Team:ULB-Brussels/H2

From 2010.igem.org

Revision as of 23:48, 27 October 2010

•   Home  
•   Team  
•   Project  
•   Parts  
•   Modeling  
•   Notebook  
•   Safety  
•   Sponsors  

Introduction

Homologous recombination

E. coli naturally produces hydrogen through the mixed acid fermentation. Our goal in this part of the project is to increase  the H2 production by modifying the carbon flow through the pathways of the mixed acid fermentation (MAF). The pathways of this fermentation are quite simple. Phosphoenolpyruvate (PEP), which comes from the glucolysis, is transformed into pyruvate or into oxaloacetate. Those two molecules are then transformed into several products after a chain of reactions. Hydrogen is one of those products. It is produced from formate to regulate the intracellular pH of the bacteria [1].

Here is a simplified global overview of the mixed acid fermentation (see fig.1 below):

 Each reaction is controlled by one or several enzymes. By overexpressing or deleting specific genes involved in the MAF, we expect to increase the production of hydrogen. The pathway in which we are interested in is this one (see fig. 2 below):

        All the reactions crossing the red lines should be avoided or limited, and the three main reactions which lead to the production of hydrogen should be increased.
The hydrogen is produce from formate by the formate hydrogenase lyase system (FHL), an intracellular membrane-bound complex composed of the formate dehydrogenase (FDHH) and the hydrogenase 3 [1]. This complex catalyzes the reaction:
Formate + H+ <=> H2 + CO2
Hydrogen is not excreted outside the bacteria but it is immediately consumed by two uptake hydrogenases, the hydrogenase 1 and 2 following this reaction [1][2]:
A menaquinone + H2 + 2H+ <=> A menaquinol + 2H+
The FHL system is activated by FhlA (formate hydrogen-lyase transcriptional activator), which is regulated by FNR and repressed by HycA [1]. FNR is the main transcriptional regulator that mediates the transition between aerobic and anaerobic growth through the regulations of hundreds of genes [2]. All the regulations linked to the transformation of formate into hydrogen are shown here (see fig.3 below):

Genes to delete

Several reactions in the MAF are irrelevant to hydrogen production (see figure 2 above). To disable these reactions we have to delete the genes which code for the enzymes catalyzing those reactions.
We studied a lot of articles about producing H2 through the MAF. Based on that, we decided which genes we would overexpress and which we would disrupt.
Here is the list of all the genes that we planned to delete. By using the KEIO Collection database, we checked that none of those genes were essential to the bacteria [4].

1. PPC

The gene ppc codes for the phosphoenolpyruvate carboxylase (Ppc). This enzyme catalyzes the reaction [2]:
Phosphoenolpyruvate + CO2 + H2O <=> Oxaloacetate + Phosphate + H+
Deleting ppc will therefore prevent the PEP being transformed into oxaloacetate which is not interesting for us. As shown on figures 1 and 2, the left wing of the mixed acid fermentation does not lead to hydrogen production. This wing starts with the transformation of PEP into oxaloacetate. The deletion of ppc will therefore disable this pathway and all the PEP will be transformed into pyruvate.

• LdhA

Pyruvate is transformed into (R)-lactate or into formate + acetyl-CoA but only this second reaction is interesting for us. We must therefore disable the first one. LdhA is the gene coding for the D-lactate dehydrogenase which catalyze the following reaction:
NADH + Pyruvate + H+ <=> NAD+ + (R)-lactate
Deleting ldha should ensure that all the pyruvate should be transformed into formate + acetyl-CoA.

• FocA

FocA codes for a formate transporter of the plasmic membrane which excreted formate outside the cell. It has been shown that disabling this transporter increase the intracellular concentration of formate [5]. Higher formate concentration inside the cell is obviously interesting for hydrogen production.

• HyaB

To prevent hydrogen uptake by the two hydrogenases, HyaB and HybC, we have to disable them. Both hydrogenases are coded by an operon. The HyaB operon is composed of 6 genes (from HyaA to HyaF), hyaB coding for the largest subunit of the hydrogenase [2]. This subunit is required for the hydrogenase to be functional [2]. Deleting this subunit should disable the hydrogenase 1 [1].

• HybC

The second hydrogenase is coded by an operon of 7 genes (from HybA to HybG), HybC coding for the largest subunit of the second hydrogenase. As for HyaB, deleting the largest subunit of the hydrogenase should disable it [1].

