusted to 100 mL and sterilized by filtration.


    32. Labortag 16.06.2010:

    Sponsoring:

    Anna, Kerstin, Anissa
    Sponsoring letters were examined and modified one more time.

    Sequencing of TK-GMK:

    Hanna
    Two primers were designed and ordered from Sigma-Aldrich. Probably we will receive them on Friday.

    Mega primer PCR:

    Bea, Hanna

    Freiburg10 ITRprimer.jpg

    33. Labortag 17.06.2010:

    Primer designing: VP1 primer for pKEX forward/reverse

    Investigator: Volker
    The construnts that we receieved from PD Dr. Kleinschmidt (DKFZ) are mainly in the pKEX backbone. The sequences of the backbone and the inserts are not availible, for this reason we decided to sequence the constructs. The first step is to sequence from one construct into the backbone. In the second step we will designe primers that bind in the backbone and point into the direction of the insert. These primers will then be used to sequence the inserts of all the constructs.

    Forward primer pKEX in VP1 from bp 4124 to 414

    • VP1 primer for pKEX forward: 5' - CAACAAGTCTGTTAATGTGGAC - 3' 22bp; TM: 50°C; CG% 41%

    Reverse primer pKEX in VP1 from bp 2081 to 2100

    • VP1 primer for pKEX reverse: 5' - GTGGGCCAGGTTTGAGCTTC - 3' 20bp; TM: 54°C CG%: 60%

    The amplicon that should be produced by the primers is 199 bp long.

    Primer designing: CMV_forward/reverse_qPCR

    Investigator: Volker
    Primers for the titering of the CMV region from the literature [Rohr et al., 2002] and [Rohr et al., 2005] were compared and analysed. The sequences from 2002 showed a differce in one nucleotide compared to the other primer and to our sequence. For this reason the second set [Rohr et al., 2005] was ordered.

    • CMV_forward_qPCR: 5' - GGGACTTTCCTACTTGGCA - 3'
    • CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'
    Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively

    These primers will be used in a quantitative PCR assay with Sybr-green to measure the genomic titer and the infectious titer of the viral particles we will produce in the future.

    Ordering of required reagents:

    Investigator: Volker

    • Nuclease S1 was ordered from Promega (10000Units for 36,00€)
    • Proteinase K was ordered from Sigma (5mg for 31,30€; BioUltra, ≥30 units/mg protein, lyophilized powder)

    These reagents are required for the procedure to determine the genomic and the infectious titer.

    34. Labortag 18.06.2010: Transfection

    Transfection

    Transfection via calcium phosphat with the prepared solutions (31. Labortag 15.06.2010)

    investigators: Chris W., Hanna, Patrick, Adrian, Volker
    Transfections with the following plasmids:

    1)

    • pAAV_iGEM_mVenus_YFP (glycerol stock B34, P39) P39 has the correct sequence (confirmed)
    • pHelper
    • pAAV_RC

    2)

    • pAAV_iGEM_mVenus_YFP (glycerol stock B33, P38) P38 (we dont know if P39 has the correct sequence!)was used because the amount of P39 was not sufficient enough for four Transfections!
    • pHelper
    • pAAV_RC

    Plasmid concentrations:
    pAAV_RC: 1 µg/µl
    pHelper: 280 ng/µl
    pAAV_iGEM_mVenus_YFP, P39: 180,83 ng/µl
    pAAV_iGEM_mVenus_YFP, P38: 179,75 ng/µl

    Cellculture clone 1 and 2 were transfected with P39. Cellculture clone 3 and 4 were transfected with P38.

    Deviations from the standard protocol (currently incomplete): We could only pipet 3,3 µg (instead of 10 µg) from each of the 3 plasmids into the 15 ml falcons due to insufficient amount of plasmid.

    Adrian tried to examine the precipation of the CaCl2+ DNA Clusters. We have to optimize the pH of our 2xHBS at the moment it is 11.12

    Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick

    investigator: Bea
    idea:

    • Digest vector in order to obtain two fragments which contain the left and the right ITR respectively.
    • Separation (Agarose-gel) and gel extraction of fragments
    • Perform PCR with iGEM-Primers (forward primer contains EcoRI and Xbai; reverse primer contains SpeI and PstI)
    • to do:
      • design primers
      • digestion of pAAV_MCS etc.

