Revision as of 09:44, 28 July 2010

Quiescence

Rcd is a functional RNA that is part of the native plasmid stability mechanisms. [http://mic.sgmjournals.org/cgi/reprint/145/8/2135 Sharpe et al. 1999] describes the structure of different forms of Rcd. The best one to use for our intent is probably Rcd70, which is the shortest isolated form. [http://lim.fcien.edu.uy/tallerbm/pdf/2.%20Serganov%202007%20Nature%20Rev%20Gen.pdf Serganov and Patel 2007]

Rcd does not have a recognizable terminator, but still seems to terminate properly. The RNA is unusually stable with a half-life of ~70 to 90 minutes. One problem encountered in culturing commercial Q-cells is that it is very difficult to fully stop the expression of Rcd. Small amounts of Rcd in the cell can slow the cell cycle down, creating an evolutionary incentive to become resistant to Rcd. Thus, cells that have been grown with a repressed Rcd gene, will lose the capability to become quiescent over time.

A new approach to making a quiescence switch would be to control the functionality of the folded RNA instead of its transcription, which proved to be problematic.

Sequence for: Edited reverse Rcd complemement + ribozyme + Rcd: AgUcUgGuCuuCGCUuuuuCGCGUUCAacgCGAUCACccgAGCAGACAGGUucuAAUGGCAACAuug gACCCGucuAACUGgguCGAauuCGCCUcuuggagcugaugagccguucgcggcgaaaacuaAGCUUAUUGC UugguuacuccaagAGGCGCGAUCGCGGCAGUUUUUCGGGUGGUUUGUUGCCAUUUUUACCUGU CUGCUGCCGUGAUCGCGCUGAACGCGUUUUAGCGGUGCCUACAAU

According to mFold and CLC workbench, the sequence we designed folds into a non-functional form. The structure includes a hammerhead ribozyme domain that will hopefully cleave itself in vivo to release the functional Rcd RNA. This sequence does not include the aptamer yet. Ideally the bacteria would grow in the lab or a vat in the presence of a ligand but would stop growing without dying, as soon as the ligand is removed. Thus if your bacteria escaped into the wild they would stop growing very quickly as the ligand is diluted. The project would involve synthesising lots of different constructs (which are all mercifully short) and testing their functionality and sensitivity. The result would be a fairly short, but quite versatile BioBrick.

[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2713350/ Smolke et al. 2009] gives a nice review of aptamer activated hammerhead ribozymes and other functional RNA structures. More information on ribozymes (self- or trans-cleaving) can be found in [http://lim.fcien.edu.uy/tallerbm/pdf/2.%20Serganov%202007%20Nature%20Rev%20Gen.pdf Serganov and Patel 2007].

Using Rcd in the H-NS mutant to induce quiescence in E.coli is the Intellectual Property of Cambridge Microbial technologies. Dr Summers has been very supportive and we are going to continue the project. However, the legal issues have not been completely resolved yet. We still need to talk to Robert Hulme, the co-holder of the patent.

[http://www.bioinfo.rpiscrews.us/zukerm/rna/node3.html page summarising all RNA software]

@@ Line 1: / Line 1: @@
 {{:Team:Cambridge/Templates/header}}
 =Quiescence=
+Rcd is a functional RNA that is part of the native plasmid stability mechanisms. [http://mic.sgmjournals.org/cgi/reprint/145/8/2135 Sharpe et al. 1999] describes the structure of different forms of Rcd. The best one to use for our intent is probably Rcd70, which is the shortest isolated form. [http://lim.fcien.edu.uy/tallerbm/pdf/2.%20Serganov%202007%20Nature%20Rev%20Gen.pdf Serganov and Patel 2007]
+Rcd does not have a recognizable terminator, but still seems to terminate properly. The RNA is unusually stable with a half-life of ~70 to 90 minutes. One problem encountered in culturing commercial Q-cells is that it is very difficult to fully stop the expression of Rcd. Small amounts of Rcd in the cell can slow the cell cycle down, creating an evolutionary incentive to become resistant to Rcd. Thus, cells that have been grown with a repressed Rcd gene, will lose the capability to become quiescent over time.
+A new approach to making a quiescence switch would be to control the functionality of the folded RNA instead of its transcription, which proved to be problematic.
 Sequence for:
 Edited reverse Rcd complemement + ribozyme + Rcd:
@@ Line 8: / Line 15: @@
 CUGCUGCCGUGAUCGCGCUGAACGCGUUUUAGCGGUGCCUACAAU
-Using Rcd in the H-NS mutant to induce quiescence in E.coli is the Intellectual Property of Dr Summers, which we do not want to infringe. Unless we get green light from him when we talk to him in a couple of days, this project is on a hold.
+According to mFold and CLC workbench, [https://2010.igem.org/Team:Cambridgee/Quiescence/Sequences the sequence we designed] folds into a non-functional form. The structure includes a hammerhead ribozyme domain that will hopefully cleave itself in vivo to release the functional Rcd RNA. This sequence does not include the aptamer yet.
+Ideally the bacteria would grow in the lab or a vat in the presence of a ligand but would stop growing without dying, as soon as the ligand is removed. Thus if your bacteria escaped into the wild they would stop growing very quickly as the ligand is diluted.
+The project would involve synthesising lots of different constructs (which are all mercifully short) and testing their functionality and sensitivity. The result would be a fairly short, but quite versatile BioBrick.
+[http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2713350/ Smolke et al. 2009] gives a nice review of aptamer activated hammerhead ribozymes and other functional RNA structures. More information on ribozymes (self- or trans-cleaving) can be found in [http://lim.fcien.edu.uy/tallerbm/pdf/2.%20Serganov%202007%20Nature%20Rev%20Gen.pdf Serganov and Patel 2007].
+Using Rcd in the H-NS mutant to induce quiescence in E.coli is the Intellectual Property of Cambridge Microbial technologies. Dr Summers has been very supportive and we are going to continue the project. However, the legal issues have not been completely resolved yet. We still need to talk to Robert Hulme, the co-holder of the patent.
 [http://www.bioinfo.rpiscrews.us/zukerm/rna/node3.html page summarising all RNA software]