Team:Freiburg Bioware/NoteBook/Labjournal/July

=> Back to Notebook overview

Juli

46.Labortag 01.07.2010

qPCR

Investigators: Hanna, Chris W. (guided by Sven)

Protocol will be inserted :)

Thawing HT1080 cells

Investigators: Adrian, Bea, Patrick

• HT1080 cells were thawed following standard protocols
• HT1080 passage 3
• Incubation at 37°C

Investigation of the Kleinschmidt sequencing

Investigator: Volker

The sequence data from VM_2_30.06.-CMV-F and VM_3_30.06.-CMV-F arrived and showed as expected a homologous region with the ORFs of the corresponding VPs.

The process of VPex1, VPex2 and VPex3 sequencing is nearly finished. For further progress the oligos that prime at different locations in the Rap/Cap ORFs are required. The actual progress of the sequencing is shown in the image on the right side:

• For the sequencing of VPex1 and VPex2 one further read will be required to achieve a continuous contig.
• The sequencing of VPex3 is completed but contains two point mutations.

The investigation of the point mutations revealed that the:

• first mutation (TAC=>TAT) is silent and codes for Tyrosine. The original codon TAC has a codon usage of 58% in Homo sapiens and 25% in E. coli where as the new codon TAT has a codon usage of 42% in H. sapiens and 75% in E. coli. There for this mutation could be an optimisation of the sequence for an approach to express the VP in E.coli.
• second mutation (CCG=>CCA) is silent and codes for Proline. The original codon CCG has a codon usage of 11% in H. sapiens and 77% in E.coli weher as the new codon CCA has a codon usage of 27% in H. sapiens and 15%. This mutation would lead to an optimiced expression in human cells.

Therefor the combination of these two "optimized" codon does not make any sense in this combination.

47.Labortag 02.07.2010

Fluoroscence Pictures of Transduction 3

Investigators: Chris W, Patrick

total celldeath!
Looks like we should not transduce 3x10^5 cells with 1000 µl (or more) of our viral solution because almost all cells died in all approaches and the medium indicator was yellow. So we can not say if resuspendig the cells with the viral soultion is a useful alteration of the standart protocol.

@Chris and Patrick: The cells which has not been resuspended died aswell?? yes (Patrick) ... so u think the volume (1000µL) of the viral stock solution is too high and cell death is not caused by the "rough" reuspension? yes (Patrick) ... Could u maybe upload some pictures even though it did not work, but to documentate it properly!! thx Bea ... No, already thrown away and we could not take good pictures because of very thick bunches of dead cells, results confirmed by Sven (Patrick)

Media:Freiburg10 Massacre.jpg

Seeding and Splitting HEK

Investigators: Johannes, Kira, Patrick, Chris W

• 4 Petri dishes (each 10ml DMEM, 1,5*10^6 cells) and one 75 cell culture bottle (20ml DMEM, 1,5*10^6 cells). The cell density was not sufficient so we could not seed 3x10^6 in the 10 cm dishes as planed initially.
• New DMEM Medium was made (10% FCS,). We received a Sodium-Pyruvat stock solution (100x).

New ologos/primers arrived

Investigator: Patrick

ST00147058: long pITR right for, labeled with number 31
ST00147059: long pITR right rev, labeled with number 32
ST00147606: long pITR left for, labeled with number 33
ST00147061: long pITR lef rev, labeled with number 34

An additional 1:10 working dilution was made with each oligo.

@ Achim: plz write it down into our oligo excel sheet.

Annotation of the 453 insertion site

The integration site between G453 and T454

Investigators: Patrick & Volker

The 453 insertion site is acoording to [Boucas et al., 2009] a promising alternative to the 585/588 integration site. The Peptides were integrated between the 453 Glycine and the 454 Threonine. This risidues were annotated in the gene maps (Genious) and visualized in the 3D structure (PyMOL).

Searching new restriction sites in the 585/588 WT loop

Investigator: Volker

The sequence of the major site for peptide integration into the capsid proteins was extracted from the viral sequence and pasted into the program DNA 2.0. In an first atempt the 4 amino acids that form the loop (5' - RGNR - 3') were used with the two flanking amino acids from the wild type sequence on each side. The goal of this theoretical investigation is to use alternative codons to insert restriction sites into the wild type loop to make later cloning easier. This was repeated in an second atempt with five flanking amino acids but did not reveal additional useful restriction sites.

Informations for the restriction enzymes were looked up in the [http://www.neb.com/nebecomm/products/category1.asp?#2 NEB Product catalogue].

Search for restriction sites in the 585/588 WT loop sequence

The three restriction sites are:

BbvI restriction site: Recognized sequence:
5'- GCAGC(N)8^ -3'
3'- CGTCG(N)12^ -3'
Sites found in pAAV_RC at position:

• 17 times in the ORFs of Rep & Cap => can't be used

BstEII restriction site: Recognized sequence:
5'- G^GTNACC -3'
3'- CCANTG^G -5'

• There is only one BstEII restriction site in the vector that we want to use to insert the fragment (x-x)
• The cutting site could be removed => theoretically useful restriction site.
• Location fits nearly perfect because peptids ae usually integrated before the R585.

PstI restriction site Recognized sequence:
5'- CTGC^AG -3'
3'- G^ACGTC -5'

• PStI is part of the iGEM standard and can't be used for this purpose.

Searching new restriction sites in the 585/588 KO loop

Search for restriction sites in the 585/588 KO loop sequence

Investigator: Volker

PstI restriction site Recognized sequence:
5'- CTGC^AG -3'
3'- G^ACGTC -5'

• PStI is part of the iGEM standard and can't be used for this purpose.

Summary: There is no codon combination availible to encode the promising BstEII restriction site in this R585A_R588A_KO sequence.

Searching new restriction sites in the 453 loop

Search for restriction sites in the 453 loop sequence

Investigator: Volker

KpnI restriction site Recognized sequence:
5'- GGTAC^C -3'
3'- C^CATGG -5'
Sites found in pAAV_RC at position:

• 1721 and 3973
• first restriction site could be replace without problem becauce it lies in the region that will be synthesized to replace the three iGEM restriction sites in the Rep ORF.
• Restriction site is potentially useful

AvaI restriction site Recognized sequence:
5'- C^YCGRG -3'
3'- GRGCY^C -5'
Sites found in pAAV_RC at position:

• six times in the ORFs of Rep and Cap => can't be used

DraIII restriction site Recognized sequence:
5'- TTT^AAA -3'
3'- AAA^TTT -5'
Sites found in pAAV_RC at position:

• 1181 (Rep ORF)
• 2893 (Cap ORF)
• 4463 (short after the Cap ORF)
• 4930 (f1 ORI)

AvaII restriction site Recognized sequence:
5'- G^GWCC -3'
3'- CCWG^G -5'
Sites found in pAAV_RC at position:

• eight times in the ORFs of Rep and Cap => can't be used

Summary: The KpnI restriction site seems to be a good possibility to make the 453 insertion site ready for easy integration of peptides.
Especially the position where the cut is performed is ideal for our purpose because peptides are usually integrated after the Glycine 453 as described for example in [Boucas et al.; 2009].

48.Labortag 03.07.2010

Planing the gene synthesis to replace the three restriction sites in the rep ORF

Investigator: Volker

The construct pAAV_RC that we have bougth from Stratagene will be a central part of our Virus construction kit and therefor it has to be cleared from restriction sites that are used in the iGEM-standard.
There are five iGEM restriction sites in the pAAV-RC:

• PstI at position (310)
• EcoRI at position (1578)
• PstI at position (1773)
• EcoRI at position (1796)
• PstI at position (4073)

The relative location to each other and other planed modifications in this sequence make it reasonable to replace the PstI (310) and PStI (4073) with site directed mutagenesis and to order a synthesis of the region with the three other restriction sites.

The primers for the site directed mutagenesis were designed:

Designed Primer: SDM PstI (310)

• PstI at position (310)
  
  • Recognized sequence: 5'- CTGC^AG -3'
    
  • The codon 5'- CTG - 3' will be replaced by 5'- CTC -3'
    
  • Both codons encode Leucine. The condon usage in H. sapiens decreases from 36% to 20%
    

5'- CTGACCGTGGCCGAGAAGCTCCAGCGCGACTTTCTGACGGA - 3'

Designed Primer: SDM PstI (4073)

• • Recognized sequence: 5'- CTGC^AG -3'
    
  • The codon 5'- CTG - 3' will be replaced by 5'- CTC -3'
    
  • Both codons encode Leucine. The condon usage in H. sapiens decreases from 36% to 20%
    

5'- CGTGGAGATCGAGTGGGAGCTCCAGAAGGAAAACAGCAAACGCTGG -3'

Restriction sites of the RFC25 standard located in the Rep ORF shown in dark blue and single cuting restriction endunucleases shown in light blue

The region with the three restriction sites that are located near to each other is show in the picture above. The restriction sites indicated in light blue are single cutters and can therefor be use to clone the synthesized fragment into the original sequence of pAAV-RC.
For this purpose the restriction sites BstBI (1435) and SwaI (2004) will be used because they are availible in the lab stock and have 100% fidelity in one of the NEB buffers.
The required construct with four flanking base pairs on each side will be 583 bp long.

