Team:GeorgiaTech/WeekNine

From 2010.igem.org

(Difference between revisions)

Revision as of 21:59, 25 October 2010

Georgia Institute of Technology iGEM Team 2010 Homepage

mainbanner

9/26-10/2

9/27/2010

Goals

PCR purify digests of building blocks from 9/25/2010
Start first round of ligations for each construct
Check ligations on gel
Digest; troubleshoot ligations if necessary

Protocols

PCR Purification of Digests from 9/25/2010 (Ompa FR , AOX1a/b FR and FR2, RFP F2R)

Reactions I am purifying:

RFP-F2R (NdeI, SpeI)

OmpA FR (NotI, XmaI)

Aox1a-FR (Xma, SpeI)

Aox1a-FR2 (Xma, NdeI)

Aox1b-FR (Xma, SpeI)

Aox1b-FR2 (Xma, NdeI)

See Protocols page for PCR Purification

Nanospec of Purified digests

RFP-F2R (NdeI, SpeI)= 28.6 ng/uL

OmpA FR (NotI, XmaI)= 15 ng/uL

Aox1a-FR (Xma, SpeI)= 12 ng/uL

Aox1a-FR2 (Xma, NdeI)= 25 ng/uL

Aox1b-FR (Xma, SpeI)= 23 ng/uL

Aox1b-FR2 (Xma, NdeI)= 21.3 ng/uL

Ligations

hyb= [26.2 ng/ul ]/ 393 bp = 0.067 eq/uL

ompa = [15 ng/uL]/81 bp = 0.185 eq/uL

Ligation of HyBb+ Ompa

5.7 uL H20

2 uL of HybB

0.8 uL of Ompa

1 uL 10x Ligase Buffer

0.5 uL T4 Ligase (enzyme-- keep in freezer-- add last of all)

Total 10 uL

RT for 1 hr. - Start time: 11:25 am

Aliquot T4 Buffer:

Make aliquots (5 uL) of the T4 Ligase Buffer so as to not continuously repeat freeze-thaw cycles.

USE FROM ALIQUOTS FROM NOW ON - NOT THE GREEN-CAPPED EPPENDORF.

Miniprep of pSB1A3+hybB+ompA

1. Remove inoculation tubes from inoculation (37C shaker).

2. Obtain P1 buffer from 4C refrigerator.

3. Take centrifuge tubes and add 1.5mL of inoculated cells.

4. Centrifuge at 3000 rpm (low) for 1-2 min.

5. Spin until white pellet of cells forms at the bottom and liquid is more clear.

6. Take off supernatant and discard.

7. Repeat steps 4-6.

8. Resuspend pelleted bacterial cells in 250սL P1 buffer.

9. Add 250սL P2 buffer and invert 4-6 times (DO NOT VORTEX - doing so will shear DNA!)

10. Add 350սL buffer N3 and immediately invert 4-6 times.

11. Centrifuge for 10 min. at 13,000 rpm.

12. Take supernatant and add to spin columns.

13. Spin 30-60 sec. and discard flow through.

14. Wash column with 750սL buffer PE and centrifuge 1 min.

15. Discard flow through and centrifuge and additional minute.

16. Please column into a clean 1.5mL microcentrifuge tube.

17. Elute DNA by adding 30սL dH2O.

18. Let stand for 1 min., then centrifuge for 1 min.

Making a 1 % gel

25*4=100 mL

We found that we had extra left over.

Start at 1:13 pm

End: 2:13 pm

PCR of Hyb+OmpA ligation

3 uL of product of ligation reaction

25.5 uL H2O

10 uL PHUSION 5X Reaction buffer

5 uL HybB-F forward primer

5 uL OmpA-R reverse primer

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

Start: 12:57 pm

End: 3:00 pm (approx)

Plan:

Once PCR is finished, run 4 uL of the reaction on the gel. Check for a band running at a size of 393+81=474 bp, so approximately mid 400-500 bp. If band is observed, prepare for the digest (check for the RE sites based on what primers were used).

Gel Picture

insert gel pic from computer

band around 500 bp.

Nanospec PCR

Christina

326 ng/uL

BASIC PLAN FOR BUILDING PLASMID CONSTRUCTS

from the primered building blocks, which are stored in our freezer

A) RUN GEL - 2 uL each - to check size - this step completed for all building blocks

B) PCR PURIFY leftovers - this step completed for all building blocks

C) NANOSPEC - record concentrations - this step completed for all building blocks

D) DIGEST with restriction enzymes, overnight

E) PCR PURIFY digestion products

F) LIGATION of gene building blocks - we are starting with HybB & RFP

G) PCR ligation products, HybB-RFP

H) DIGEST products, HybB-RFP

I) RUN GEL on small amount of digestion products, HybB-RFP

J) PCR PURIFY the rest of the digestion products, HybB-RFP

K) DIGEST the vector - we are using pBS1A3

L) PCR PURIFY the vector

M) LIGATION of gene with vector, HybB-RFP and pBS1A3

N) TRANSFORMATION of plasmid into E. coli, run overnight

Note- Do a nanospec after PCR purifications

NOTES:

Steps in BOLD are going to be repeated with each plasmid construct. Steps A,B, and C have already been done for each building block and won’t be repeated unless there is a specific issue with a particular building block.
Steps K and L do not necessarily need to wait until step J is completed to be run. They are listed this way so there is no confusion about what is being digested or PCR purified at each step.

9/28/2010

Results from 9/27/2010:

The gel picture of the hybB+ompa is in the folder.

The band is bright at 500 bp, and our predictions confirm the results.
Nanospec results - 326.6 ng/uL
Goals for 9/28/10: PCR purify the PCR (in the yellow box)

Experimental Procedures:

1. Make cryostocks of mRFP:NB cells from starter cultures made on 9/27/2010. 900uL cells+100uL DMSO. Stored in -80C fridge in Gaucher Lab (iGEM box).

Notes

Christina+Rob PCR purified the hyb+ompa PCR.
Richard suggested we can PCR Aox+RFP, then pcr that to the hyb+ompa. This wil take care of two constructs. The other two require Aox a/b to be attached to the hybb+ompa construct
For the constructs that have Aox+RFP, we can do a ligation of Aox to RFP; then, PCR that part and ligate it to the Hyb+ompa.

For the AOX-RFP constructs:

Ligate Aox1a-FR2 to RFP-F2R
LigateAox1b-FR2 to RFP-F2R
PCR each ligation reaction
PCR purify
Check results on gel

Gel extract if PCR results in multiple bands

Digest the Aox-RFP construct
PCR purify
Ligate the Aox-RFP digests to Hyb-Ompa digest
PCR the entire constructs

For the HybB-Ompa-Aox constructs:

Ligate the HybB-Ompa to Aox1a-FR or Aox1b-FR
PCR the constructs
PCR Purify
Check results on gel

if multiple bands, gel extract

Ligate Hyb-Ompa-Aox to pSB1A3
Transform into cells or PCR entire vector

9/29/2010

Goals

Ligate Aox1a-FR2 to RFP-F2R (1hr) -COMPLETED
LigateAox1b-FR2 to RFP-F2R (1hr at same time as step 1) -COMPLETED
Digest HybB.Ompa (3 hours) - COMPLETED

PCR purify hybB.ompA -COMPLETED
Ligate the digested, purified HybB-Ompa to Aox1a-FR -COMPLETED
Ligate the digested, purified HybB-Ompa to Aox1b-FR -COMPLETED