Materials and methods

In order to delete the five genes listed above, we used a method based on the λ phage Red recombinase (see chapter X). It consists in producing a gene-specific PCR fragments, containing an antibiotic resistance gene. The targeted gene is replaced by the resistance gene through homologous recombination performed by the Red recombinase system, and finally the resistance is removed.All the primers used for the deletions of the 5 genes are listed in Table 1 at the end of this chapter.
Both chloramphenicol and kanamicine resistance cassette already contain the FRT sequence required to remove the resistance after a successful deletion (see chapter X about the homologous recombination)
The antibiotic resistance will help us to select the bacteria in which the targeted gene has been successfully disrupted. To delete a gene, we simply had to electroporate the cells with the PCR product   and then spread them on a selective medium containing the appropriate antiobiotic. In order to achieve the deletion by homologous recombination, the cells must be transformed with the plasmid helper λ (PH λ). We had to streak three times the deletion candidates on agar plate with the appropriate antibiotic, in order to purify their genome. A bacteria has numerous copies of each of its genes. The streaking process on a selective medium has for objective to eliminate the wild type version of the surnumerous chromosomes. After this process, we tested our deletion candidate by PCR. We amplified the area of the deletion and by measuring the obtained sequence (by electrophoresis), we were able to verify if the expected deletion has happened or not. If the sequence amplified has the length of the wild type, the deletion failed, but if the sequence has the length of the resistance cassette, the gene has been successfully deleted.
The next step is to remove the resistance cassette using the flippase recombination enzyme (see chapter X about homologous recombination). The flippase will recognize the FRT (flippase recognition target) sequence placed at each ends of the resistance cassette and will delete what is in between the two FRT sequences. Once the cassette has been removed, we a single deletion mutant. We can start the deletion process from the start for another gene to obtain a two deletion mutant.
To avoid losing too much time, we proceeded to the different deletions in parallel. The single gene mutations in the different resulting strains were then combined using P1 transduction. That is the reason why we used two different resistance cassettes (chloramphenicol and kanamicine). Once we have two different strains of bacteria, each with one gene deleted and the resistance cassette still in place, we can combined them using P1 transduction. Two different resistance cassettes are needed in order to select the two deletion mutant on a selective medium. The selective medium contains the two antibiotics.

Results

In the laboratory, we only managed to obtain a three deletion mutant. The construction of the resistance cassettes for each gene by PCR took us a little more than a week. Because of the size of the primers used, we had to try several times those PCR. Once we had our resistance cassettes, it took us about 1 month to obtain our first deletion candidate. The process of electroporation for deletions is not really efficient. We obtained a lot of deletion candidate (i.e. we obtained a lot of bacteria which grew on the selective medium). As explained in the materials and methods part, we had to streak three times each candidate (this process takes therefore 3 days). Unfortunately the candidates often were negative: we assumed that the resistance cassette was inserted at a wrong space in the genome, giving the bacteria the resistance but without deleting the aimed gene. Once we had two different strains, each one with a different resistance cassette for a different deleted gene, we were able to start the transduction process. By the time we finally had our three deletion mutant; it was too late for a measurement campaign.

Genes to overexpress

In order to enhance hydrogen production, we decided to over-express some genes involved in the hydrogen production. In the mixed acid fermentation, there are three reactions which interest us:

• The transformation of phosphoenolpyruvate into pyruvate:

Phosphoenolpyruvate + ADP + 2H+ <=> Pyruvate + ATP
This reaction happens in other pathways, so we decided not to improve it assuming it won't be the limiting reaction.

• The transformation of pyruvate into formate:

Pyruvate + Coenzyme A <=> Formate + Acetyl-CoA
This reaction is catalyzed by two pyruvate formate lyase: pflB and tdcE. The formate is the key molecule for hydrogen production and high levels of formate concentration inside the cell are needed for hydrogen production [6].

• The transformation of formate into hydrogen:

Formate + H+ <=> CO2 + H2
This reaction is under the control of the FHL complex (formate hydrogenase lyase). As explained earlier, the FHL complex is regulated by FNR, a transcriptional regulator that mediates the transition between aerobic and anaerobic growth, and repressed by HyaC. In studies, we find that the activity of the FHL complex is not the limiting process for hydrogen production. We, therefore, choosed not to over-express the two enzymes of the FHL complex: the formate dehydrogenase (FDHH) and the hydrogenase 3[2].
On the basis of those three reactions, we decided to overexpress the following genes:

• FNR

        FNR is quite an obvious choice for the first gene to overexpress. FNR is the main transcriptional regulator that mediates the transition from aerobic to anaerobic growth [2]. The concentration of the protein FNR is the same under aerobic and anaerobic conditions, but in presence of O2 the protein FNR is inactivated. Under anaerobic conditions, the protein became functional and activates hundreds of genes involved in anaerobic metabolism. FNR also represses genes involved in aerobic metabolism [2]. Over-expressing the gene FNR should increase the concentration level of the protein FNR and should thus enhance all the anaerobic metabolism of the bacteria. The three reactions of the mixed acid fermentation leading to hydrogen will therefore be increased.