• EcoRI at position (1578)
  
  • Recognized sequence: 5'- G^AATTC -3'
    
  • The codon 5'- GAA -3' will be replaced by 5'- GAG -3'
    
  • Both codons encode Glutamic acid. The codon usage in H.sapiens increases from 41% to 59%.
    

• PstI at position (1773)
  
  • Recognized sequence: 5'- CTGC^AG -3'
    
  • The codon 5'- TGC - 3' will be replaced by 5'- TGT -3'
    
  • Both codons encode Cysteine. The condon usage in H. sapiens decreases from 58% to 42%
    

• EcoRI at position (1796)
  • Recognized sequence: 5'- G^AATTC -3'
    
  • The codon 5'- AAT -3' will be replaced by 5'- AAC -3'
    
  • Both codons encode for Asparagine. The codon usage in H. sapiens increases from 44% to 56%.
    

This are all the restriction sites in the ORFs for the Rep and Cap proteins. In the backbone of the pAAV_RC there are more restriction sites in the iGEM standard. These restriction sites should not cause any problems when the insert in cloned into a standard iGEM vector. An other interesting question is what has been changed in the regulatory region p5. This will be important to determine the sequence that is required for the functional expression of the pAAV-RC.

Modification of the Cap genes

Investigator: Volker

The HSPG-binding-motif can be knocked out by the two mutations R585A and R588A.

The sequence 5'-CTC CAG AGA GGC AAC AGA CAA -3' codes in the pAAV-RC construct for the amino acids LQRGNRQ.
In order to achieve the recommanded mutation the sequence has to be changed to: 5'-CTC CAG GCT GGC AAC GCT CAA -3'
which codes for LQAGNAQ.

The problem is that in this R585A R588A KO version there is no possible codon usage to encode a BstEII restriction site that would make it possible to integrate peptides in an easy fashion.
An R585A R588L KO version would contain the BstEII restriction site and could be a possible alternative to the R585A R588A KO version.

Questions to adress on monday:

• Is the proposed R585A_R588L_KO mutation possible?
• Are iGEM standard vectors availible that do not contain KpnI and BstEII?

Cellculture

Investigators: Patrick, Chris W.

HT1080 cells were split. Deviations from the standart protocol: The cells were centrifuged with 2000 G instead of 200 G. Then the cells were put into the incubator for 4 hours and then examined again. It seems that most of them survived this mistake.

The 293 cells were checked for cell density. They will be >70% confluent tomorrow and therefore transfected.

49.Labortag 04.07.2010:

Transfection nr.3

Investigators: Chris W, Patrick
Transfection with P41 was performed according standart protocol. Two transfektions where carried out with 10µg (3,33 µg each plasmid) DNA and the other two with 20µg DNA (6,66 µg each plasmid).

50.Labortag 05.07.2010:

Sequencing of pAAV_iGEM-mVenus-YFP

Investigator: Hanna
Alignment of sequenced hGH region with pAAV_iGEM_mVenus-YFP delivered following picture:

There seemed to be a nucleotide insertion. But by having a closer look, we recognized that Geneious mis-interpreted the signal at this point. Further on we could validate that YFP was also successfully cloned into this clone. Unfortunately the sequencing of the gene of interest didn't work - neither with the forward, nor with the reverse primer. Their sequences were checked on the order form: Everything OK!
To do: Repeat sequencing of GOI!

Dirty and fancy method for ITR BioBrick production

Investigator: Hanna
A new strategy for ITR BioBrick production was figured out. This method does NOT require any PCR steps! :)
We want to take advantage of the fact, that the ITRs are flanked by NotI and PstI.
"Short version" of the strategy:

• Digestion of pAAV_MCS with AlwNI. Result: one large fragment (2982 bp) with right ITR; one small fragment (1674 bp) with left ITR.
• Separate fragments via gel run.
• Digest them with NotI and PstI.
• Präfix and suffix oligos were designed. They need to be hybridized and ligated to the left and right ITR with several intermediate steps (subcloning into pSB1C3 etc.). The oligos posess compatible overhangs to the PstI and NotI restriction sites of the ITR but do not generate new restriction sites after ligation!
• For detailed instruction, check up here: File:Freiburg10 ITRBioBrick dirty fancy.pdf

Beta-globin BioBrick production

Investigator: Hanna
The beta-globin sequence (pAAV_MCS) contains no iGEM-restriction sites. Therefore we decided NOT to order the sequence, but to perform a PCR with RFC10 overhang primers:

hGH BioBrick production

Investigator: Hanna
The hGH sequence (pAAV_MCS) contains no iGEM-restriction sites. Therefore we decided NOT to order the sequence, but to perform a PCR with RFC10 overhang primers:

Splitting HT and HEK cells

• Investigators: Adrian, Bea
• HEK Cells: over 100% confluent!!!
• HT-cells: over 90% confluent!!!

Preparation of HT1080 3x6er dishes for Transduction

• Investigators: Adrian, Bea
• 3x 6well dishes got prepared with 3ml DMEM and 300.000 cells (0,0375ml of our Cell-falcon)
• Transduction on 6.7.2010

Preparation of 6x10cm petri dishes HEK293

• Investigator: Adrian
• 6x 10cm petri dishes with 10ml with 3.000.000 cells (0,344ml of cell-falcon)
• Transfection on 7.7.2010

Repetition of ITR restriction site modification via PCR

Investigator: Achim, Chris

No bands were observed on the gel -> pcr didn't work.
Possible reasons: *Old Vent polymerase -> New polymerase ordered

• Mg concentration could be optimized
• Template okay? Template will be loaded on gel as well next time

Search for restriction sites in the sequence LQA/RGQA/RQA

Investigator: Volker

The idea to use a R588L mutation instead of the R588A that is published in the literature was discussed with the supervisers. It was proposed to search for other amino acid exchanges that alter the loop less drastically. For this reason the mutation N587Q was examined for possible restriction sites.

Search for restriction sites in the 585/588 KO loop sequence

 :)

Results sequencing alignment of GMK_TK30

Investigator: Bea

Result: The obtained sequencing results indicate that the DNA we received from Amor contains the GMK_TK30 fusion enzyme, but tk30 contains some restriction sites.

Sequence alignment of GMK_TK30

Sequence alignment of GMK_TK30

Sequence alignment of GMK_TK30

Sequence alignment of GMK_TK30

• To do (06.07.2010): Order primers for BioBrick Fusionenzyme and order genes of GMK and TK (wtTK, TK30, sr39????)
• remove iGEM restriction sites

51.Labortag 6.07.2010:

Harvesting AAVs from 4 10cm dishes, Transduction of 3x6er dishes

Investigators: Adrian, Anna, Bea, Kerstin

We want to investigate which of the following approaches yields a better transduction efficiency.

• Half of the transfected cells were exposed 3 cycles of thawing and freezing and then centrifuged (15 ml falcon, 2100G). The supernatant was transfered into a new 15 ml falcon and used for transduction.
• The other half was centrifuged at 300 G for 5min . The supernatant was transfered into another 15 ml falcon and the pellet was resuspended with 5 ml of DMEM. The content of these two falcons was also exposed to 3 cycles of thawing and freezing and then used for transduction.

• We have got 2 10 cm cellculture dishes with 10µg and 2 dishes with 20µg DNA used for transfection.

Approach with standart protocol (one dish with 10 and the other with 20µg Plasmids)(2100 G and 3 cycles of freezing and thawing)

Deviations from the standart protocol:

• The cells were centrifuged at 2100 G instead of 10.000 G
• The viruses were harvested after 44 hours
• 3 cycles of freezing and thawing

Search for restriction sites before and after the insertion sites 453 and 585/588

Investigator: Volker

Transduction of 3x6er dishes

Investigators: Adrian Bea

• used plasmids: 10µg, 20µg YFP
• we have 10µg and 20µg from standard protocol => SV
• we have 10µg and 20µg from standard protocol pellet => Pellet
• we have 10µg and 20µg from standard protocol suspension => Super
• amount of 500µl

1. Plate I(A is up)

10µg dropped Super	10µg dropped Super gently resuspending	10µg dropped Super gently resuspending
10µg Super gently resuspending Super	20µg dropped Super gently resuspending 1:10 dilution	control

2. Plate I(A is up)

10µg dropped Super	10µg dropped Super gently resuspending	10µg dropped Super gently resuspending
10µg Super gently resuspending Super	20µg dropped Super gently resuspending 1:10 dilution	control

3. Plate I(A is up)

10µg dropped Pellet	10µg dropped Pellet gently resuspending	10µg dropped Pellet gently resuspending
10µg Super gently resuspending Pellet	20µg dropped Pellet gently resuspending 1:10 dilution	control

Search for restriction sites around the 453 and 585/588 integration sites

Investigator: Volker

For this purpose a list of all commercially availible restriction enzymes was created that do not match in the ORFs of pAAV-RC.