PCR each ligation reaction (3 hr, run simultaneously)

Use Phusion Polymerase
Only 3 ul or so is needed for the PCR
PCR volume can be 30 or 50 uL (50 works fine and gets us lots of DNA)

PCR purify (45 mins max)
Check results on gel (40 mins max)

Gel extract if PCR results in multiple bands (1hr)

Digest the Aox-RFP construct (3 hours or overnight)

Protocols

Make sure all products are digested

hyb.ompa is not digested, so start that today

Ligation of AOX1a-FR2 to RFP-F2R (Scott)

using AOX1a-FR2 from 9/27/2010 and RFP-F2R from 9/27/2010

Calculating equivalents:

RFPF2R- [ 29 ng/uL]/678 bp= 0.0428 eq/uL

AOX1a-FR2-[ 25 ng/uL]/1035 bp = 0.0242 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation:

1.1 uL of RFP F2R

2 uL of AOX1a-FR2

1 uL 10x Ligase Buffer

5.4 uL H20

0.5 uL T4 Ligase

Total=10 uL

Leave RT for 1 hour

Started 10:42 am

Ligation of AOX1b-FR2 to RFP-F2R (Scott)

using AOX1a-FR2 from 9/27/2010 and RFP-F2R from 9/27/2010

Calculating equivalents:

RFP F2,R- [ 29 ng/uL]/678 bp= 0.0428 eq/uL

AOX1b F,R2-[ 21.3 ng/uL]/1047 bp = 0.0203 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation:

1 uL of RFP F2R

2 uL of Aox1b-FR2

1 uL 10x Ligase Buffer

5.5 uL H20

0.5 uL T4 Ligase

Total=10 uL

Leave RT for 1 hour

Started 10:42 am

Digest of HybB.Ompa (Christina)

17 uL of Hyb.Ompa (58.2 ng/uL)

8.5 uL h20

3 uL 10x Buffer B (Promega)

0.75 uL EcoRI

0.75 uL XmaI

Total= 30 uL

37c heating block (with water) for 3 hours

Start: 10:00 pm

End: 1pm

Following digestion, perform a PCR purification according to kit instructions. (See Protocols page for PCR Purification)

Nanospec results of purified, digested hybB.OmpA: 4.1 ng/uL

PCR of Aox1a-FR2.RFP ligation

3 uL of product of ligation reaction

25.5 uL H2O

10 uL PHUSION 5X Reaction buffer

5 uL Aox1a-F forward primer

5 uL RFP-R reverse primer

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

PCR of Aox1b-FR2.RFP ligation

3 uL of product of ligation reaction

25.5 uL H2O

10 uL PHUSION 5X Reaction buffer

5 uL Aox1b-F forward primer

5 uL RFP-R reverse primer

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

PCR ended at 3- Scott and Christina will grab them.

The tube labels could not be read! The tubes were crushed- I have had this happen to me as well. Slight pressure is sufficient. I don’t know which one is aox1a+rfp or aox1b+rfp. I assume the one that looked like “b” is aox1b. PCRS are the in yellow box- I put pcrs in there usually. Note: (@Scott - I (Christina) looked again at the tubes and I think they were labelled “1” and “2” - I in front of the ones you put in the yellow box to verify)

Heat shock transformation of the plasmids into our bacteria

10 սL BL21 cells + 5 սL of plasmid

See Protocols page for Heat Shock Transformation

Picked colonies from plates of HybB+RFP and added to 25 ul of water each. Used 5 ul for PCR, and added 250 ul of LB media to the rest. These tubes are in a green holder in the 37 degrees incubator.

Colony PCR of Hyb.RFP

5 uL of cells

25.5 uL H2O

10 uL GOTAQ 5X Reaction buffer

5 uL HybB-F forward primer

5 uL RFP-R reverse primer

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, TAQ

Total Volume= 50 uL

10 tubes in Block B. Should end at 5 pm. First 5 tubes are from plate 1, and the -10 are from plate 2. Wrote details in Scott’s notebook. Ran out of GOTAQ enzymed for tube 10. Got some from Ryan for this specific PCR, but still ran out =/ So tube 10 may have funky results.

nanospec of digested and purified hybB.ompA: 4.1 ng/uL

Ligation of AOX1a-FR to HybB.Ompa

using purified, digested AOX1a-FR from 9/27/2010 and digested Hyb.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa - [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1a-FR-[ 12 ng/uL]/1035 bp = 0.0116 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation:

2 uL of Aox1a-FR -

2.5 uL of Hyb.Ompa-

1 uL 10x Ligase Buffer-

4 uL H20 -

0.5 uL T4 Ligase

Total=10 uL

leave in 4C overnight.labelled with an “A” on top.

Ligation of AOX1b-FR to HybB.Ompa

using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL

for linear ligations, use a 1:1 ratio of products

Ligation:

1 uL of Aox1b-FR -

2.4 uL of Hyb.Ompa

1 uL 10x Ligase Buffer

5.1 uL H20

0.5 uL T4 Ligase

Total=10 uL

leave in 4C overnight - labelled with a “B” on top.

9/30/2010

Goals

Check results form 9.29.2010
Richard/Megan suggested we can do a double ligation for:

[HybB.OmPa.AOX1a-FR.]+[pSB1A3]
[HybB.OmPa.AOX1b-FR].+[pSB1A3]

Similarly, we can do a triple ligation of:

[Hyb.Ompa]+[Aox1a-FR2.RFP]+[pSB1A3]
[Hyb.Ompa]+[Aox1b-FR2.RFP]+[pSB1A3]

Results from 9/29/2010

Plates from 9/29/2010 of the hyb+rfp construct have many red colonies. Each colony has a red center and brownish outer ring surrounding that center.

I put the plates in the refrigerator.

Two gels were prepared to check the results from 9/29:

Gel 1:

Lane 1: 1KB Ladder

Lane 2: Colony pcr tube 1

Lane 3: Colony pcr tube 2

Lane 4: Colony pcr tube 3

Lane 5: Colony pcr tube 4

Lane 6: Colony pcr tube 5

Lane 7: Colony pcr tube 6

Lane 8: Colony pcr tube 7

Results:

Gel 2:

Lane 1: 1KB Ladder

Lane 2: Colony tube 8

Lane 3: Colony tube 9

Lane 4: Colony tube 10

Lane 5: [Aox1a-FR2.RFP] (9.29.2010)

Lane 6: [Aox1b-FR2.RFP] (9.29.2010)

Lane 7:

Lane 8:

Results:

Results

The pcrs of Aoxa/b+RFP do not appear clean. The predicted 1700 bp is very faint. We need to troubleshoot !

Successful tubes (All except 7 + 10) placed in 37C shaker in Gauche lab at 3:00pm

Protocols

Ask Richard/Megan volume for triple ligation. Do we need to check concentration of ligations?

I have laid out the proposed double ligation recipes, but check with Richard/Megan. I predict the triple ligations are similar except less water will be used .

What is our plan- do digests from the ligations, or PCR them up and then digest?