    Theoretical: Digestion of pAAV_MCS with AlwNI produces two fragments which can be separated by agaorse gel.

    Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively










    35. Labortag 19.06.2010: Literature seminar

    Investigators: Bea, Hanna, Melanie, Denis, Volker, Christian W., Adrian and Achim

    Topics:

    • The ITRs
    • The Cap

    36.Labortag 20.06.2010: Picking clones of sequenced pAAV_igEM_mVenus_YFP

    Investigators: Bea and Chris W

    • Incoluate 250 mL DYT medium (add 250µL ampiciliin) with B34 (glycerol stock: BL-21 E.coli cells with P39 plasmid: pAAV-iGEM_mVenus_YFP
    • Incubate on rotary shaker over-night (o/n) at 37°C
    • to do: perform Midi-Prep tomorrow (21.06.2010)

    37.Labortag 21.06.2010: Second Transfection, Transduction

    2x HBS was steril filtrated into two 50 ml flacons. The falcons were put into the cellculture fridge.

    New medium is prepared:

    DMEM-Medium

    • 500ml DMEM with Glutamax
    • 10% FCS (50 ml)
    • 5 ml 100x Pen/Strep
    • 5 ml 100x NaPyruvat

    H-DMEM-Medium

    • 400 ml DMEM with Glutamax
    • 90 ml FCS
    • 5 ml 100x Pen/Strep
    • 5 ml 100x NaPyruvat

    Investigators: Patrick, Johannes

    Feching dry ice for the experiments

    Volker

    Dry ice can be fetched from the department for macromolecular chemistry. The chemical depot is located in the second basement. The dry ice can be retrieved from monday to friday from 11:00 to 11:30 and from 14:15 to 14:30. The requestforms for this institute can be found in the iGEM folder and should be filled out, signed by an advisor and taken to the chemical depot. A styrofoam container is required for the transport.

    Annotation of the BRs and the PLA2 domains

    Volker
    The Bacis Regions which are important for the nuclear localisation were annotated in the protein sequences of VP 1-3 according to: [Grieger et al, 2006]

    Endotoxin-free Midi-Prep of pAAV_iGEM_mVenus-YFP

    Chris W., Hanna (guided by Sven)
    Midi-Prep was performed following standard protocol: File:Freiburg10 Endotoxinfreie Midi.pdf
    DNA concenration was measured: 507 ng/µL
    Plasmid was further used for a...

    ... Second Transfection

    Six transfections were performed according to the standart protocol: Media:Freiburg10_Transfection_protocoll.pdf
    Three 10 cm cellcluture dishes with 293 cells were transfected with 10 µg DNA (3,33 µg each plasmid) and the other three 10 cm cellculture dishes with 30 µg DNA (10 µg DNA each plasmid).

    Plasmids:

    • pAAV_iGEM-MCS_mVenus (P41), 507 ng/µl
    • pAAV_RC , 1000 ng/µl
    • pHelper , 280 ng/µl

    Investigators: Patrick, Johannes

    Preparing Viral Stocks

    ... according to the standart protocol (see AAV Helper-free System manual). No dilution was performed.

    Investigators: Johannes, Patrick

    HT1080 Transduction

    Four 10 cm cellculture dishes with HT1080 cells have been provided for the transduction.

    • 1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 1. Note: the virus solution (buffer) showed a yellow coloration.
    • 1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 2. Note: the virus solution showed (buffer) an orange coloration.
    • 1 ml of the AAV-2-mVenus (derived from P 38) was pipeted to into dish 3. Note: the virus solution showed (buffer) an orange coloration.
    • 1 ml of the AAV-2-mVenus (derived from P 38) was pipeted to into dish 4. Note: the virus solution showed (buffer) an orange coloration.

    Apart from the dilution, the transduction was performed according to the standart protocol.