Search for restriction sites in the sequence LQA/RGQA/RQA

Investigator: Volker

The idea to use a R588L mutation instead of the R588A that is published in the literature was discussed with the supervisers. It was proposed to search for other amino acid exchanges that alter the loop less drastically. For this reason the mutation N587Q was examined for possible restriction sites.

bla Bla bla

bla Bla bla

.

52.Labortag 07.07.2010:

Sequencing of GIO

Investigator: Hanna
Comments: Neither sequencing with forward nor with reverse primer (O29 + O30) worked. Therefore P40 (pAAV_iGEM_mVenus-YFP) was sent for sequencing once again.

• Name: Hanna P40
  
• V (P40) = 11 µL + 19 µL H2O
  
• Name of primer forward: Hanna 1 (O30)
  
• Name of primer reverse: Hanna 2 (O29)
  
• V(primer) = 3 µL + 27 µL H2O
  

Interview with Bild der Wissenschaft

• Adrian did a good job ;-)
• The article will be send to us next week
• For additional question, Jessica will be send an email

Transfection

Investigators: Adrian, Bea

• Transfection of AAV-293 cells with pAAV_iGEM-mVenus_YFP

New pcr run with new polymerase and different MgSO4 concentrations

• While this time the positive control was actually positive, no pcr product could be seen. The reasons are unclear. (Secondary structures, primer binding...)

Checking the results of the following sequencing reactions for the expression constructs from the DKFZ

Investigator: Volker

pKEX-VP1ex: sequence confirmed as described in [Name et al.,] with two pointmutations (ACG=>GCG) and (ATG=>CTG) to avoid the translation of VP2 and VP3.

pKEX-VP2ex: sequence confirmed as described in [Name et al.,] with one mutation (ATG=>CTG) to avoid the translation of VP3 and a second mutation (AAGACG=>CATATG) to switch to the main start codon ATG and to introduce a restriction site (which one??) before the start codon.

pKEX-VP3ex: sequence confirmed as described in [Name et al.,] with two silent pointmutations and a second mutation to introduce a restriction site before the start codon.

pKEX-Rep40ex: Sequence as expected until now, further sequencing reaction required with the primer: GATC_std_pTeSp-1

pKEX-Rep52ex: Point mutation directly at the beginning of the exon sequence, perhaps functionality in this context? At the end of the sequence some umcertainities. For the beginning further sequencing reaction required with the primer: GATC_std_pTeSp-1

pKEX-Rep68ex: One point mutation in the second condon that changes the coded amino acids from P to A, a second mutation (ATG=>GGG) at the beginning of the Rep40/Rep52 ORFs to avoid the translation of these sequences and a silent mutation. One further sequencing reaction is required with the primer: GATC_std_pcDNA1.1-RP.

pKEX-Rep78ex: One point mutation in the second condon that changes the coded amino acids from P to A, a second mutation (ATG=>GGG) at the beginning of the Rep40/Rep52 ORFs to avoid the translation of these sequences, a silent mutation and the same point mutation at the beginning of the exon as seen before in pKEX-Rep52ex.

53.Labortag 08.07.2010:

Final planing of the Cap modifications

Investigator: Volker

BbvCI
50|100|10|100 37°
File:Freiburg10 BbvC-I-cutsite 1 v1 000007.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

KpnI
100|75|0|50 37°C + BSA
File:Freiburg10 Kpn-I-cutsite 1 v1 000021.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

SalI
10|100|100|100 37°C
File:Freiburg10 Sal-I-cutsite 1 v1 000016.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

AarI
|||
File:Freiburg10 .gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

ScaI
100|100|10|100 37°C
File:Freiburg10 Sca-I-cutsite 1 v1 00001.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3: 2

BamHI
75|100|100|100 37°C + BSA
File:Freiburg10 BamH-I-cutsite 1 v1 000025.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3:

PvuII
100|100|100|100 37°C
File:Freiburg10 Pvu-II-cutsite 1 v1 000013.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3: 1

EagI
10|25|100|10 37°C
File:Freiburg10 Eag-I-cutsite 1 v1 000021.gif.gif
Recognition sites in Rep/Cap ORFs:
Recognition sites in pAAV_RC:
Recognition site in pSB1C3: 2

54.Labortag 09.07.2010:

Investigators: Anissa, Kerstin, Anna

• New DMEM-Medium was prepared (10% FCS). Investigators: Bea, Patrick
• HT and 293 cells were split into 4 flasks, 2 flasks each. Investigator: Kira
• AAV stocks were prepared, put into the -80°C freezer and labeled with the date, name, AAV, the amount of DNA used for transfection and drop/resuspend to make clear whether the DNA was just pippeted dropwise to the 293 cells or gently mixed with the cells. The numbers on the 15 ml falcons refer to DNA amount and DNA administration, too. Investigator: Patrick

PCR of hgH

• PCR program: Unnamed

components	volume of vector /µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
hgH_primer_for	2,5
hgH_primer_rev	2,5
DNA template	0,38
DMSO	-
Phusion polymerase	0,5
H2O	33,1
Total volume (e.g. 50 µl)	50

Agarose-Gel:

0,625 g Agarose, 50 ml TAE (1,25%), 3 µl GELRED (3-6µl), at 110 Volt, running time: 60 minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size (Geneious)
p47: hgH	50 µl	10 µl	488 bp

• Marker: GeneRuler ladder mix

	Marker (8 µl)	Sample 50 /µl
Lane	1	4

Gelextraction

Gel measurement:

Sample	weight
p47: hgH	0,13 g

• DNA concentration (hgH): 19,83 ng/µl

Comments: PCR was succesful:-) to do: Ligation of PCR product into standard plasmid which we´ve received wihthin the DNA distrivution kit of iGEM-HQ .

Order oligos for GMK_TK30

Investigator: Bea
Oligos have been ordered at sigmaaldrich in order to insert prefix and suffix to fusionenzyme mGMK_TK30 in RFC25.

to do: Order gene tk30 and part of gene sr39

Quickchange for the PstI restriction sites in pAAV-RC

Investigators: Kira and Volker
Quick change, Gel and test digestion with PstI. (more precise informations will be added)
@Kira and Volker: did the Quickchange actually work? Could you please add the information onto the wiki!! Thx!

PCR program: PstI

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__310 ____primer_for (1:10 dilution)	0,39 µl
__310____primer_rev (1:10 dilution)	0,39 µl
DNA template (1:40 dilution)	0,5 µl
DMSO	0 µl
Phusion polymerase	0.5 µl
H2O	20,22 µl
Total volume (e.g. 50 µl)	25 µl

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__4073____primer_for (1:10 dilution)	0.33 µl
___4073___primer_rev (1:10 dilution)	0.33 µl
DNA template (1:40 dilution)	0.5 µl
DMSO	0 µl
Phusion polymerase	0.5 µl
H2O	20.32 µl
Total volume (e.g. 50 µl)	25 µl

cycles	temperature	time
1	95 C	2 min
20	95 C	30 sec
	66 C	1 min
	68 C	5 min

• The PCR-products were digested with DpnI (1µl instead of 0.5 µl)
• aragose gel revealed for both samples very distinct bands

TEST DIGESTION

components	volume /µl
DNA	10
BSA (10x)	2
Buffer 3 (10x)	2
Enzyme (no.Lab: 48)	1
H2O	5
Total volume	20

• agarose gel was performed with digested samples and revealed 3 distinct bands, while only 1-2 bands have been expected. Because of the density of the bands it might be that the digestion with DpnI did not work properly, thus additional 1 µl of DpnI was added to each sample. Incubation @ 37 C lasted 1 h.

55.Labortag 11.07.2010

Splitting of HT1080 cells

Investigator: Patrick
HT 1080 and HEK 293 cells were split.
@ Kira: fetch new trypsin if it is not sufficient for the next splitting !

56.Labortag 12.07.2010:

Cloning CFP into pSB1C3

Investigator: Anna, Kerstin, Anissa

Practical Cloning:

• experiment date: 12.07.2010 ; time: 11.00
• plasmid: pSB1c3_CFP (p48)
  • Vector: name: pSB1c3 number:- production date: - origin: iGEM
  • Insert: name: pMA_CFP number:- production date: - origin: Sven
• new vector name: pSB1c3_CFP (p48)
• buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:28) EcoRI ; Enzyme 2 (no.Lab:48) PstI ;Enzyme 3 (no.Lab:77) DpNI
• DNA concentration (vector): 25 µg/µl ; DNA concentration (insert): 436,8 µg/µl

Comments:Third enzyme was only used to digest template from vector pcr

Digestion

components	volume of vector /µl	volume of insert /µl
DNA	4	5
BSA (100x)	0,2	2
Buffer ____ (10x)	1,5	2
Enzyme 1 (no.Lab:23)	0,5	1
Enzyme 2 (no.Lab:48)	0,5	1
Enzyme 3 (no.Lab:77)	0,5	1
H2O	7,8	9
Total volume (e.g. 15,20,25,30 µl)	15	20

• Incubation: 1h

Agarose-Gel:

0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 Volt, running time:45 minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)	Expected size 3 (Geneious)	Expected size 4 (Geneious)
2	20 µl	3,3 µl	732 bp (Insert)	2074 bp (Vector)	____ bp	____ bp

• Marker: GeneRuler ladder mix

	Marker	Sample 23,3 µl
Lane	1	3

Gelextraction

Gel measurement:

Sample	weight
2 (Insert)	0,14g

Ligation

	Insert	Vector
Volume/µl	6,77 µl	2,23 µl

TRAFO-EVALUATION

• Unfortunately the agar plate with p48, pSB1c3_CFP [XL1B, Cm, A.B.] does not contain any colonies. Thus, the plate was incubated @ 37 C for another 5 hours. Still no detectable colonies. This was double checked by Sven.