PCR of hybB.ompA-Aox1a F,R ligation (Christina)

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL PHUSION 5X Reaction buffer-

5 uL hybB forward primer-

5 uL AOX1a reverse primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

labelled “A, 9-30-10”

PCR of hybB.ompA-Aox1b F,R ligation (Christina)

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL PHUSION 5X Reaction buffer-

5 uL hybB forward primer-

5 uL AOX1B reverse primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

labelled “B, 9-30-10”

Gel for hyb.ompa.aox1a/b PCRs

order:

Lane 1:1kb ladder|

Lane 2: HybB.OmPa.AOX1a-FR (predicted=1509)

Lane 3: HybB.OmPa.AOX1b-FR (predicted=1521 bp)

Results

Inconclusive- the predicted bands do not appear.

List of what is done now:

[HybB.OmPa.AOX1a-FR.] (low volume) (ligations)

[HybB.OmPa.AOX1b-FR] (low volume) (ligations)

[HybB.OmPa.AOX1a-FR] (pcr) (loaded on gel 9.30.2010) (troubleshoot)

[HybB.OmPa.AOX1b-FR] (pcr) (loaded on gel 9.30.2010) (troubleshoot)

[Aox1a-FR2.RFP] (pcr) (doing gel extract today)

[Aox1b-FR2.RFP] (pcr) (doing gel extract today)

[hyb.RFP] (in NB and BL21) (create expression profile)

Notes:

Troubleshooting the

[HybB.OmPa.AOX1a-FR] and [HybB.OmPa.AOX1b-FR] :

make sure elongation time is 2 minutes
make thermocycler compatible with lowest melting temp of primers
troubleshoot pcr by making shorter pcr products, like ompa+aox or hyb+ompa, to make sure template is there
Or just not do PCR and do a triple ligation

[Aox1a-FR2.RFP] and [Aox1b-FR2.RFP]:

Richard suggested we gel extract the aox1a/b+RFP

Triple Ligation of AOX1a/b-FR to HybB.Ompa and pSB1a3(Gita)

using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL

pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL

for linear ligations, use a 2:2:1 ratio of products:product:vector

Ligation:

1.2 uL of Aox1b-FR -

2 uL of Hyb.Ompa

3 ul pSB1A3

1 uL 10x Ligase Buffer

2.3 uL H20

0.5 uL T4 Ligase

Total=10 uL

leave in 4C overnight - labelled with a “B” on top.

Triple Ligation of AOX1a/b-FR to HybB.Ompa and psb1a3 (Gita)

using AOX1a-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1a-FR -[ 25 ng/uL]/1035 bp = 0.0241 eq/uL

pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL

for linear ligations, use a 2:2:1 ratio of products:product:vector

Ligation:

1.4 uL of Aox1a/b-FR -

2 uL of Hyb.Ompa

3 ul pSB1A3

1 uL 10x Ligase Buffer

2.1 uL H20

0.5 uL T4 Ligase

Total=10 uL

leave in 4C overnight - labelled with a “B” on top.

Repeat PCR of hybB.ompA+Aox1a F,R ligation (Christian)

5 uL of product of ligation reaction -

23.5 uL H2O-

10 uL PHUSION 5X Reaction buffer-

5 uL hybbB F primer-

5 uL AOX1a R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

Started 6:50pm

iGEM 2

Changed extension time to 2 mins

Labeled “A” on top and sides

PCR of hybB.ompA+Aox1b F,R ligation (Christian)

5 uL of product of ligation reaction -

23.5 uL H2O-

10 uL PHUSION 5X Reaction buffer-

5 uL hybB F primer-

5 uL AOX1B R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, PHUSION

Total Volume= 50 uL

Started 6:50pm

iGEM 2

Changed extension time to 2 mins

Labeled “B” on top and sides

1% Gel for gel extraction for aox1a-FR2 +RFP, aox1b-FR2+RFP

Notes- about 70-80 mL

See Protocols page for Preparing 1% Agarose Gels

Loading Gel for Gel Extract (going to perform 7pm today)

order:

empty....empty|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP

[loaded 40 ul of each pcr reaction, 9.5 ul of ladder]

start 6:40 pm

Before Gel Extraction

|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP

Targeting the 1500 bp bands

AfterGel Extraction

|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP

Gel Extraction

Notes: similar to the previous ones, elute in 30 uL of water

For Tomorromow

Nanospec the gel extractions and run on gel to check for 1500 bp band
Order Primers!!:

Sequencing Primers for PSB1A3

20-30 bp bindign region

Tm~60

psb1a3-R1

5’ tcgccggcgacgtcag 3’; Tm=62, GC=75%

psb1a3-F1

5’ tccttagctttcgctaaggatgatttctg 3’ tTM=60 GC=41%

Make sequence files for all constructs!
Troubleshoot

[HybB.OmPa.AOX1a-FR] (pcr) (loaded gel 9.30.2010) (troubleshoot) (repeated PCR today)
[HybB.OmPa.AOX1b-FR] (pcr) (loaded gel 9.30.2010) (troubleshoot) (repeated PCR today)
[Aox1a-FR2.RFP] (pcr) (did gel extract today)(but PCR was messy)
[Aox1b-FR2.RFP] (pcr) (did gel extract today)(but PCR was messy)

10/1/2010

Goals

Run gel to check for:

Gel extractions to check for 1500 bp band (aox+rfp)
PCRs of:

[HybB.OmPa.AOX1a-FR] (from 9.30.2010)
[HybB.OmPa.AOX1b-FR] (from 9.30.2010)

Running Gel (Scott)
Predicted:

[HybB.OmPa.AOX1a-FR] ~1500 bp
[HybB.OmPa.AOX1b-FR]~1500 bp
[Aox1a+RFP]~1700 bp
[Aox1b+RFP~1700 bp

Results

The PCRs of Hyb.Ompa.Aox were vey messy- PCR purify them and run them again on a gel

Gel (Version 1) order:

1kb ladder|PCR of HybB.OmPa.AOX1a-FR|PCR of HybB.OmPa.AOX1b-FR|Gel extract of Aox1a+RFP|empty well| Gel extract of Aox1b+RFP| 1 kb ladder

Gel (Version 2) (Same as Version 1)
For Mitesh, Margo

I ran wrong PCR- Run on gel the PCR labeled from 9.30.2010 as “Repeat” with Christian’s name on it.
Gel extraction has two bands- one is the 1700 one we want, the other isn’t. We need to plan how get the 1700 one; perhaps another gel extract?
We need annotated sequence files-Richard has some starting ones.
We need to design sequencing primers for all the parts once they are in pSB1A3
Debika- Start starter cultures of colonies 9,10, 5 ,6 of hyb+RFP

Protocols

Gel of Repeated PCRs:

Lane 2 [HybB.OmPa.AOX1a-FR] (from 9.30.2010)
Lane 3 [HybB.OmPa.AOX1b-FR] (from 9.30.2010)
Ladder in lane 1 (left most well)

PCRs to troubleshoot hyb.ompa.aox pcrs

PCR of hybB.ompA.Aox1a F,R ligation using Hyb-F and OmpaR [tube label 1]

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL Gotaq 5X Reaction buffer-

5 uL hybB F primer-

5 uL Ompa R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, Gotaq

Total Volume= 50 uL

PCR of hybB.ompA.Aox1b F,R ligation using Hyb-F and OmpaR [tube label 2]

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL Gotaq 5X Reaction buffer-

5 uL hybB F primer-

5 uL Ompa R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, Gotaq

Total Volume= 50 uL

PCR of hybB.ompA.Aox1a F,R ligation using OmpaF and Aox1a-R [tube label 3]

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL Gotaq 5X Reaction buffer-

5 uL Ompa F primer-

5 uL AOX1a R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, Gotaq

Total Volume= 50 uL

PCR of hybB.ompA.Aox1b F,R ligation using OmpaF and Aox1b-R [tube label 4]

3 uL of product of ligation reaction -

25.5 uL H2O-

10 uL Gotaq 5X Reaction buffer-

5 uL
5 uL Ompa F primer-

5 uL AOX1B R primer-

1 uL dNTP 10 mM - (thawed & kept on ice)

0.5 uL polymerase enzyme, Gotaq

Total Volume= 50 uL

Suggestions

Dr. Gaucher suggested doing a PCR purification of the Ligation reactions, since PCR is sensitive to salts and buffers.