• PflB

        PflB codes for one of the two pyruvate formate lyases which catalyze the transformation of pyruvate into formate [2]. This reaction is the most important one for hydrogen production. Overexpressing PflB should assure sufficient concentration levels of formate inside the cell for hydrogen production. The pyruvate is also used in many other reactions, but we want the maximum of pyruvate to be used for hydrogen production.

• TdcE

        TdcE codes for the second pyruvate formate lyase [2]. The reasons to overexpress this gene are the same as for PflB.

Materials and methods

To over-express those three genes, we decide to insert them into to plasmid pSB1C3 with a strong RBS, a constitutive promoter and a terminator. First of all, we had to obtain the three genes in order to link them with the RBS, the promoter and the terminator. We decided to work in the BioBrick standard assembly 10 because the plasmid pSB1C3 is only compatible with this one. Unfortunately, FNR is cut by EcoR1, and cannot be used without modifying its sequence. We introduce a silent mutation in the restriction site of EcoR1 and we ordered our modified gene of FNR on mrgene.com. TdcE was obtained by PCR using primers of the gene on the wild type genome of E. coli. PflB is also cut by a restriction enzyme of the standard assembly 10: Pst1. We could have also introduced a silent mutation in this gene and order it on mrgene.com, but due to the length of Pflb (2283 bp) and our limited budget, we were not able to afford it.
The RBS, the promoter and the terminator chosen are the strongest ones received in spring 2010 distribution.
The promoter is: BBa_J23100
The RBS is: BBa_B0034
The terminator is: BBa_B0024
When we had the genes, we linked them to the RBS by digesting the plasmid of the RBS using the enzyme Spe1 and Pst1 (in order to open the plasmid behind the RBS sequence). The genes were digested by Xba1 and Pst1. Then we linked the two parts together using ligation enzymes. We started this process again to insert the part RBS+gene with the promoter. The next step consists in extracting the construction promoter+RBS+gene and inserting it in front of the terminator. Finally, we have to extract the construction promoter+RBS+gene+terminator and insert it into the pSB1C3.
Unfortunately, we did not have had the time the complete the all process. We only managed to link the gene to the RBS.

Other genes considered

Several other genes are involved in the MAF and are potential candidates for modifications (deletion or overexpression). We listed below all the other genes considered for modification:

• HycA

        This gene codes for HycA, a regulator of the hydrogenase 3 in the FHL system [2]. The regulator limits the amount of hydrogenase 3 in the cell. Deleting HycA should therefore lead to an increase of the concentration of hydrogenase 3. And as explained in the beginning of this chapter, the hydrogenase 3 catalyzes the transformation of formate into hydrogen. But a study about the hydrogenase 3 has shown that, the transformation of formate into hydrogen is not the limiting step for hydrogen production and that normal concentration of hydrogenase 3 is fully adequate [3]. We decided not to delete this gene based on that information on to focus on the limiting steps of hydrogen production.

• AceE

        This gene codes for a subunit of the pyruvate dehydrogenase complex. This complex catalyzes the following reaction [2]:
Pyruvate + NAD+ + coenzyme A <=> Acetyl-CoA + CO2 + NADH
Or what we want for hydrogen production is the transformation of pyruvate into formate. Unfortunately, AceE catalyzes other reactions, and deleting it reduces the survivability and the growth rate of E. coli [1]. We therefore decided not to delete this gene. This decision led us to focus on the transformation of pyruvate into formate. That's another reason why we decided to overexpress the gene TdcE (see above).

• PoxB

        PoxB is coding for a pyruvate oxydase, which catalyze the transformation of pyruvate into acetate and CO2 [1]. This reaction consumes pyruvate which is the opposite of what we want. We could have deleted poxB but we did not because the transformation of pyruvate into acetate and CO2 is a very slow reaction [2]. The pyruvate oxydase pathway is even less important under anaerobic conditions [2]. We also found, in a study, that deleting poxB did not increased hydrogen production [1].