    Investigators: Johannes, Patrick

    38.Labortag 22.06.2010: Midiprep of pHelper plasmid; cloning of the rfc25 MCS

    Investigators: Bea, Chris W, Adrian, Achim

    • Hybridisation of oligos RFC25 EcoR1+BglII for & RFC25 EcoR1+BglII rev
      • Programm ORIGAMI1 was modified for normal oligos:
        • 1 95°C 7'
        • 2 95°C 1'
        • -1°C R=0,3°s
        • Rep 70
    • conc of Oligos: 138,3µg/µl


    Digestion


  • plasmid: name: pAAV_MCS number: P9 production date: 01.06.2010 origin: Adrian, Hanna, Bea
  • new vector name: pAAV_RFC25
  • buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:23) EcoRI ; Enzyme 2 (no.Lab:15) BglII
  • DNA concentration (vector): 261,6 ng/µL
    components volume of vector /µl volume of insert /µl
    DNA 5,8 none
    BSA (100x) none none
    Buffer 3 (10x)3 none
    Enzyme EcoRI (no.Lab:23)1,5 none
    Enzyme BglII (no.Lab:15)1,5 none
    H2O 18,2 none
    Total volume (e.g. 15,20,25,30 µl) 30 none
  • Incubation: 1,5 h
    • A 1% agarose gel was prepared for plasmid separation
    • Production of antibiotika-stock-solutions (10 x 1ml AMP)
    • Midi Prep of pAAV-Helper: concentration. 732,6 µg/µl
    Ligation of Oligos: RFC25 and pAAV-MCS.
    • dilution of our Oligos RFC from 138,3 µg/µl 1:10 13,83 (71bp long)=> 0,64µl
    • Vektor pAAV-MCS 23.3 µg/µl => 8,36µl
    • two plates are placed in the 37°C room
    • Trafo has been performed following standard protocols

    39.Labortag 23.06.2010: Preparation of Viral Stock, Seeding cells

    Design of Primer

    Achim, Hanna

    In order to sequence the hGH (polyadenylation) sequence and in general the GOI (gene of interest :) ) primer were designed: File:Primer GOI+polyA pAAV iGEM-MCS mVenus YFP.pdf
    These primer will be used in order to sequence P38 (pAAV_iGEM_mVenus-YFP) which delivered fluorescencing HT1080 cells - in comparison to the already sequenced P39 clone. Further on they can be used in general for sequencing any GOI.
    These oligos were ordered at sigma aldrich as E@sy Oligos.
    P38 was send for sequencing with GATC_std_pTESp-1 primer: 12 µL P39 (180 ng/µL) + 18 µL H2O

    Sequencing of pKEX-VP1

    Achim, Hanna, Adrian, Chris W.
    Primer:

    • VP1 primer for pKEX forward: V = 3 µL + 27 µL H2O
    • VP1 primer for pKEX reverse: V = 3 µL + 27 µL H2O

    Vector:

    • pKEX-VP1 (P27.2): c = 693 ng/µL, V = 3 µL + 27 µL H2O



    Thaw HT1080 and AAV-293 cells

    Achim, Hanna (guided by Sven)
    Thawing of HT1080 and AAV-293 cells was performed following this protocol: Media:Freiburg10 Thawing cells.pdf

    Picking clones of pAAV_RFC25 and inoculating 250 mL DYT with pAAV_iGEM_mVenus-YFP (P38) for Midi-Prep

    Achim, Chris W., Hanna
    Bacteria cultures are stored in 37°C room over night.

    Adrian, Sven

    Results of transduction, ~ 1% of the HT1080 showed expression of mVenus.

    Bright light image 1

    Fluoresce microscopy image 1

    Bright light image 1

    Fluoresce microscopy image 1


    Preparation of viral stocks

    Johannes, Bea Please fill in!!!
    Steril filtration of virus particles was performed (guided by Sven). Viral stocks are stored at -80°C.

    40.Labortag 24.06.2010: Labmeeting, Presentation/Update by Patrick and Adrian, Midi Prep of pAAV_iGEM_mVenus-YFP, Mini Prep pAAV_RFC25

    Delivery of:

    Proteinkinase K (will be used for the degradation of the viral capsid prior to qPCR)
    Benzonase (will be used fur viral stock preparation)
    Primer for for ITR-Conversion to iGEM-Standart



    Midi-Prep of pAAV_iGEM_mVenus-YFP


    Investigators: Hanna, Chris W (Adrian inserted RNAse and Ethanol into Buffers)