Also a gradient would be useful.

Try increasign annealing temp to 56 or so, 52 is too low he said!

Triple Ligation

richard suggested triple ligation, screen with 20 colonies

Sequences

Primers:

Ompa_3’ end_F_Seq

5’ GCTACCGTTGCGCAAGCT3’

tm=60

GC= 61%

Hybb_3’ end_F_Seq

5’ GCCGCCACCATGGGGTTAAGTAG 3’

tm=63

GC= 61%

Sequencing Primers for PSB1A3

20-30 bp binding region

Tm~60

psb1a3-R1

5’ tcgccggcgacgtcag 3’; Tm=62, GC=75%

psb1a3-F1

5’ tccttagctttcgctaaggatgatttctg 3’ tTM=60 GC=41%

Primer to construct hyb.omp.rfp

RFP-F3

5’[GAGAGA ][CCCGGG]ATGGCGTCTTCTGAAGACGTTAT

RE from RFP-F2 replaced with an XmaI site

For Tomorrow

(Check to make sure the proposed actions for tomorrow make sense!)

Troubleshooting the PCR of hyb.ompa.aox

run the troubleshooting PCRs Margo did today on a gel to check results

Prepare the reactions needed to make hyb.ompa+aox+psb1a3 using a triple ligation

Digest the Pcr of hyb.ompa from
Ligate hyb.ompa+aox+psb1a3

Order primers!

10/2/2010

Goals

If Gaucher lab is open, run results on gel and visualize
Else, start Triple ligation

Do we start from the digested products we have or start from scratch?

Problem: we didn’t transform the triple ligation (hyb.ompa+aox+psb1a4) from 9.30.2010 that Gita did! We can transform that today and start a new triple ligation, and make sure to transform that tomorrow
Make cryo stocks of starter cultures

Protocols:

Heat shock transformation of the NB with triple ligations (hyb.ompa+aox_psb1a3) (Scott)

1. hyb.ompa+aox1a-FR+psb1a3

2. hyb.ompa+aoox1b-FR+psb1a3

10 սL Nova Blue cells + 5 սL of Ligation Reaction (hyb.ompa+aox+psb1a3) from 9.30.2010 that Gita did

See Protocols page for Heat Shock Transformation

Observations of Starter cultures

Culture1 has a slight pink hue, while culture 2 does not; the rest have pink hues less than that of culture 1.

CryoStocks of Start cultures from 10.1.2010 of hyb+RFP+psb1a3 in BL21

Cryostocks

Colonies 1,2,3,4,5,6,8 of HybB+RFP+pSB1A3 in Bl21 cells

600 uL of cells

900 uL Glycerol

Total 1.5 mL

Mix, place in -80c Freezer

Repeat of Triple Ligations (hyb.ompa +aox+psb1a3)

Triple Ligation of AOX1a-FR to HybB.Ompa and psb1a3 (Margo)

using AOX1a-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1a-FR -[ 25 ng/uL]/1035 bp = 0.0241 eq/uL

pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL

for linear ligations, use a 2:2:1 ratio of products:product:vector

Ligation:

1.4 uL of Aox1a/b-FR -

2 uL of Hyb.Ompa

3 ul pSB1A3

1 uL 10x Ligase Buffer

2.1 uL H20

0.5 uL T4 Ligase

Total=10 uL

1 hr RT, labeled A

Ligation Start: 1:14 pm

Triple Ligation of AOX1b-FR to HybB.Ompa (Margo)

using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010

Calculating equivalents:

HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL

AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL

pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL

for linear ligations, use a 2:2:1 ratio of products:product:vector

Ligation:

1.2 uL of Aox1b-FR -

2 uL of Hyb.Ompa

3 ul pSB1A3

1 uL 10x Ligase Buffer

2.3 uL H20

0.5 uL T4 Ligase

Total=10 uL

1 hr RT labeled B

Ligation Start: 1:14 pm

Checking PCR from 10.1.2010 on Gel

Gel start 1:11 pm

Order :

1kb ladder|PCR 1|PCR 2|PCR3|PCR 4 hyb+ompa from 9.28.2010|ladder

PCR1= PCR of hybB.ompA.Aox1a F,R ligation using Hyb-F and OmpaR

PCR2= PCR of hybB.ompA.Aox1b F,R ligation using Hyb-F and OmpaR

PCR3= PCR of hybB.ompA.Aox1a F,R ligation using OmpaF and Aox1a-R

PCR4= PCR of hybB.ompA.Aox1b F,R ligation using OmpaF and Aox1a-R

Observations of Gel

Well 3 (the empty one) should not be empty! Perhaps misloaded?

Heat shock transformation of the NB with triple ligations (HybB.OmpA+AOX_psb1a3) (Margo)

1. hyb.ompa+aox1a-FR+psb1a3 (from 10.2.2010)

2. hyb.ompa+aoox1b-FR+psb1a3 (from 10.2.2010)

10 սL Nova Blue cells + 5 սL of Ligation Reaction (hyb.ompa+aox+psb1a3) from 2 OCT 2010 that Margo did

See Protocols page for Heat Shock Transformation

For Tomorrow

Run on a gel

aoxa, aoxb next to the troubleshooting pcrs from today, specifically of the PCRS using Ompa-F and Aoxa/b-R since they are similar sizes

Take out plates from incubator. Record observations

Run colony PCRs on at least 20 colonies per construct (yes 20)

Check which primers to use for colony pcr! We can likely use the primers we already have
Run results on gel