Seeding HT1080 + Passage

• Investigators: Adrian, Patrick
• 3* 6well dishes

3*10^5 cells	3*10^5 cells	3*10^5 cells
3*10^5 cells	3*10^5 cells	3*10^5 cells

• The amount of cells was doubled in first place and diluted in following steps (for further information ask patrick and adrian)

PCR of beta-globin:

• Investigator: Achim
• PCR program: BETA...(?)

components	volume of vector /µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
beta-globin_primer_for	2,5
beta-globin_primer_rev	2,5
DNA template	8 ng
DMSO	-
Phusion polymerase	0,5
H2O	33,2
Total volume (e.g. 50 µl)	50

Agarose-Gel:

0,625 g Agarose, 50 ml TAE (1,25%), 3 µl GELRED (3-6µl), at 115 Volt, running time: 30 minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size (Geneious)
p49: beta-globin	50 µl	10 µl	509 bp

• Marker: GeneRuler ladder mix

	Marker (8 µl)	Sample 50 /µl
Lane	1	4

Gelextraction

Gel measurement:

Sample	weight
p49: hgH	0,21 g

• DNA concentration (hgH): 34,87 ng/µl

Comments: PCR was succesful:-)
to do: Ligation of PCR product into standard plasmid which we´ve received wihthin the DNA distrivution kit of iGEM-HQ .

Midi-Prep preparation pAAV_RC

Investigator: Bea

• 200mL LB-Medium and 200µl Amp
• inoculated with glycerol stock containing pAAV_RC
• 20:00 p.m.: put intp 37°C room on shaker

First steps in producing ITR BioBricks via Fancy Method

Investigators: Hanna, Chris W.

Digestion of pGA14_Cerulean-CFP

1. Digestion with EcoRI and NotI:

components	volume of vector /µl
DNA	3.5
BSA (10x)	2
Buffer 3 (10x)	2
Enzyme EcoRI (no.Lab:23)	1
Enzyme NotI (no.Lab:46)	1
H2O	10.5
Total volume	20

Incubation: 1.5 hours, 37°C

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 0.15 g
Gel extraction was performed following the standard protocol.

DNA concentration: 26.8 ng/µL

1. Digestion with XbaI and PstI:

components	volume of vector /µl
DNA	3.5
BSA (10x)	2
Buffer 3 (10x)	2
Enzyme XbaI (no.Lab:63)	1.25
Enzyme PstI (no.Lab:48)	0.75
H2O	10.5
Total volume	20

Incubation: 1.5 hours, 37°C

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 0.17 g
Gel extraction was performed following the standard protocol.

DNA concentration: 22.9 ng/µL

Digestion of pAAV_MCS (P9) with AlwNI

components	volume of vector /µl
DNA	11.6
BSA (10x)	-
Buffer 4 (10x)	2.5
Enzyme AlwNI (no.Lab:120)	2.5
H2O	8.4
Total volume	25

Incubation: 1 hours + 20 minutes, 37°C

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment sizes: 2982 bp = right ITR and 1674 bp = left ITR

Gel extraction:

• Sample: right ITR = 0.15 g
  
• Sample: left ITR = 0.12 g
  

Gel extraction was performed following the standard protocol.

DNA concentration:

• right ITR: 44.5 ng/µL
• left ITR: 32.8 ng/µL

Digestion of ITR fragments with NotI and PstI

Digestion of both fragments was performed as follows:

components	volume of vector /µl
DNA	19 µL
BSA (10x)	1.5
Buffer 3 (10x)	2.5
Enzyme NotI (no.Lab:46)	1
Enzyme PstI (no.Lab:48)	1
H2O	-
Total volume	25

Incubation: 1 hours + 15 minutes, 37°C

Gel run:

• due to the small fragment sizes, we prepared a 2% agarose gel: 1.3 g agarose + 65 ml TAE buffer
• 25 µL of each sample + 5 µL loading dye (6x); 8µL marker
  
• Expected fragment sizes: ~ 150 bp (both)
• Big problem: Small fragments and little amounts -> 150 bp fragments were nearly not visible. In addition to that, the right ITR sample delivered 2 fragments in the referring range. Therefore two gel extractions ("right ITR oben" and "right ITR unten") were performed.

Gel extraction:

• Sample: right ITR oben = 0.11 g
  
• Sample: right ITR unten = 0.12 g
  
• Sample: left ITR = 0.2 g
  

Gel extraction was performed with special columns provided from Sven. In order to elute the samples 12 µL EB were used, columns were placed for 2 minutes into 50°C water bath and then centrifuged at 13200 rpm for 1 minute.

DNA concentration:

• right ITR oben: 23.9 ng/µL
• right ITR unten: 13.8 ng/µL
• left ITR: 4.46 ng/µL

Hybridization of ITR-Präfix-Oligos

left ITR:

• 10 µL Oligo 1 (O43 = Präfix_for)
• 10 µL Oligo 2 (O44 = Präfix_rev)
• 4 µL 100 mM TrisHCl pH8
• 8 µL 5 mM MgCl2
• 8 µL H2O

Total: 40 mL

right ITR:

• 10 µL Oligo 1 (O47 = Präfix_for)
• 10 µL Oligo 2 (O48 = Präfix_rev)
• 4 µL 100 mM TrisHCl pH8
• 8 µL 5 mM MgCl2
• 8 µL H2O

Total: 40 mL

Because some of the oligos produce strong secondary structures, we used the ORIGAMI1 program:
1) initial denaturation: 99°C, 7 minutes
2) 99°C, 1 minute
3) 73 x repetition of 2) -> -1°C, R = 0.3 °C/sec
4) hold 4°C

Ligation of pGA14 + ITR + Präfix

1. right ITR oben:

• Präfix: 1 µL
• ITR: 7 µL
• vector (pGA14): 9 µL
• buffer: 2 µL
• T4 ligase: 1 µL

Total volume: 20 µL

2. right ITR unten:

• Präfix: 1 µL
• ITR: 7 µL
• vector (pGA14): 9 µL
• buffer: 2 µL
• T4 ligase: 1 µL

Total volume: 20 µL

3. left ITR:

• Präfix: 1 µL
• ITR: 7 µL
• vector (pGA14): 9 µL
• buffer: 2 µL
• T4 ligase: 1 µL

Total volume: 20 µL

Samples will be incubating over night at 16°C.

Ordering genes for the replacement of Rep and Cap parts

Investigator: Volker guided by Sven & Tobi

The replacement for the Rep ORF from base 1510 to base 2008 and for the Cap ORF from base 3064 to base 3985 was ordered from Mr. Gene.

File:Freiburg10 Rep Cap Replacement.pdf

Sequencing of GOI

Investigator: Hanna
This time the sequencing delivered good results:

Conclusion: The designed primers can always be used in order to sequence any gene of interest!!!

57.Labortag 13.07.2010:

Endotoxin-free Midi Prep of pAAV_RC

Investigators: Chris, Stefan, Patrick
Deviations from the Standard Protocol:
As the lysate was applied to the column filter, about 1/5 of the lysate was spilled.
Result of the Midi-prep: about 18 ng/µl => waste
A new Midi-Pred will be prepared for tomorrow: 200 ml LB, 0,2 ml Amp, E.coli XL-1-blue (with pAAV_RC plasmid).

HEK-293 cells

The cells were split according to the standard protocol. Investigator: Patrick

Oligos pMGMK_TK30 arrived

New Oligos arrived for inserting RFC25 to thymidinkinase_gmk construct!(number O60 to O65). They were resuspended in water and a 1:10 dilution was done. They were put in Primer Box 2.

to do: perform PCR tomorrow and clone PCR product into pAAV_RFC25

Transduction

Investigators: Adrian, Patrick

• 3 Plates got transduced

1. Plate I(A is up) completely 10 µg

300µl dropped	300µl resuspended	450µl resuspended
600µl dropped	600µl resuspended	control

2. Plate II(A is up)completely 18 µg

300µl dropped	300µl resuspended	450µl resuspended
600µl dropped	600µl resuspended	control

3. Plate III(A is up) completely 24 µg

300µl dropped	300µl resuspended	450µl resuspended
600µl dropped	600µl resuspended	control

Results of Trafo of cloning CFP into pSB1C3

Investigator: Bea
Results: no clones on trafo plate even after longer incubation at 37 °C
Solution: perform digestion of linearized plasmid pSB1C3 and pMA_CFP again!!!