    • new kit from Qiagen was used
    • 35 ml of the over-night culture was filled into a 50 mL falcon and centrifuged at 5000 g at 4°C for 5 minutes.
    • supernatant was discarded
    • Midi-prep was performed according to manual of Qiagen
    • final concentrations: 380,4 µg/µl
    • Name of eppi: P44


    Mini Prep of P42 and P43 pAAV-RFC-25

    Investigator: Bea

    • Mini-Prep was performed following standard protocols
    • conc: P42: 321,5 µg/µl
    • conc: P43: 310,1 µg/µl


    ITR modification via PCR

    • Primers for ITR modification were resuspended and labeled: left forward: o24, left reverse: o25, right forward: o26, right reverse: o27

    Work on pKEX backbones

    Volker

    The sequencing data was evaluated and BLAST searches were carried out on NCBI to answer the question weather the sequence belongs to the backbone pKEX. This question could be answered positively.
    There are standard Primers from GATC that prime in the sequence. The three expression plasmids from PD Kleinschmidt will therefor be sequenced tomorrow.
    Additionnaly nine primers for sequences in the AAV Rep and Cap genes were disigned. '

    41.Labortag 25.06.2010: PCR of ITRs, Splitting HT1080 and AAV-293 cells, Seeding of HT1080 cells, Creating Virus Stock Economics, Medium check


    Preparation for PCR of ITRs

    Digestion of pAAV_MCS (P9)

  • experiment date: 25.06.2010
  • name of investigator: Bea
  • plasmid: name: pAAV_MCS number: P9 production date: 08.05.2010 origin: SH
  • buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:113) NgoMIV ; Enzyme 2 (no.Lab:120) AlwNI
  • DNA concentration (vector): 267,9 ng/µL
    In order to receive the best PCR-results, two digestion reactions/approaches have been performed.
    The first digestion was cut only with AlwNI, the second digestion was cut with AlwNI and NgomIV.

    components v(pAAV_MCS 1) /µl v(pAAV_MCS 2) /µl
    DNA 4 4
    BSA (100x) none none
    Buffer 4 (10x) 2 2
    Enzyme AlwNI (no.Lab: 120)1 1
    Enzyme NgoMIV (no.Lab:113) none 1
    H2O 13,0 12,0
    Total volume (e.g. 15,20,25,30 µl) 20 20


  • Incubation:1,5h
  • 1% agarose gel has been prepared. Running the gel at 110 V for 45 minutes.
  • Loading plan: Marker (8 µL), pAAV_MCS 1 (24 µL), paav_MCS 2 (24 µL)

    Splitting of HT1080 and AAV-293 cells, Seeding of HT1080 cells

    Investigator: Hanna

    HT1080:

    • Cells showed 80 % confluence
    • Cells were washed with PBS, detached with Trypsine
    • 10 mL DMEM was added, cell suspension was centrifuged for 5 minutes at 200 g.
    • Supernatant was discarded, pellet was resuspended with 8 mL DMEM.
    • Cells were counted: 47.5 µL Trypan blue (stains dead cells) and 2.5 µL cell suspension were mixed and applied onto a Neubauer counting chamber -> 2.2 x 20 x 10^-4 cells per mL
    • Therefore 27 µL of the cellsuspension was added to each 3 mL DMEM in the 6-well plates. -> 2 6-well plates were prepared for transduction!
    • Further on cells were splitted: 110 µL cell suspension was pipetted into 2 75T flasks each containing 20 mL DMEM and stored in the 37°C incubator.


    AAV-293 cells:

    • Cells showed ~ 50% confluence
    • Cells were splitted following the standard protocol.


    Creating Virus Stock Economics

    Investigators: Adrian

    Medium check

    Investigator: Adrian

    • three little culture bottles got prepared (H-DMEM, DMEM and PBS) and set into the incubator. In the following days they'll get checked for bacerial growth.

    Sequencing results of pAAV_RFC25

    investigators: Adrian, Bea, Hanna

    SpeI restriction site deletion in sequenced data (on bottom).


    sequenced sample: pAAV_RFC25 clone 2 (P43)

    used primer: GATC_std_pTeSp-1.ab1
    The alignment with the theoretical construct showed, that there's a exchange of one base in the RFC25-multiple cloning site. This substitution leads to the deletion of the SpeI restriction site.
    Therefore we checked the order sheet (everything OK!).
    We sent the second clone (P42) for sequencing (Hanna).