@@ Line 74: / Line 74: @@
    </map>
 </a></p>
-<title>9/26-10/2</title><style type="text/css">ol{margin:0;padding:0}p{margin:0}.c0{color:#ffffff;font-size:10pt;font-family:Arial;font-weight:bold}.c4{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:36.0pt}.c13{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:144.0pt}.c1{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:72.0pt}.c7{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:108.0pt}.c2{color:#ffffff;font-size:10pt;font-family:Arial}.c3{line-height:1.15;text-indent:0pt;direction:ltr}.c14{list-style-type:square}.c15{list-style-type:lower-latin}.c10{margin-left:36.0pt}.c9{background-color:#ffffff}.c8{list-style-type:circle}.c6{text-decoration:underline}.c12{list-style-type:lower-roman}.c16{list-style-type:decimal}.c5{list-style-type:disc}.c11{font-style:italic}</style></head><body class="c9"><p class="c3"><span class="c0">9/27/2010</span></p><p class="c3"><span class="c2 c6">Goals</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">PCR purify digests of building blocks from 9/25/2010</span></li><li class="c4"><span class="c2">Start first round of ligations for each construct</span></li><li class="c4"><span class="c2">Check ligations on gel</span></li><li class="c4"><span class="c2">Digest; troubleshoot ligations if necessary</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Protocols</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR Purification of Digests from 9/25/2010</span><span class="c2"> (Ompa FR , AOX1a/b FR and FR2, RFP F2R)</span></p><p class="c3"><span class="c2">Reactions I am purifying:</span></p><p class="c3"><span class="c2">RFP-F2R (NdeI, SpeI)</span></p><p class="c3"><span class="c2">OmpA FR (NotI, XmaI)</span></p><p class="c3"><span class="c2">Aox1a-FR (Xma, SpeI)</span></p><p class="c3"><span class="c2">Aox1a-FR2 (Xma, NdeI)</span></p><p class="c3"><span class="c2">Aox1b-FR (Xma, SpeI)</span></p><p class="c3"><span class="c2">Aox1b-FR2 (Xma, NdeI)</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0 c11">See Protocols page for PCR Purification</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Nanospec of Purified digests</span></p><p class="c3"><span class="c2">RFP-F2R (NdeI, SpeI)= 28.6 ng/uL</span></p><p class="c3"><span class="c2">OmpA FR (NotI, XmaI)= 15 ng/uL</span></p><p class="c3"><span class="c2">Aox1a-FR (Xma, SpeI)= 12 ng/uL</span></p><p class="c3"><span class="c2">Aox1a-FR2 (Xma, NdeI)= 25 ng/uL</span></p><p class="c3"><span class="c2">Aox1b-FR (Xma, SpeI)= 23 ng/uL</span></p><p class="c3"><span class="c2">Aox1b-FR2 (Xma, NdeI)= 21.3 ng/uL</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Ligations</span></p><p class="c3"><span class="c2">hyb= [26.2 ng/ul ]/ 393 bp = 0.067 eq/uL</span></p><p class="c3"><span class="c2">ompa = [15 ng/uL]/81 bp = 0.185 eq/uL</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Ligation of HyBb+ Ompa</span></p><p class="c3"><span class="c2">5.7 uL H20</span></p><p class="c3"><span class="c2"> 2 uL of HybB</span></p><p class="c3"><span class="c2"> 0.8 &nbsp;uL of Ompa </span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase (enzyme-- keep in freezer-- add last of all)</span></p><p class="c3"><span class="c2 c11">Total 10 uL</span></p><p class="c3"><span class="c2">RT for 1 hr. - Start time: 11:25 am</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Aliquot T4 Buffer:</span></p><p class="c3"><span class="c2">Make aliquots (5 uL) of the T4 Ligase Buffer so as to not continuously repeat freeze-thaw cycles. </span></p><p class="c3"><span class="c2">USE FROM ALIQUOTS FROM NOW ON - NOT THE GREEN-CAPPED EPPENDORF.</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Miniprep of pSB1A3+hybB+ompA</span></p><p class="c3"><span class="c2">1. Remove inoculation tubes from inoculation (37C shaker).</span></p><p class="c3"><span class="c2">2. Obtain P1 buffer from 4C refrigerator.</span></p><p class="c3"><span class="c2">3. Take centrifuge tubes and add 1.5mL of inoculated cells. </span></p><p class="c3"><span class="c2">4. Centrifuge at 3000 rpm (low) for 1-2 min. </span></p><p class="c3"><span class="c2">5. Spin until white pellet of cells forms at the bottom and liquid is more clear. </span></p><p class="c3"><span class="c2">6. Take off supernatant and discard. </span></p><p class="c3"><span class="c2">7. Repeat steps 4-6. </span></p><p class="c3"><span class="c2">8. Resuspend pelleted bacterial cells in 250&#1405;L P1 buffer. </span></p><p class="c3"><span class="c2">9. &nbsp;Add 250&#1405;L P2 buffer and invert 4-6 times (DO NOT VORTEX - doing so will shear DNA!)</span></p><p class="c3"><span class="c2">10. Add 350&#1405;L buffer N3 and immediately invert 4-6 times. </span></p><p class="c3"><span class="c2">11. Centrifuge for 10 min. at 13,000 rpm. </span></p><p class="c3"><span class="c2">12. Take supernatant and add to spin columns. </span></p><p class="c3"><span class="c2">13. Spin 30-60 sec. and discard flow through. </span></p><p class="c3"><span class="c2">14. Wash column with 750&#1405;L buffer PE and centrifuge 1 min. </span></p><p class="c3"><span class="c2">15. Discard flow through and centrifuge and additional minute.</span></p><p class="c3"><span class="c2">16. Please column into a clean 1.5mL microcentrifuge tube.</span></p><p class="c3"><span class="c2">17. Elute DNA by adding 30&#1405;L dH2O. </span></p><p class="c3"><span class="c2">18. Let stand for 1 min., then centrifuge for 1 min. </span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Making a 1 % gel </span></p><p class="c3"><span class="c2">25*4=100 mL</span></p><p class="c3"><span class="c2">We found that we had extra left over. </span></p><p class="c3"><span class="c2">Start at 1:13 pm</span></p><p class="c3"><span class="c2">End: 2:13 pm</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of Hyb+OmpA ligation </span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction</span></p><p class="c3"><span class="c2">25.5 uL H2O</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">PHUSION 5X Reaction buffer</span></p><p class="c3"><span class="c2">5 uL HybB-F forward primer </span></p><p class="c3"><span class="c2">5 uL OmpA-R reverse primer</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">PHUSION</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c2">Start: 12:57 pm</span></p><p class="c3"><span class="c2">End: 3:00 pm (approx)</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">Plan:</span></p><p class="c3"><span class="c2">Once PCR is finished, run 4 uL of the reaction on the gel. Check for a band running at a size of 393+81=474 bp, so approximately mid 400-500 bp. If band is observed, prepare for the digest (check for the RE sites based on what primers were used).