Repetition of cloning of CFP into pSB1C3

Investigator: Bea

• experiment date: 13.07.2010 ; time: 16:00
  • Vector: name: pSB1c3 number: do not have any number production date: - origin: iGEM HQ sent per DNA distribution kit
  • Insert: name: pMA_CFP number:- production date: - origin: iGEM 2009
• new vector name: pSB1c3_CFP (P48)
• buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab: 23) EcoRI ; Enzyme 2 (no.Lab: 48) PstI ;Enzyme 3 (no.Lab: 77) DpnI
• DNA concentration (vector: pSB1C3): 25 ng/µl ; DNA concentration (insert pMA_CFP): 436,8 µg/µl

Comments:The standard plasmid vector (pSB1C3) received from the iGEM HQ is linearized (PCR product) and need to be cut with EcoRI, PstI and optionally with DpnI to digest the DNA template.

Digestion of pSB1C3 and pMA_CFP

components	volume of pSB1C3 /µl	volume of pMA_CFP /µl
DNA	4	4,6
BSA (100x)	1,5	2
Buffer 3 (10x)	1,5	2
Enzyme EcoRI (no.Lab:23)	0,5	1
Enzyme PstI (no.Lab:48)	0,5	1
Enzyme DpnI (no.Lab:77)	0,5	-
H2O	6,5	9
Total volume (e.g. 15,20,25,30 µl)	15	20
Incubation	30 min at 37°C in PCR cycler	45min at 37°C in PCR cycler
commment	after digestion: 80°C 20 min heat kill	load on agarose gel

• Load pMA_CFP digestion reaction onto 1% agarose gel

1% Agarose-Gel

0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 Volt, running time:45 minutes

Sample	Sample/µl]	Loading dye (/6x)/µl	Expected size 1 (Geneious)	Expected size 2 (Geneious)
pMA_CFP	20 µl	4 µl	732 bp (Insert)	2974 bp (Vector)

Loading plan for agarose gel:
Marker used: GeneRuler ladder mix (Fermentas)

	Marker	Sample 24 µl
Lane	1	3

Results: Expected bands too high, but lower band (= CFP) was cut out and gel extraction have been performed folowing standard protocol.

Gel extraction

has been performed and Nanodrop measurement reveals following concentraion of the insert CFP:

• c(CFP)= 6,75ng/µL

• Ligation ratio of vector/insert was calculated with LabTools
• v(pSB1C3)= 4,4 µL
• v(CFP)= 4,6 µL
• vQuickligase Buffer (2x)= 10µL
• vQuickLigase = 1µL

Transformation

• used bacterial strain: XL-1B
• 2µL of DNA (pSB1C3_CFP)
• Trafo plate in 37°C room for incubating at 23:00

TRANSFORMATION of Quickchange PstI

Investigator: Kira

• Transfection was performed according to the standard protocol with XL1B cells.

58.Labortag 14.07.2010

Trafo evaluation of Quickchange PstI

Investigator: Kira
Both plates contained lots of colonies, while 8-10 colonies are considered for inoculation to perform a mini prep and an additional test digestion. However, the experiment has to be repeated.

Quickchange for the PstI restriction sites in pAAV-RC (modified)

Investigators: Kira

PCR program: PstI

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__310 ____primer_for (1:10 dilution)	0,39 µl
__310____primer_rev (1:10 dilution)	0,39 µl
DNA template (1:40 dilution)	0,5 µl
DMSO	0.5 µl
Phusion polymerase	0.5 µl
H2O	19.72 µl
Total volume (e.g. 50 µl)	25 µl

components	volume in µl
10x Phusion HF buffer	2.5 µl
10 mM dNTP mix	0.5 µl
__4073____primer_for (1:10 dilution)	0.33 µl
___4073___primer_rev (1:10 dilution)	0.35 µl
DNA template (1:40 dilution)	0.5 µl
DMSO	0.5 µl
Phusion polymerase	0.5 µl
H2O	19.82 µl
Total volume (e.g. 50 µl)	25 µl

cycles	temperature	time
1	95 C	2 min
20	95 C	30 sec
	68 C	7 min

• PCR products were digested with 0.5 µl and incubated @ 37 C for 1 h

TRANSFORMATION

• The transformation of XL1B was performed according to the standard protocol but with DYT instead of LB.

Results of trafo cloning pSB1C3_CFP

Investigator: Bea
Comments: experiment have been repeated because no clones were grown after the last trafo!

• There have been clones grown on the trafo plate. Four clones were picked and inoculated on LB_Medium containing Cm (Chloramphenicol).
• 18:00: 37°C room on shaker. Incubating over night!

Seed AAV-293

Investigators: Adrian ,Bea

• 2x75cm2 culture flasks
• after counting via neubauer chamber (2,2*20*10000*(x/4))= should be around 3,xxx so it would be possible to prepare 4x10cm petri dishes with 3.000.000 cells per plate and passage 1.500.000 cells to a 75cm.

DAAD Timetable

Investigators: Adrian, Kerstin Prepared timetable for DAAD

Summary

Investigators: all

have not been done yet! to do for tomorrow! deadline of submitting project descrpition is 16th of july!! (Bea)

Ordering ITR+TK/GMK

Investigators: Bea, Sven

• It has been ordered the TK30 with NgoMIV add-on prefix and ageI and SpeI add-on suffix combined with the wt_left_ITR in the RFC10 standard.

Endotoxoin free Midi prep mAAV_RC

Investigator: Chris W.
Midi prep done with the Qiagen-Kit
OD of the Bacteria: 3.07
concentration: 429,8 and 378,5 ng/µl
Labeled as P50 and stored in the -20° Freezer

MGMK_TK30:PCR with iGEM restriction-sites and cloning into pAAV_RFC25

Investigators: Achim,Bea,Anissa

PCR:

• PCR program:mGMK_TK30

components	volume in µl
5x Phusion HF buffer	10
10 mM dNTP mix	1
pMGMK_TK30_RFC25_prefix_for (060) (1:10 dilution)	2,5 (0,5 µM)
pMGMK_TK30_RFC25_suffix_rev (063) (1:10 dilution)	2,5 (0,5 µM)
DNA template	~8 ng
DMSO	-
Phusion polymerase	0,5
H2O	fill up to 50 µl
Total volume (e.g. 50 µl)	50

Comments:Oligos with add-on tails (prefix and suffix), but TK30 still contains three iGEM restriction sites (TK30 without restriction sites was ordered today)

Practical Cloning:

• • Vector: name:pAAV_RFC25 number:p42
  • Insert: name: MGMK_TK30 (after PCR with iGEM standard) number:-
• new vector name: pAAV_RFC25_MGMK_TK30
• buffer used:4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:149) AgeI ; Enzyme 2 (no.Lab:63) XbaI
• DNA concentration (vector):321,5 ng/µl ; DNA concentration (insert):

Comments:_____

Digestion

components	volume of vector /µl	volume of insert (=PCR product) /µl
DNA	3,1 (1 µg)	30 (0,691 µg)
BSA (100x)	2	5 µl
Buffer 4 (10x)	2	5µl
AgeI (no.Lab:149)	1	2 µl
XbaI(no.Lab:63)	0,75	1 µl
H2O	11,15	7 µl
Total volume (e.g. 15,20,25,30 µl)	20	50 µl

• Incubation: Vector: 1h; PCR product: 2h

Agarose-Gel:

0,5 g Agarose, 50 ml TAE (1%), 3 µl GELRED (3-6µl), at 110 (PCR); 115 (vector) Volt, running time:____ minutes

Sample	Sample/µl]	Loading dye (5x/6x)/µl	Expected size (Geneious)
PCR product	50 µl	10 µl	~1692 bp
vector	20 µl	4 µl	4646 bp

• Marker: GeneRuler ladder mix

	Marker	Sample 60 /µl
Lane	8 µl	PCR

• Marker: GeneRuler ladder mix

	Marker	Sample 24 /µl
Lane	8 µl	vector

Comments: two gels were made, one for the vector, one for the pcr product

• Gel extraction was carried out according to standard protocol
• Nanodrop:
  • pAAV_rfc 25 Digestion: 15,07 ng/µl
  • mgmk tk30 pcr product: 23,04 ng/µl

• Puricifation using Quiagen QIAquick PCR Purification Kit Protocol
  • c(mgmk_tk30) = 8,1ng/µL
• Ligation of mgmk tk30 and pAAV_rfc 25
  • v(vector) = 2,97 µL
  • v(insert) = 6,03 µL

• Trafo
• put in 37°C room at 22:00

Ordering of Oligos

Investigator:Volker

The following four Oligos were ordered:

• SDM BamHI (729) for
• SDM BamHI (729) rev
• SDM SalI (1110) for
• SDM SalI (1110) rev

59.Labortag 15.07.2010

Picking clones for mini-prep

Investigators: Adrian, Chris, Stefan

4 clones (1-4) of pAAV_RFC25_mgmk_tk30 where picked according to protocol for mini-prep (tomorrow).
Antibiotic: Amp
Time: 18:30
Investigators: Stefan, Patrick
New millipore H2O, LB + Agar and DMEM medium were prepared

Splitting of HT1080 cells

Investigators: Chris, Patrick
HT 1080 cells were split according to the standard protocol

PstI Quickchange Trafo from 14.07

Investigator: Kira
Trafo evaluation: Unfortunately no colonies are present.