    • V(Plasmid) = 6.5 µL
    • V(H2O) = 23.5 µL
    • Primer: pTESP-1



    Annotation and studies of the AAV structure

    Investigator: Volker

    The NGR- and the HPSG motif were annotated in the gene sequences according to [Michelfelder & Trepe; 2009] The pdb sequence were visualized with the programm [http://www.pymol.org| PyMOL] and the important motifs were highlighted.

    Impressions from PyMOL

    thumb|left| The viral structure of AAV-2

    900px|thumb|left| Sturcture of a single AAV-2 VP2 monomer

    900px|thumb|left| B-Factor indicating mobility in the crystal

    900px|thumb|left| HPSG-binding-motif

    900px|thumb|left| Residues of the HPSG-binding-motif

    900px|thumb|left| The NGR-motif that is responsible for the integrin a5β1 binding



    42.Labortag 26.06.2010


    Transduction of HT1080 cells

    Investigator: Adrian

    • Transduction of 2x6 wells was successfully done (14.25)
    • one six well is transduced with 10µg the other with 30µg DNA amount (see HEK293 infection protokoll for further information)

    (A is up)

    stock solution 1:10 Dilution 1:50 Dilution
    1:100 Dilution 1:500 Dilution control (500µl DMEM)


    • the delution steps (1:10, 1:50, 1:100, 1:500) are placed upon the virus stocks in the -80°C freezer in 15 ml falcons.


    Did primers for sequencing GOI arrive?

    Paper reading session

    Investigators: Igor, Anna, Patrick, Stefan and Volker

    Several papers were read and infomation on cap-modifications were extracted.

    Proposed transitions Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F in red & R459D and N551D in green



































    43.Labortag 28.06.2010: Checking HT1080 for YFP-Expression, Creating plan: urgent things to do


    Checking HT1080 for YFP-Expression

    • Hannas 2*6 wells (24.6) transduced by (Adrian 25.6)

    Investigator: Sven, Patrick, Adrian

    Results of transduction nr.2

    10µg_unverd_2_(c1).JPG 48h post transduction

    10µg_unverd_1_(c1).JPG 48h post transduction

    30µg_unverd_2_(c1).JPG 48h post transduction

    30µg_unverd_(c1).JPG 48h post transduction

    30µg_unverd_4_(c1).JPG 48h post transduction

    30µg unverd 3 (c1).JPG 48h post transduction

    30µg_unverd_6_(c1).JPG 48h post transduction

    30µg_unverd_5_(c1).JPG 48h post transduction

    • The transduced cells will be checked again (29.6.).


    Sequencing results of P42

    Hanna
    Sequencing of pAAV_RFC25 (P42): Freiburg10 P42.jpg Sequencing delivered, that there weren't any base exchanges or deletions in this clone. Therefore P43 was dismissed (Plasmid and glycerol stock).

    Theoretical construction of our biobricks

    Theoretical cloning

    Investigators: Hanna, Adrian, Chris W, Patrick, Volker

    Urgent Things to do:

    • Modification CAP:
      • HSPG -> 2 AS
      • Targeting (585,588...) -> 2 AS -> 1 or 2 restriction sites?! Investigator: Volker
      • Seroprevalence -> 2 AS
      • thyrosine for ubiquitination Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F
      • Primer: start codons
      • EGF-Rezeptor: A431-Zellinie
        • Affibody: order the Gensequence
        • bispecific AK -> order Diabodys (are there any restriction sites?) Investigator: kristian???


    • Ordering the ITRs Investigator: Hanna
      • Stratagene: right and left
      • wild-type


    • Modification: REP Investigator: Volker
      • 3 restriction sites -> site directed mutagenisis vs. synthetic? ->order (check which is the cheaper approach)


    • HGH Investigator: Hanna
      • restriction sites? -> are there any available biobricks?
      • biobrick production


    • Beta-globin: what is the function? -> cut out?
      • where is the start and the end?
      • restriction sites?
      • biobrick production


    • GMK-TK
      • restriction sites: primer
      • biobrick production
      • ordering the SR39


    • tumor specific promotors
      • more Information!!!
      • telomerase specific promoters!!!