</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Gel Picture</span></p><p class="c3"><span class="c2">insert gel pic from computer</span></p><p class="c3"><span class="c2">band around 500 bp. </span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Nanospec PCR</span></p><p class="c3"><span class="c2">Christina</span></p><p class="c3"><span class="c2">326 ng/uL</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0 c6">BASIC PLAN FOR BUILDING PLASMID CONSTRUCTS</span></p><p class="c3"><span class="c2">from the primered building blocks, which are stored in our freezer</span></p><p class="c3"><span class="c2">A) RUN GEL - 2 uL each - to check size - this step completed for all building blocks</span></p><p class="c3"><span class="c2">B) PCR PURIFY leftovers - this step completed for all building blocks</span></p><p class="c3"><span class="c2">C) NANOSPEC - record concentrations - this step completed for all building blocks</span></p><p class="c3"><span class="c0">D) DIGEST</span><span class="c2"> with restriction enzymes, overnight</span></p><p class="c3"><span class="c0">E) PCR PURIFY</span><span class="c2"> digestion products</span></p><p class="c3"><span class="c0">F) LIGATION</span><span class="c2"> of gene building blocks - we are starting with HybB &amp; RFP</span></p><p class="c3"><span class="c0">G) PCR </span><span class="c2">ligation products, HybB-RFP</span></p><p class="c3"><span class="c0">H) DIGEST</span><span class="c2"> products, HybB-RFP</span></p><p class="c3"><span class="c0">I) RUN GEL</span><span class="c2"> on small amount of digestion products, HybB-RFP</span></p><p class="c3"><span class="c0">J) PCR PURIFY</span><span class="c2"> the rest of the digestion products, HybB-RFP</span></p><p class="c3"><span class="c0">K) DIGEST</span><span class="c2"> the vector - we are using pBS1A3</span></p><p class="c3"><span class="c0">L) PCR PURIFY</span><span class="c2"> the vector</span></p><p class="c3"><span class="c0">M) LIGATION </span><span class="c2">of gene with vector, HybB-RFP and pBS1A3</span></p><p class="c3"><span class="c0">N) TRANSFORMATION </span><span class="c2">of plasmid into E. coli, run overnight</span></p><p class="c3"><span class="c2 c6">Note- </span><span class="c2"> Do a nanospec after PCR purifications</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">NOTES:</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Steps in BOLD are going to be repeated with each plasmid construct. Steps A,B, and C have already been done for each building block and won&rsquo;t be repeated unless there is a specific issue with a particular building block.</span></li><li class="c4"><span class="c2">Steps K and L do not necessarily need to wait until step J is completed to be run. They are listed this way so there is no confusion about what is being digested or PCR purified at each step.</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0">9/28/2010</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c0">Results from 9/27/2010:</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">The gel picture of the hybB+ompa is in the folder.</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">The band is bright at 500 bp, and our predictions confirm the results.</span></li><li class="c1"><span class="c2">Nanospec results - 326.6 ng/uL</span></li><li class="c1"><span class="c2">Goals for 9/28/10: PCR purify the PCR (in the yellow box)</span></li><li class="c1"><span class="c2">&nbsp;</span></li></ol><p class="c3"><span class="c0">Experimental Procedures:</span></p><p class="c3"><span class="c2">1. Make cryostocks of mRFP:NB cells from starter cultures made on 9/27/2010. &nbsp;900uL cells+100uL DMSO. Stored in -80C fridge in Gaucher Lab (iGEM box).</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Notes</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Christina+Rob PCR purified the hyb+ompa PCR.</span></li><li class="c4"><span class="c2">Richard suggested we can PCR Aox+RFP, then pcr that to the hyb+ompa. This wil take care of two constructs. The other two require Aox a/b to be attached to the hybb+ompa construct</span></li><li class="c4"><span class="c2">For the constructs that have Aox+RFP, we can do a ligation of Aox to RFP; then, PCR that part and ligate it to the Hyb+ompa.</span></li></ol><ol class="c15"><li class="c1" value="1"><span class="c2">For the AOX-RFP constructs:</span></li></ol><ol class="c12"><li class="c7" value="1"><span class="c2">Ligate Aox1a-FR2 to RFP-F2R</span></li><li class="c7"><span class="c2">LigateAox1b-FR2 to RFP-F2R</span></li><li class="c7"><span class="c2">PCR each ligation reaction</span></li><li class="c7"><span class="c2">PCR purify</span></li><li class="c7"><span class="c2">Check results on gel</span></li></ol><ol class="c16"><li class="c13" value="1"><span class="c2">Gel extract if PCR results in multiple bands</span></li></ol><ol class="c12"><li class="c7" value="6"><span class="c2">Digest the Aox-RFP construct</span></li><li class="c7"><span class="c2">PCR purify</span></li><li class="c7"><span class="c2">Ligate the Aox-RFP digests to Hyb-Ompa digest</span></li><li class="c7"><span class="c2">PCR the entire constructs</span></li></ol><ol class="c15"><li class="c1" value="2"><span class="c2">For the HybB-Ompa-Aox constructs:</span></li></ol><ol class="c12"><li class="c7" value="1"><span class="c2">Ligate the HybB-Ompa to Aox1a-FR or Aox1b-FR</span></li><li class="c7"><span class="c2">PCR the constructs</span></li><li class="c7"><span class="c2">PCR Purify</span></li><li class="c7"><span class="c2">Check results on gel</span></li></ol><ol class="c16"><li class="c13" value="1"><span class="c2">if multiple bands, gel extract</span></li></ol><ol class="c12"><li class="c7" value="5"><span class="c2">Ligate Hyb-Ompa-Aox to pSB1A3</span></li><li class="c7"><span class="c2">Transform into cells or PCR entire vector</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0">9/29/2010</span></p><p class="c3"><span class="c2 c6">Goals</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Ligate Aox1a-FR2 to RFP-F2R (1hr) -COMPLETED</span></li><li class="c4"><span class="c2">LigateAox1b-FR2 to RFP-F2R (1hr at same time as step 1) -COMPLETED</span></li><li class="c4"><span class="c2">Digest HybB.Ompa (3 hours) &nbsp;- COMPLETED</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">PCR purify hybB.ompA -COMPLETED</span></li><li class="c1"><span class="c2">Ligate the digested, purified HybB-Ompa to Aox1a-FR &nbsp;-COMPLETED</span></li><li class="c1"><span class="c2">Ligate the digested, purified HybB-Ompa to Aox1b-FR -COMPLETED</span></li></ol><ol class="c5"><li class="c4" value="4"><span class="c2">PCR each ligation reaction (3 hr, run simultaneously)</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">Use Phusion Polymerase</span></li><li class="c1"><span class="c2">Only 3 ul or so is needed for the PCR</span></li><li class="c1"><span class="c2">PCR volume can be 30 or 50 uL (50 works fine and gets us lots of DNA)</span></li></ol><ol class="c5"><li class="c4" value="5"><span class="c2">PCR purify (45 mins max)</span></li><li class="c4"><span class="c2">Check results on gel (40 mins max)</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">Gel extract if PCR results in multiple bands (1hr)</span></li></ol><ol class="c5"><li class="c4" value="7"><span class="c2">Digest the Aox-RFP construct (3 hours or overnight)</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Protocols</span></p><p class="c3"><span class="c2">Make sure all products are digested</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">hyb.ompa is not digested, so start that today</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Ligation of AOX1a-FR2 to RFP-F2R (Scott)</span></p><p class="c3"><span class="c2">using AOX1a-FR2 from 9/27/2010 and RFP-F2R from 9/27/2010</span></p><p class="c3"><span class="c2 c11">Calculating equivalents:</span></p><p class="c3"><span class="c2">RFPF2R- [ 29 ng/uL]/678 bp= 0.0428 eq/uL</span></p><p class="c3"><span class="c2">AOX1a-FR2-[ 25 ng/uL]/1035 bp = 0.0242 eq/uL</span></p><p class="c3"><span class="c2">for linear ligations, use a 1:1 ratio of products</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Ligation:</span></p><p class="c3"><span class="c2">1.1 uL of RFP F2R</span></p><p class="c3"><span class="c2">2 uL of AOX1a-FR2</span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer</span></p><p class="c3"><span class="c2">5.4 uL H20</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase</span></p><p class="c3"><span class="c0">Total=10 uL</span></p><p class="c3"><span class="c2">Leave RT for 1 hour</span></p><p class="c3"><span class="c2">Started 10:42 am</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Ligation of AOX1b-FR2 to RFP-F2R (Scott)</span></p><p class="c3"><span class="c2">using AOX1a-FR2 from 9/27/2010 and RFP-F2R from 9/27/2010</span></p><p class="c3"><span class="c2 c11">Calculating equivalents:</span></p><p class="c3"><span class="c2">RFP F2,R- [ 29 