• FocB

        FocB codes for another formate transporter (the other formate transporter is focA, see above). Unlike focA, focB is less efficient and less specific to formate. We could have deleted focB aswell but deleting the two formate transporter would have reduced the growth rate of our bacteria [1]. We, therefore, decided not to delete focB.

• FdoG and fdnG

        FdoG codes for formate dehydrogenase-O and fdnG for the formate dehydrogenase-N. Those two formate dehydrogenase catalyze the transformation of formate into CO2 + H+. The formate dehydrogenase-O does it in presence of oxygen, in other words: under aerobic conditions. We can therefore avoid deleting fdoG simply because our bacteria will be used under anaerobic conditions. The formate dehydrogenase-N needs a source of nitrate to be active. In the laboratory, it is easy to work on medium which do not contain nitrogen and we can avoid deleting this gene. In reality, in a sewage treatment, this is much more problematic. But we can imagine that our bacteria will be used to produce hydrogen after the step of nitrogen removal. Deleting fdnG is necessary if we want to produce hydrogen in a medium which contain nitrogen. Especially when we know that the formate dehydrogenase-N is a much more effective enzyme than the FHL system. Most of the formate will thus consume by the formate dehydrogenase-N instead of being transformed into hydrogen.

Table 1

All the sequences are listed in the directionality 5' -> 3'.
PPC
H1R1: ACCCTCGCGCAAAAGCACGAGGGTTTGCAGAAGAGGAAGAGTGTAGGCTGGAGCTGCTTC
H2R2: ACAGGGCTATCAAACGATAAGATGGGGTGTCTGGGGTAATCATATGAATATCCTCCTTA
LdhA
H1R1: ATCTGAATCAGCTCCCCTGGAATGCAGGGGAGCGGCAAGAGTGTAGGCTGGAGCTGCTTC
H2R2: AGTAGCTTAAATGTGATTCAACATCACTGGAGAAAGTCTTCATATGAATATCCTCCTTA
FocA
For FocA, we didn't try to delete the entire gene because FocA is located next to pflB (one of the genes useful for hydrogen production, see above). The RBS and the promoter of pflB are included into the sequence of FocA. We decided to remove only the half of FocA, leaving the RBS and promoter of pflB untouched.
H1R1: GCTGCGGCCAGAATAACTCATCCATACTGCCAGACATACCGTGTAGGCTGGAGCTGCTTC
H2R2: GTTAGTATCTCGTCGCCGACTTAATAAAGAGAGAGTTAGTCATATGAATATCCTCCTTA
HyaB
H1R1: CAGAAACCGAACATCAGCCAGGCAATGAGGATAAACAGGCGTGTAGGCTGGAGCTGCTTC
H2R2: CGTTGTCGCTTTTCTGTTGCATGATGATTCTCCTTCGCTGCATATGAATATCCTCCTTA
HybC
H1R1: GTCAGCAAAATATTGCCGACCCCTAAGACTAAAATACGCAGTGTAGGCTGGAGCTGCTTC
H2R2: TAAAACAAAACGATCATAATCGTCATGAGGCGAGCAAAGCCATATGAATATCCTCCTTA

References

[1] Maeda, T.; Sanchez-Torres, V.; K. Wood, Thomas. - Enhanced hydrogen production from glucose by metabolically engineered Escherichia coli - Appl Microbiol Biotechnol (2007) 77:879–890 – September 2007.
[2] The database Ecocyc for the bacterium Escherichia coli K-12 MG1655, consulted online in July, August and September 2010: http://ecocyc.org/
[3] Node, K.; Watanabe, M.; Makimoto, H.; Tomiyama, M. - Effect of hydrogenase 3 over-expression and disruption of nitrate reductase on fermamentive hydrogen production in Escherichia coli

[4] The KEIO Collection consulted online in July, August and September 2010: http://ecoli.naist.jp/gb6/Resources/deletion/deletion.html

[5] Suppmann, B.; Sawers, G. - Isolation and characterization of hypophosphite--resistant mutants of Escherichia coli: identification of the FocA protein, encoded by the pfl operon, as a putative formate transporter - Lehrstuhl für Mikrobiologie der Universität München, Germany. - Mol Microbiol. 1994 Mar;11(5):965-982. – March 1994.

[6] Sawers, R.G. - Formate and its role in hydrogen production in Escherichia coli - Biochemical Society Transactions (2005) Volume 33, part 1 – Pages 42-46 – September 2004.

Introduction

Homologous recombination