    Continuation of ITR PCR

    Hanna, Chris W., Adrian

    • Analytic gel was run: 1.7 µL loading dye (6x) was added to 8.3 µL of each sample (left ITR: 5 µL DMSO + 10 µL DMSO; right ITR: 5 µL DMSO + 10 µL DMSO).
    • 110 V, 35 minutes
    • No ITr bands were detectable - just 2 weak "primer-bands"

    Conclusion: PCR didn't work. Because of that new primers were designed and ordered (Achim), which are longer and posses therefore higher annealing temperatures.

    ITRs (theoretical)

    Adrian, Achim, Hanna

    • trs sequences (GTTGG) are present in both ITRs (Stratagene)!
    • assumption: transcription despite of ITR-secondary structure - no single-strand nick at trs-sequence in transduced cells ?


    44.Labortag 29.06.2010: Discussionround 3, Seeding HEK293 cells for transfection and titering

    DISCUSSIONROUND

    • Affibodys
      • Investigator: Anna
        • Affibodys are 6-7kD Proteins derived from Protein A/Z
        • they are binding to domain 3 from IGFR
        • 13 AS are replaceable for changing the tropism


    • Tyrosine Mutants
      • Investigator: Adrian
        • replacements are done in VP3! => Volker?!
        • no multi-mutants are available (instead of single mutations many Y->F)
        • best candidates are: Y730F and Y444F.


    • Second strand DNA-synthesis in Transduced cells
      • Investigator: Achim
        • Dual strand synthesis is the main limiting for transduction/transgen expression.


    Seeding HT-cells for transfection and titering

    Investigators: Sven, Adrian, Bea

    • The pellet was resolved in 4ml we had a 550.000 cells/ml
    • 2x6 well dishes got prepared:

    1. Plate I(A is up)

    3x10^5 cells 3x10^5 cells 3x10^5 cells
    3x10^5 cells 3x10^5 cells 3x10^5 cells


    2. Plate II (A is up)

    about 3x10^5 cells only mediumonly medium
    about 3x10^5 cells only mediumonly medium


    Seeding HT1080-cells for transduction and qPCR

    Hanna

    • Cell density was determined with trypan blue and counting chamber: 2 x 20 x 10^4 cells/mL
    • wanted: 5 x 10^4 cells --> 125 µL cell suspension per well
    • Cells were seeded into a 24-well-plate (row C and D!): 1.5 mL DMEM + 125 µL cell suspension per well
    • cells were incubated for 1 hour at 37°C


    Further on, cells were splitted: ~ 3 mL cell suspension was added to ~ 17 mL DMEM

    Transduction of HT1080 cells for qPCR

    Chris W.

    45.Labortag 30.06.2010: Titering Procedure via qPCR, Transduction of 6well plates nr.4, (Seeding HEK293 for Transfection?), further Gene-Order-Investigation

    Harvesting cells for qPCR

    Investigators: Chris W, Hanna
    Transduced HT1080 cells were harvested following Sven's standard protocol.


    Transduction of 2 x 6well plates nr.4

    Investigators: Bea, Adrian...

    • Master plan: Different Transduction Mechanisms
      • rise the amount of transduced particels, instead of 500µl, 1000µl of the AAV-stock getting pipetted into each well.
      • the second plate gets stimulated via UV-light to boost the expression of DNA-Repair mechanisms. This should enhance the second strand synthesis of our ssDNA-GOI => a rise of YFP Expression!

    1. Plate I(A is up)

    3x10^5 cells 3x10^5 cells 3x10^5 cells
    3x10^5 cells 3x10^5 cells 3x10^5 cells

    Transduction:

    1000 µl of Viral Stock DROPPED 1000 µl of Viral Stock gently resuspended1500 µl of Viral Stock hard resuspending
    1000 µl of Viral Stock DROPPED 1000 µl of Viral Stock gently resuspended no Transduction



    2. Plate II (A is up)

    about 3x10^5 cells only mediumonly medium
    about 3x10^5 cells only mediumonly medium


    Transduction:

    1500 µl of Viral Stock gently resuspended no Transductionno Transduction
    1500 µl of Viral Stock gently resuspended no Transductionno Transduction


    (Seeding HEK293 for Transfection?)