ng/uL]/678 bp= 0.0428 eq/uL</span></p><p class="c3"><span class="c2">AOX1b F,R2-[ 21.3 ng/uL]/1047 bp = 0.0203 eq/uL</span></p><p class="c3"><span class="c2">for linear ligations, use a 1:1 ratio of products</span></p><p class="c3"><span class="c2 c6">Ligation:</span></p><p class="c3"><span class="c2">1 uL of RFP F2R</span></p><p class="c3"><span class="c2">2 uL of Aox1b-FR2</span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer</span></p><p class="c3"><span class="c2">5.5 uL H20</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase</span></p><p class="c3"><span class="c0">Total=10 uL</span></p><p class="c3"><span class="c2">Leave RT for 1 hour</span></p><p class="c3"><span class="c2">Started 10:42 am</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Digest of HybB.Ompa (Christina)</span></p><p class="c3"><span class="c2">17 uL of Hyb.Ompa (58.2 ng/uL)</span></p><p class="c3"><span class="c2">8.5 uL h20</span></p><p class="c3"><span class="c2">3 uL 10x Buffer B (Promega)</span></p><p class="c3"><span class="c2">0.75 uL EcoRI</span></p><p class="c3"><span class="c2">0.75 uL XmaI</span></p><p class="c3"><span class="c0">Total= 30 uL</span></p><p class="c3"><span class="c2">37c heating block (with water) for 3 hours</span></p><p class="c3"><span class="c2">Start: 10:00 pm</span></p><p class="c3"><span class="c2">End: 1pm</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">Following digestion, perform a PCR purification according to kit instructions. </span><span class="c0">(</span><span class="c0 c11">See Protocols page for PCR Purification)</span></p><p class="c3"><span class="c0 c11"> </span></p><p class="c3"><span class="c2">Nanospec results of purified, digested hybB.OmpA: 4.1 ng/uL</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of Aox1a-FR2.RFP ligation</span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction</span></p><p class="c3"><span class="c2">25.5 uL H2O</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">PHUSION 5X Reaction buffer</span></p><p class="c3"><span class="c2">5 uL Aox1a-F forward primer</span></p><p class="c3"><span class="c2">5 uL RFP-R reverse primer</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">PHUSION</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of Aox1b-FR2.RFP ligation</span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction</span></p><p class="c3"><span class="c2">25.5 uL H2O</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">PHUSION 5X Reaction buffer</span></p><p class="c3"><span class="c2">5 uL Aox1b-F forward primer</span></p><p class="c3"><span class="c2">5 uL RFP-R reverse primer</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">PHUSION</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">PCR ended at 3- Scott and Christina will grab them.</span></p><p class="c3"><span class="c2">The tube labels could not be read! The tubes were crushed- I have had this happen to me as well. Slight pressure is sufficient. I don&rsquo;t know which one is aox1a+rfp or aox1b+rfp. I assume the one that looked like &ldquo;b&rdquo; is aox1b. PCRS are the in yellow box- I put pcrs in there usually. &nbsp;Note: (@Scott - I (Christina) &nbsp;looked again at the tubes and I think they were labelled &ldquo;1&rdquo; and &ldquo;2&rdquo; - I in front of the ones you put in the yellow box to verify)</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Heat shock transformation of the plasmids into our bacteria</span></p><p class="c3"><span class="c2">10 &#1405;L BL21 cells + 5 &#1405;L of plasmid</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0 c11">See Protocols page for Heat Shock Transformation </span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">Picked colonies from plates of HybB+RFP and added to 25 ul of water each. Used 5 ul for PCR, and added 250 ul of LB media to the rest. These tubes are in a &nbsp;green holder in the 37 degrees incubator.</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Colony PCR of Hyb.RFP</span></p><p class="c3"><span class="c2">5 uL of cells</span></p><p class="c3"><span class="c2">25.5 uL H2O</span></p><p class="c3"><span class="c2">10 uL GOTAQ</span><span class="c0"> 5X Reaction buffer</span></p><p class="c3"><span class="c2">5 uL HybB-F forward primer</span></p><p class="c3"><span class="c2">5 uL RFP-R reverse primer</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, TAQ</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c0">10 tubes in Block B. Should end at 5 pm. First 5 tubes are from plate 1, and the -10 are from plate 2. Wrote details in Scott&rsquo;s notebook. Ran out of GOTAQ enzymed for tube 10. Got some from Ryan for this specific PCR, but still ran out =/ So tube 10 may have funky results.</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2 c6">nanospec of digested and purified hybB.ompA: </span><span class="c2">4.1 ng/uL</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Ligation of AOX1a-FR to HybB.Ompa</span></p><p class="c3"><span class="c2">using purified, digested AOX1a-FR from 9/27/2010 and digested Hyb.Ompa from 9/29/2010</span></p><p class="c3"><span class="c2 c11">Calculating equivalents:</span></p><p class="c3"><span class="c2">HybB.Ompa - [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c3"><span class="c2">AOX1a-FR-[ 12 ng/uL]/1035 bp = &nbsp;0.0116 eq/uL</span></p><p class="c3"><span class="c2">for linear ligations, use a 1:1 ratio of products</span></p><p class="c3"><span class="c2">Ligation:</span></p><p class="c3"><span class="c2">2 uL of Aox1a-FR -</span></p><p class="c3"><span class="c2">2.5 uL of Hyb.Ompa-</span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer-</span></p><p class="c3"><span class="c2">4 uL H20 -</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase</span></p><p class="c3"><span class="c0">Total=10 uL</span></p><p class="c3"><span class="c2">leave in 4C overnight.labelled with an &ldquo;A&rdquo; on top.</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Ligation of AOX1b-FR to HybB.Ompa</span></p><p class="c3"><span class="c2">using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c3"><span class="c2 c11">Calculating equivalents:</span></p><p class="c3"><span class="c2">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c3"><span class="c2">AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL</span></p><p class="c3"><span class="c2">for linear ligations, use a 1:1 ratio of products</span></p><p class="c3"><span class="c2">Ligation:</span></p><p class="c3"><span class="c2">1 uL of Aox1b-FR -</span></p><p class="c3"><span class="c2">2.4 uL of Hyb.Ompa</span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer</span></p><p class="c3"><span class="c2">5.1 uL H20</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase</span></p><p class="c3"><span class="c0">Total=10 uL</span></p><p class="c3"><span class="c2">leave in 4C overnight - labelled with a &ldquo;B&rdquo; on top.</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">9/30/2010</span></p><p class="c3"><span class="c2 c6">Goals</span></p><ol class=""><li class="c4" value="1"><span class="c2">Check results form 9.29.2010</span></li><li class="c4"><span class="c2">Richard/Megan suggested we can do a double ligation for:</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">[HybB.OmPa.AOX1a-FR.]+[pSB1A3]</span></li><li class="c1"><span class="c2">[HybB.OmPa.AOX1b-FR].+[pSB1A3]</span></li></ol><ol class="c5"><li class="c4" value="3"><span class="c2">Similarly, we can do a triple ligation of:</span></li></ol><ol class=""><li class="c1" value="1"><span class="c2">[Hyb.Ompa]+[Aox1a-FR2.RFP]+[pSB1A3]</span></li><li class="c1"><span class="c2">[Hyb.Ompa]+[Aox1b-FR2.RFP]+[pSB1A3]</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Results from 9/29/2010</span></p><p class="c3"><span class="c2">Plates from 9/29/2010 of the hyb+rfp construct have many red colonies. Each colony has a red center and brownish outer ring surrounding that center.