MINI PREP (PstI Quickchange Trafo from 13.07)

Investigator: Kira

@Kira: ich habe die Clone benannt: SDM310 Nr. 1 ist jetzt P58 und sdm4073 nr 1 ist jetzt P59. Bitte eintragen.

TEST DIGESTION (PstI Quickchange Trafo from 13.07)

Investigator: Kira

FACS

Investigators: Kerstin, Anna

FACS analysis of different treated HT1080 cells was done (18 samples)

The first percentage refers to the living and fluorescent cells and the second percentage to the total amout of living cells.

The data are listed this way:

1. Plate I(A is up)

A1	A2	A3
B1	B2	B3

1= Plate 1 A1 : 0% YFP-positive Cells (there were only a few cells in this sample)
2= Plate 1 A2 : 27,7% YFP-positve Cells from 73,3%
3= Plate 1 A3 : 17,3% " from 63,1%
4= Plate 2 A1 : 32,9% " from 75,3%
5= Plate 2 A2 : 27,2% " from 76,5%
6= Plate 2 A3 : 30,7% " from 73,4%
7= Plate 3 A1 : 26,8% " from 76,0%
8= Plate 3 A2 : 30,5% " from 74,2%
9= Plate 3 A3 : 30,7% " from 75,2%
10= Plate 1 B1 : 6,25% " from 36,1%
11= Plate 1 B2 : 6,42% " from 68,4%
12= Plate 1 B3 : 0,05% " from 89,5%
13= Plate 2 B1 : 20,5% " from 72,5%
14= Plate 2 B2 : 15,7% " from 73,6%
15= Plate 2 B3 : 0,02% " from 85,4%
16= Plate 3 B1 : 19,5% " from 73,3%
17= Plate 3 B2 : 20,8% " from 75,7%
18= Plate 3 B3 : 0,07% " from 84,8%

The calculated value written into the table describes the fluorescent amount of cells from the living cells. Example: 1 A2 : 27,7% YFP-positve cells of 73,3% living cells : 27,7/73,3 = 0,378

1. Plate I(A is up) completely 10 µg

300µl dropped 0,00	300µl resuspended 0,378	450µl resuspended 0,274
600µl dropped 0,173	600µl resuspended 0,094	control 5,6x10^-4

2. Plate II(A is up)completely 18 µg

300µl dropped 0,437	300µl resuspended 0,356	450µl resuspended 0,418
600µl dropped 0,283	600µl resuspended 2,1x10^-3	control 2,3x10^-4

3. Plate III(A is up) completely 24 µg

300µl dropped 0,353	300µl resuspended 0,411	450µl resuspended 0,408
600µl dropped 0,266	600µl resuspended 0,275	control 8,3x10^-4

Conclusions

• Higher amounts of Plasmids (24, 30µg) seems to have no obvious effect on YFP expression
• Theres no difference in YFP expression comparing resuspended samples to not resuspended samples
• The amount of dead HT cells is about 25%, it is not clear if it is either AAV induced or mechanic stress (Trypsin, washing procedure)

Next steps:

• does the amount of GOI (ng plasmids) has an effect on YFP expression
• compare transduced to non transduced cells (vitality), or in other words is the mechanic stress responsible for 25% dead cell ratio?
• comparison of transduction efficiency of different virus stock production routines

Plasmid Mini-Prep of pSB1C3_CFP

Investigators: Kerstin, Anissa

• experiment date: 15.07.2010 ; time:10.00
• new vector name:pSB1C3_CFP

Glycerol Stocks

	Clone 1	Clone 2	Clone 3	Clone 4
Bacteria strain	XL1 blue	XL1 blue	XL1 blue	XL1 blue
Plasmidname	pSB1C3_CFP	pSB1C3_CFP	pSB1C3_CFP	pSB1C3_CFP
Date	15.7.2010	15.7.2010	15.7.2010	15.7.2010
given glycerol-stock no.	B38	B39	B40	B41
given plasmid no.	p48	p51	p52	p53

Test digestion

• buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:48)PstI ; Enzyme 2 (no.Lab:23) EcoRI
• Plasmid
  • Given Plasmid-Number: p48; DNA concentration: 195,1 ng/µl ;
  • Given Plasmid-Number: p51; DNA concentration: 230,1 ng/µl;
  • Given Plasmid-Number: p52; DNA concentration: 134,1 ng/µl;
  • Given Plasmid-Number: p53; DNA concentration: 244,1 ng/µl;

Comments:p48 and p51 were sequenced

Components	Volume/µL	Mastermix
DNA	Variable (800-1000 ng)	-
BSA (100x)	1,5	7,5
Buffer no.3 (10x)	1,5	7,5
Enzyme 1 (no. Lab:48 )	0,5	2,5
Enzyme 2 (no. Lab:23 )	0,5	2,5
H2O	variable	-
Total volume	15	-

Sample	Volume sample/ µl	Volume H2O / µl
p48	5	6
p51	4	7
p52	7	4
p53	4	7

• Incubation: 1h

Agarose-Gel:

0,5 g Agarose, 50 TAE (1%), 3GELRED (3-6µl), at 110Volt, running time:30 minutes

Sample	Sample/µl]	Loading dye (6x)/µl	Expected size (Geneious)
p48	15 µl	3 µl	700 bp
p51	15 µl	3 µl	700 bp
p52	15 µl	3 µl	700 bp
p53	15 µl	3 µl	700 bp

• Marker: GeneRuler ladder mix

	Marker	Sample p48 /µl	Sample p51 /µl	Sample p52 /µl	Sample p53 /µl
Lane	8 µl	18µl	18µl	18µl	18µl

Comments: Gel was leaky, therefore two samples "flew through". Plasmid p48 and p51 were sent for sequencing.

2nd try: First steps in producing ITR BioBricks via Fancy Method

Investigator: Hanna

Unfortunately it turned out, that the digestion step of the 1st try didn't work: After the transformation very much colonies grew on the plates. Sequencing delivered, that survival of the bacteria was due to re-ligated vector... Therefore the whole experiment will be performed again today.

Digestion of pGA14_Cerulean-CFP

1. Digestion with EcoRI and NotI:

components	volume of vector /µl
DNA	3.4
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme EcoRI-HF	1
Enzyme NotI-HF	1
H2O	10.6
Total volume	20

Incubation: 1.5 hours, 37°C in thermocycler

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 0.31 g
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C.

DNA concentration: 43 ng/µL

1. Digestion with XbaI and PstI:

components	volume of vector /µl
DNA	3.4
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme XbaI	1
Enzyme PstI-HF	1
H2O	10.6
Total volume	20

Incubation: 1.5 hours, 37°C in thermocycler

Gel run: 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 0.31 g
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C.

DNA concentration: 38.6 ng/µL

Digestion of pAAV_MCS with AlwNI

components	volume of vector /µl
DNA	17.86 = 5 µg
BSA (10x)	-
Buffer 4 (10x)	3
Enzyme AlwNI (no.Lab:120)	3
H2O	6.14
Total volume	30

Incubation: 1.5 hours , 37°C in thermocycler

Gel run: 30 µL sample + 6 µL loading dye (6x); 8µL marker
Expected fragment sizes: 2982 bp = right ITR and 1674 bp = left ITR

Gel extraction:

• Sample: right ITR = 0.19 g
  
• Sample: left ITR = 0.17 g
  

Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C. Further on 30 µL EB-buffer was used.

DNA concentration:

• right ITR: 59.8 ng/µL
• left ITR: 46.2 ng/µL  :)

Digestion of ITR fragments with NotI and PstI

Digestion of right ITR fragment:

components	volume of vector /µl
DNA	30 µL
BSA (100x)	0.5
Buffer 4 (10x)	3.74
Enzyme NotI-HF	1.5
Enzyme PstI-HF	1.5
H2O	-
Total volume	37.4

Incubation: 50 minutes, 37°C in thermocycler

Digestion of left ITR fragment:

components	volume of vector /µl
DNA	30 µL
BSA (100x)	0.5
Buffer 4 (10x)	3.72
Enzyme NotI-HF	1.5
Enzyme PstI-HF	1.5
H2O	-
Total volume	37.2

Incubation: 50 minutes, 37°C in thermocycler
Gel run:

• due to the small fragment sizes, a 2% agarose gel was prepared.
• 5 µL loading dye was added to the whole volume of each sample; 8µL marker
  
• 115 V, 40 minutes
  
• Expected fragment sizes: ~ 150 bp (both)
• Problem: Small fragments, little amounts, blurred 150 bp bands -> fragments were cut out broad-minded.