    Investigators: ...


    beta-globin intron

    Investigators: Adrian, Bea
    We found some interesting literature which point out that introns have an influence on the eucaryotic gene expression on DNA and RNA level. Next steps are going to be the designing of the beta-globin intron and maybe further analysis of the other mentioned introns. Maybe two or three more introns can be ordered.
    Media:Freiburg10_LeHir_et_al_How_introns_influence_and_enhance_eukaryotic_gene_expression_2003.pdf
    Media:Freiburg10_Noe_et_al_An_intron_is_required_dro_dihydrofolate_reductase_protein_stability_2008.pdf
    Media:Freiburg10_Mashadrizeh_et_al_A_systematic_study_of_the_function_of_the_human_beta-globin_introns_on_the_expression_of_the_human_coagulation_factor_in_cultured_Chinese_hamster_ovary_cells_2009.pdf‎



    hGH sequence

    Hanna

    • orientation in pAAV_MCS is reverse annotated... but in the same orientation as in human growth hormone I gene!
    • Blast and alignment with other expression vectors and the human growth hormone I revealed that Stratagene annotated 1 bp too much
    • "A common feature of mRNA in higher eukaryotes (but not in yeast) is the presence of the highly conserved sequence AAUAAA in the region from 11-30 nucleotides upstream of the site of poly(A) addition. (...) The signal is needed for both cleavage and polyadenylation." (Genes VIII, Lewin, P. 720)
    • good news: There're no iGEM restriction sites in the sequence (RFC25)
    • Conclusion: Instead of ordering the whole sequenc in iGEM standard it would be probably easier (and cheaper) to perform a PCR.
    • Done: Oligos were designed for PCR!


    ITRs: new strategy

    Hanna
    Plan:

    • Digest pAAV_MCS with AlwNI. Result: one large fragment containing the left ITR + a small fragment containing right ITR.
    • Digest both fragments with NotI and PstI.
    • Hybridize oligos containing RFC10 restriction sites (designed by Hanna), ligate them via intermediate steps (ligating into a vector) with ITRs . Comment: One oligo posseses a blunt end - therefore "intermediate step-vector" needs to be digested with an enzyme producing a blunt site.
    • Done: Oligos were designed. Need to be checked!


    Sequencing of pAAV_iGEM-mVenus-YFP

    Hanna, Chris W.

    • 3 µL of O28, 29 and 30 each were mixed with 27 µL water -> primer fpr sequencing of GOI and of hGH sequence
    • 11.1 µL plasmid + 18.9 µL H2O


    Investigation of the Kleinschmidt sequencing

    Investigator: Volker

    The CMV promoter sequence was found in front of the expression constructs of VP2 and VP3

    The sequencing of den unknown backbone pKEX revealed that the construct VP1ex from the DKFZ seemed not to contain a regulatory region for the expresion of the VP1 ORF, but in the backbonesequence there were some standard primers from GATC that could be used to sequence the insert of all expression constructs.

    This sequencing was done at the 26.06.2010. The read into the construct VP1 showed a long homologous region with the ORF of VP1 where as the sequencing of VP2ex and VP3ex did not show a homologous region with the ORFs of VP2 and VP3.

    The test weather primers of GATC bind to the unknown region gave a positive hit in both constructs with the primer GATC_std_CMV_f. This primer is specific for the sequence of the CMV promoter. After this indice the sequences VM_2 26.06. -pBR1.ab1 and VM_3 26.06. -pBR1.ab1 were aligned with the sequence of the CMV promoter provieded in the stratagene kit in the plasmid pAAV-MCS. The majority of the sequence fitted well with CMV promoter as indicated in the image in purple. At the 5' end of the CMV promoter there were some missmatches in the alignment indicated in yellow.

    The fact that VP2ex and VP3ex contained a CMV promoter element which was not included in VP1ex was unexpected. The sequencing with the standard primer GATC_std_CMV_f which binds at the 3' end of the CMV promoter and will probably sequence the ORF of VP2ex and VP3ex was ordered.

    • Retrieved from "http://2010.igem.org/Team:Freiburg_Bioware/testpage"