Gel extraction:

• Sample: right ITR oben = 0.4 g
  
• Sample: left ITR = 0.36 g
  

Gel extraction was performed following standard protocol. After applying EB buffer to the columns, they were placed for 2 minutes into 50°C water bath and then centrifuged at 13200 rpm for 1 minute.

DNA concentration:

• right ITR: 4 ng/µL
• left ITR: 4 ng/µL

Hybridization of ITR-Präfix-Oligos

left ITR:

• 10 µL Oligo 1 (O43 = Präfix_for)
• 10 µL Oligo 2 (O44 = Präfix_rev)
• 4 µL 100 mM TrisHCl pH8
• 8 µL 5 mM MgCl2
• 8 µL H2O

Total: 40 mL

right ITR:

• 10 µL Oligo 1 (O47 = Präfix_for)
• 10 µL Oligo 2 (O48 = Präfix_rev)
• 4 µL 100 mM TrisHCl pH8
• 8 µL 5 mM MgCl2
• 8 µL H2O

Total: 40 mL

Because some of the oligos produce strong secondary structures, we used the ORIGAMI1 program:
1) initial denaturation: 99°C, 7 minutes
2) 99°C, 1 minute
3) 73 x repetition of 2) -> -1°C, R = 0.3 °C/sec
4) hold 4°C

Ligation of pGA14 + ITR + Präfix

1. right ITR

• Präfix: 2 µL
• ITR: 10 µL
• vector (pGA14): 5 µL
• buffer: 2 µL
• T4 ligase: 1 µL

Total volume: 20 µL

2. left ITR

• Präfix: 2 µL
• ITR: 10 µL
• vector (pGA14): 5 µL
• buffer: 2 µL
• T4 ligase: 1 µL

Total volume: 20 µL

3. control 1:

• vector 1 (pGA14, digested with EcoRI + NotI): 5 µL
• buffer: 2 µL
• T4 ligase: 1 µL
• H2O: 12 µL

Total volume: 20 µL

4. control 2:

• vector 2 (pGA14, digested with XbaI + PstI): 5 µL
• buffer: 2 µL
• T4 ligase: 1 µL
• H2O: 12 µL

Total volume: 20 µL

Samples will be incubating over night at 16°C. To do: Trafo (Agar plates were already prepared.)

60.Labortag 16.07.2010

Continuation of Fancy ITR-method

Investigator: Hanna

Trafo

Trafo was performed following standard protocol. Aberration: Instead of 2 µL, 3 µL DNA was added to BL21 bacteria (50 µL).

right ITR

It turned out, that the strategy by digesting pGA14 with XbaI and PstI cannot work. pGA14 needs to be digested with EcoRI and PstI:

Digestion of pGA14_Cerulean-CFP with EcoRI and PstI

components	volume of vector /µl
DNA	3.4
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme EcoRI-HF	1
Enzyme PstI-HF	1
H2O	10.6
Total volume	20

Incubation: 1 hour, 37°C in thermocycler

Gel run: 1% gel, 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 2900 bp

Gel extraction:
Sample weight: 170 mg
Gel extraction was performed following the standard protocol. Abberation: After applying EB-buffer, the column was incubated for two minutes at 50°C.

DNA concentration: 26.8 ng/µL

Digestion of pAAV_MCS with NotI and PstI

In order to create ITRs with NotI and PstI restriction sites, the AlwNI-digestion step was skipped. Therefore 50% of the constructs will also contain the left ITR... this means: picking more colonies and sequencing!

components	volume of vector /µl
DNA	10.71
BSA (10x)	2
Buffer 4 (10x)	2
Enzyme EcoRI-HF	1
Enzyme PstI-HF	1
H2O	3.29
Total volume	20

Incubation: 1 hour, 37°C in thermocycler

Gel run: 2% gel, 20 µL sample + 4 µL loading dye (6x); 8µL marker
Expected fragment size: ~ 150 bp
Gel run delivered no satisfying results. Therefore the gel was discarded and the strategy changed: The residual right ITR solution of yesterday's elution will be taken for ligation.

Ligation of right ITR + Präfix + pGA14

• ITR: 7 µL
• pGA14: 7 µL
• Präfix: 1.5 µL
• Buffer: 2 µL
• T4 ligase: 1 µL
• H2O: 1.5 µL

Total: 20 µL

• pGA14: 7 µL
• Buffer: 2 µL
• T4 ligase: 1 µL
• H2O: 10 µL

Total: 20 µL

The ligation-solution will be incubating over night.

To do:

• Mini-Prep of pGA14_präfix_leftITR
• Trafo of pGA14_präfix_rightITR
• Midi-Prep of pGA14

Results sequencing of pSB1C3_CFP

Investigator: Bea
Plasmid: pSB1C3_CFP
Primer used: VR2
Plasmid names: P48_KK and P51_AB
Comments: Sequencing results of cloning experiment performed at 14.-15.07.2010.

Results: Sequencing reads are good. Cloning of CFP into pSB1C3 can be confirmed. There are no insertions, transitions or deletions in the sequence or the iGEM restriction sites. Using this plasmid in order to create our iGEM BioBricks in RFC10 standard can be confirmed.

Sequencing results of pSB1C3_CFP (plasmid number P48). There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).

Sequencing results of pSB1C3_CFP (plasmid number P51). There are no mutations in the CFP sequence and in the RFC10 iGEM restiction sites (blue boxes).

BioBrick production with hGH and beta-globin by cloning it into pSB1C3

Investigator: Bea
Plasmid: pSB1C3_CFP
Plasmid names: pSB1C3 (P51 or P48) and PCR prdouct of hGH and beta-globin

Comments: While cloning theoretically the hGH PCR product into the vector pSB1C3, it was recognized that the primers that were used for PCR for

• hGH RFC10 production and
• beta-globin intron RFC10 production

do not contain the required "G" at the end of the prefix and the "T" in the suffix add-on in the RFC10 standard. They were already used by performing a PCR with the add-on prefix and suffix primer, but we did not clone it into the pSB1C3 because of the wrong add-on tails. Therefore new primers were designed and ordered.

Ordered oligos:

hGH

• suffix (reverse)
• prefix (forward)

beta-globin

• suffix (reverse)
• prefix (forward)

CMV

• suffix (reverse)
• prefix (forward)

TK_GMK

• tk_gmk_prefix for
• tk_gmk_suffix_rev
• gmk_suffix_rev

To do: Upload cloning strategy of tk_gmk and BioBrick production

--Bea 15:21, 16 July 2010 (UTC)
Comment: reverse beta-globin primer is correct!? (Hanna)

Transfection

Investigator: Adrian
30µg Plasmid were used (pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30)
VIRUS nix:pHelper + pAAV_RC
VIRUS 1  :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 1 : P54
VIRUS 2  :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 2 : P55
VIRUS 3  :pHelper + pAAV_RC+ pAAV_RFC25_mgmk_TK30 clone 3 : P56

Mini Prep of pAAV_RFC25_mgmk_TK30

Investigator: Adrian 4ml were preparated

• pAAV_RFC25_mgmk_TK30 clone1 conc: 291,43 ng/µl : P54
• pAAV_RFC25_mgmk_TK30 clone2 conc: 243,99 ng/µl : P55
• pAAV_RFC25_mgmk_TK30 clone3 conc: 247,00 ng/µl : P56
• pAAV_RFC25_mgmk_TK30 clone4 conc: 246,01 ng/µl : P57

Test digestion of all four plasmids to check if the mgmg_TK30 insert is present. Investigator: Patrick, Chris
Each digestion sample:

• 0,2 µl BSA (I picked the wrong tube. It should have been 2 µl BSA)
• 2 µl Buffer 4
• 0,5 µl XbaI
• 0,5 µl SpeI
• 13,8 µl H2O
• 3 µl DNA

Digestion: 65 minutes, 37°C. Results: No mgmk_TK30 insert detectable. I will try it again on saturday or sunday.

Preparation of 50x TAE and 0,5M EDTA

Investigators: Chris W., Patrick

1 L TAE (50x)

242 g tris base
57.1 ml glacial acetic acid
100 ml 0.5 M EDTA
ad 1 L Milipor

1 L EDTA (0.5 M)

146,13 g Ethylendiamintetraessigsäure
ad 800 ml Milipor
~20 g NaOH
pH mit NaOH auf 8 einstellen
ad 1 L Milipor

Test digestion of the QuickChange for PstI (310) and PstI (4073)

Investigator: Kira & Volker

The digestion showed two bands with apropirate lengt for each of the 6 clones as they were expected.
The constructs were sent to GATC for sequencing.

• pAAV_RC_SDM_PstI(310) with the primer GATC_std_QE-FP
• pAAV_RC_SDM_PstI (4073) with the primer GATC_std_M13_FP

Primers to convert the expression constructs into the iGEM standard were ordered

Investigator: Volker

• Praefix VP1ex
• Praefix VP2ex
• Praefix VP3ex
• Suffix VP123ex
• Praefix Rep68_78ex
• Praefix Rep 40_52ex
• Praefix AAPex
• Suffix Rep 40_68ex
• Suffix Rep 52_78ex
• Suffix AAPex

61.Labortag 17.07.2010:

Picking clones of pGA14_Präfix-leftITR Trafo

Investigator: Hanna

Bacteria also grew on control plates. Control means: Ligation of digested vector (pGA14_Cerulean) without insert (Präfix and left ITR). Therefore it seemed that somehow pGA14 religated (Can't be if vector digested completely). Therefore 10 colonies were picked, in order to increase the chance to get a successfully ligated plasmid.

Mini-Preps of pGA14_Präfix-lITR cultures

Investigator: Hanna

No glycerol stocks were prepared, because I'm going to perform the test digestion today.

10 Mini-Preps were performed following the standard protocol.

Test digestion of pGA14_Präfix-lITR (Ligation)

Investigator: Hanna

Test digestion

• buffer used: 4; Restriction-enzymes used: Enzyme 1: EcoRI-HF ; Enzyme 2: PstI-HF
• Plasmid: pGA14_Präfix_lITR 1 - 10 (all: ~ 400 ng/µL)

Components	Volume/µL	Mastermix
DNA	2.5	-
BSA (10x)	-	12
Buffer 4 (10x)	-	12
Enzyme 1 EcoRI-HF	-	6
Enzyme 2 PstI-HF	-	6
H2O	-	54
Total volume	10	90

• Incubation: 55 minutes

Agarose-Gel:

0.75 g Agarose, 50 ml TAE (1.5 %), 3 µL GELRED, at 115 Volt, running time: 30 minutes

Expected fragment size: Hopefully 160 bp = left ITR :) If pGA14_Cerulean religated the expected fragment size would be ~ 800 bp.

• Marker: GeneRuler ladder mix (6x)

	Marker	Sample 1	Sample 2	Sample 3	Sample 4	Sample 5	Sample 6	Sample 7	Sample 8	Sample 9	Sample 10
Lane	8 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL

Comments: Numbers refer to "colony 1, 2, 3,..."

Wonderful news: All 10 test digestions delivered positive results: 150 bp fragments and no 800 bp fragment was detectable. Means: left ITR + Präfix was inserted successfully into pGA14!!! :)

yees, thats great! Finally something worked with our ITRs. well done Hanna!! (Bea)

the most astonishingly test digestion gel of our entire working time! :)(Adrian)

Next step: Fusion of suffix to left ITR

Glycerol stocks of all 10 colonies were prepared: B46.1 - B46.10; Plasmid names: P62.1 - P62.10

Trafo of pGA14_Präfix_rITR

Investigator: Hanna

Transformation of BL21 bacteria with pGA14_Präfix_rITR which ligated over night was performed following standard protocol. Abberation: 3µL DNA was added to 50 µL cells.

To do: Mini-Prep + Test digestion of pGA14_Präfix_rITR; Sequencing of pGA14_Präfix_lITR and pGA14_Präfix_rITR.

62.Labortag 18.07.2010

Investigator: Adrian

Calculation of ganciclovir cymeven concentration

• Ganciclovir: m = 255,23 g/mol
• dissolved in PBS (?), NaCL (0,9%) ?
• Concentrations : 0,5 µM = 0,0000005M
• xg = (0,0000005 mol/l *255,23 g/mol)/(1l PBS resp. 1l 0,9% NaCl)
• x = 0,000128g
• x = 0,128 mg
• 0,128 mg solved in 1l of PBS = 1l of 0,5µM solution
• steril filtrated under steril bench

preparation of Aliquots:

Cellculture

The HEK-293 cells were split according to the standard protocol. The HT 1080 cells were split and sowed (3x10^5 cells each well). The amount of cells/ml was determined with the Neubauer-Meteringchamber: (8 cells counted/4)x2,2x20x10^4 = 888000 cells/ml. Two 6-well dishes could be prepared.

only DMEM	3x10^5 cells+DMEM	3x10^5 cells+DMEM
3x10^5 cells+DMEM	3x10^5 cells+DMEM	3x10^5 cells+DMEM

Test digestion of pAAV_RFC_mgmk_tk30: P54, P55, P56, P57

Investigators: Chris, Patrick

To check whether the mutual mgmk_tk30 insert is present in the plasmid we digested it with AgeI and EcoRI. If the insert is present there will an DNA fragmet with a size of about 1700 bp.

P54	P55	P56	P57
291,4 ng/µl	244 ng/µl	247 ng/µl	246 ng/µl

Mastermix:

• 10 µl Buffer 4
• 4,4 µl AgeI
• 2,5 µl EcoRI
• no BSA (accroding to NEB)
• 83,1 µl H2O
• Total volume: 100 µl

17 µl of the mastermix were pipetted to 3 µl plasmid sample. Digestion time: 75 minutes.

Gelrun (1% Agarose), 55 minutes, 115 mV: Results: See picture. Interpretation of the results: ? The "upper" DNA seems to be undigested vector underneath the probably digested vector with an estimated size of about 5600 bp. The mutual insert (mgmk_tk30) should be about 1700 bp. There are probably several DNA coil structures visible but not our mutual insert. To do : ligate again.

Aferwards i noticed that i miscalculated the Mastermix.

63. Labortag 19.07.2010

rITR

Picking clones of pGA14_Präfix-rITR Trafo

Few bacteria also grew on control plates. Control means: Ligation of digested vector (pGA14_Cerulean) without insert (Präfix and right ITR).
6 colonies were picked, in order to increase the chance to get a successfully ligated plasmid.

Mini-Preps of pGA14_Präfix-lITR cultures

Investigators: Hanna, Jessy

Glycerol stocks were prepared: B47.1, B47.2, B47.3, B47.4, B47.6

6 Mini-Preps were performed following the standard protocol.

Test digestion of pGA14_Präfix-rITR (Ligation)

Investigator: Hanna, Jessy

Test digestion

• buffer used: 4; Restriction-enzymes used: Enzyme 1: EcoRI-HF ; Enzyme 2: PstI-HF
• Plasmid: pGA14_Präfix_rITR 1 - 6 (all: ~ 500 ng/µL) -> 1 µg

Components	Volume/µL	Mastermix
DNA	2	-
BSA (10x)	-	6.4
Buffer 4 (10x)	-	6.4
Enzyme 1 EcoRI-HF	-	4
Enzyme 2 PstI-HF	-	4
H2O	-	43.2
Total volume	10	64

• Incubation: 45 minutes

Agarose-Gel:

0.75 g Agarose, 50 ml TAE (1.5 %), 3 µL GELRED, at 90 - 100 Volt, running time: 45 minutes

Expected fragment size: Hopefully 160 bp = right ITR :) If pGA14_Cerulean religated the expected fragment size would be ~ 800 bp.

• Marker: GeneRuler ladder mix (6x)

	Marker	Sample 1	Sample 2	Sample 3	Sample 4	Sample 5	Sample 6	Marker
Lane	8 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL	10 µL

Comments: Numbers refer to "colony 1, 2, 3,..."

Wonderful news: All 6 test digestions delivered positive results: ~ 160 bp fragments and no 800 bp fragment were detectable. Means: right ITR + Präfix was inserted successfully into pGA14!!! :)

Next step: Ordering new oligos: Präfix of lITR, suffix of right and left ITRs, continuation of fancy cloning protocol

New Oligos (left ITR Präfix and Suffix + right ITR Suffix) were ordered.

Sequencing of ITRs

Investigator: Hanna

pGA14_Präfix_lITR and pGA14_Präfix_rITR were sent for sequencing to GATC:
1) pGA14_Präfix_lITR: c(P62.1) = 422.38 ng/µL -> V = 5 µL + 25 µL H2O
2) pGA14_Präfix_rITR: c(P63.1) = 501 ng/µL -> V = 4.2 µL + 25.8 µL H2O

Primer: GATC_std_pQE-FP

Quantitative real time PCR

Investigator: Hanna

Template: DNA of HT1080 cells transducted with 1) 10 µL and 2) with 30 µL virus stock solution.

Pipetting scheme:
Master Mix

• 2x QuantiFast SYBR Green PCR Mix: 400 µL
• Primer for and rev: 32 µL of 1:10 dilution = 10 µM
• Water: 208 µL
• Total: 640 µL

Template: 5 µL
To each template 20 µL master mix were added.

PCR program:

• Hold: 95°C, 5 minutes
• Cycling: 95°C for 10 seconds, 60°C for 30 seconds
• Melt: Ramp from 60°C to 95°C, rising by 1°C each step, wait for 45 seconds on first step, then wait for 5 seconds for each step afterwards. Aquire to Melt A on FAM.

Cloning strategy for gmk_tk added!!

Investigator: Bea
Media:Freiburg10 BioBrick GMK TK30 07 07 2010 with new oligos.pdf

pAAV_RC site directed mutagenesis: Digestion of the two mutagenesis reaction of PstI site: 310 and 4073

Investigator: Volker

Digestion of pAAV_RC