</span></p><p class="c3"><span class="c2">I put the plates in the refrigerator.</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Two gels were prepared to check the results from 9/29:</span></p><p class="c3"><span class="c2">Gel 1:</span></p><p class="c3"><span class="c2">Lane 1: 1KB Ladder</span></p><p class="c3"><span class="c2">Lane 2: Colony &nbsp;pcr tube 1</span></p><p class="c3"><span class="c2">Lane 3: Colony pcr tube 2</span></p><p class="c3"><span class="c2">Lane 4: Colony &nbsp;pcr tube 3</span></p><p class="c3"><span class="c2">Lane 5: Colony pcr tube 4</span></p><p class="c3"><span class="c2">Lane 6: Colony pcr tube 5</span></p><p class="c3"><span class="c2">Lane 7: Colony pcr tube 6</span></p><p class="c3"><span class="c2">Lane 8: Colony pcr tube 7</span></p><p class="c3"><span class="c0">Results:</span></p><p class="c3"><img height="740.0" src="images/image2.png" width="569.0"></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2">Gel 2:</span></p><p class="c3"><span class="c2">Lane 1: 1KB Ladder</span></p><p class="c3"><span class="c2">Lane 2: Colony tube 8</span></p><p class="c3"><span class="c2">Lane 3: Colony tube 9</span></p><p class="c3"><span class="c2">Lane 4: Colony tube 10</span></p><p class="c3"><span class="c2">Lane 5: [Aox1a-FR2.RFP] (9.29.2010)</span></p><p class="c3"><span class="c2">Lane 6: [Aox1b-FR2.RFP] (9.29.2010)</span></p><p class="c3"><span class="c2">Lane 7:</span></p><p class="c3"><span class="c2">Lane 8:</span></p><p class="c3"><span class="c0">Results: </span><img height="800.0" src="images/image0.png" width="615.0"></p><p class="c3"><span class="c2 c6">Results</span></p><p class="c3"><span class="c2">The pcrs of Aoxa/b+RFP do not appear clean. The predicted 1700 bp is very faint. &nbsp; We need to troubleshoot !</span></p><p class="c3"><span class="c2">Successful tubes (All except 7 + 10) placed in 37C shaker in Gauche lab at 3:00pm</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Protocols</span></p><p class="c3"><span class="c2">Ask Richard/Megan volume for triple ligation. Do we need to check concentration of ligations?</span></p><p class="c3"><span class="c2">I have laid out the proposed &nbsp;double ligation recipes, but check with Richard/Megan. I predict the triple ligations are similar except less water will be used .</span></p><p class="c3"><span class="c2">What is our plan- do digests from the ligations, or PCR them up and then digest?</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of hybB.ompA-Aox1a F,R ligation (Christina)</span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction -</span></p><p class="c3"><span class="c2">25.5 uL H2O-</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">PHUSION 5X Reaction buffer-</span></p><p class="c3"><span class="c2">5 uL hybB forward primer-</span></p><p class="c3"><span class="c2">5 uL AOX1a reverse primer-</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">PHUSION</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">labelled &ldquo;A, 9-30-10&rdquo;</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of hybB.ompA-Aox1b F,R ligation (Christina)</span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction -</span></p><p class="c3"><span class="c2">25.5 uL H2O-</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">PHUSION 5X Reaction buffer-</span></p><p class="c3"><span class="c2">5 uL hybB forward primer-</span></p><p class="c3"><span class="c2">5 uL AOX1B reverse primer-</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">PHUSION</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">labelled &ldquo;B, 9-30-10&rdquo;</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2 c6">Gel for hyb.ompa.aox1a/b PCRs</span></p><p class="c3"><span class="c2">order:</span></p><p class="c3"><span class="c2">Lane 1:1kb ladder|</span></p><p class="c3"><span class="c2">Lane 2: HybB.OmPa.AOX1a-FR (predicted=1509)</span></p><p class="c3"><span class="c2">Lane 3: HybB.OmPa.AOX1b-FR (predicted=1521 bp)</span></p><p class="c3"><img height="781.0" src="images/image3.png" width="601.0"></p><p class="c3"><span class="c2 c6">Results</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Inconclusive- the predicted bands do not appear.</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">List of what is done now:</span></p><p class="c3"><span class="c2">[HybB.OmPa.AOX1a-FR.] &nbsp;(low volume) (ligations)</span></p><p class="c3"><span class="c2">[HybB.OmPa.AOX1b-FR] &nbsp;(low volume) (ligations)</span></p><p class="c3"><span class="c2">[HybB.OmPa.AOX1a-FR] (pcr) (loaded on gel 9.30.2010) (troubleshoot)</span></p><p class="c3"><span class="c2">[HybB.OmPa.AOX1b-FR] (pcr) (loaded on gel 9.30.2010) (troubleshoot)</span></p><p class="c3"><span class="c2">[Aox1a-FR2.RFP] (pcr) (doing gel extract today)</span></p><p class="c3"><span class="c2">[Aox1b-FR2.RFP] (pcr) (doing gel extract today)</span></p><p class="c3"><span class="c2">[hyb.RFP] (in NB and BL21) (create expression profile)</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Notes:</span></p><p class="c3"><span class="c2">Troubleshooting the</span></p><p class="c3"><span class="c2">[HybB.OmPa.AOX1a-FR] and [HybB.OmPa.AOX1b-FR] :</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">make sure elongation time is 2 minutes</span></li><li class="c4"><span class="c2">make thermocycler compatible with lowest melting temp of primers</span></li><li class="c4"><span class="c2">troubleshoot pcr by making shorter pcr products, like ompa+aox or hyb+ompa, to make sure template is there</span></li><li class="c4"><span class="c2">Or just not do PCR and do a triple ligation</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">[Aox1a-FR2.RFP] and [Aox1b-FR2.RFP]:</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Richard suggested we gel extract the aox1a/b+RFP</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Triple Ligation of AOX1a/b-FR to HybB.Ompa and pSB1a3(Gita)</span></p><p class="c3"><span class="c2">using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c3"><span class="c2 c11">Calculating equivalents:</span></p><p class="c3"><span class="c2">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c3"><span class="c2">AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL</span></p><p class="c3"><span class="c2">pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL</span></p><p class="c3"><span class="c2">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c3"><span class="c2">Ligation:</span></p><p class="c3"><span class="c2">1.2 uL of Aox1b-FR -</span></p><p class="c3"><span class="c2">2 uL of Hyb.Ompa</span></p><p class="c3"><span class="c2">3 ul pSB1A3</span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer</span></p><p class="c3"><span class="c2">2.3 uL H20</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase</span></p><p class="c3"><span class="c0">Total=10 uL</span></p><p class="c3"><span class="c2">leave in 4C overnight - labelled with a &ldquo;B&rdquo; on top.</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Triple Ligation of AOX1a/b-FR to HybB.Ompa and psb1a3 (Gita)</span></p><p class="c3"><span class="c2">using AOX1a-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c3"><span class="c2 c11">Calculating equivalents:</span></p><p class="c3"><span class="c2">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c3"><span class="c2">AOX1a-FR -[ 25 ng/uL]/1035 bp = 0.0241 eq/uL</span></p><p class="c3"><span class="c2">pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL</span></p><p class="c3"><span class="c2">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c3"><span class="c2">Ligation:</span></p><p class="c3"><span class="c2">1.4 uL of Aox1a/b-FR -</span></p><p class="c3"><span class="c2">2 uL of Hyb.Ompa</span></p><p class="c3"><span class="c2">3 ul pSB1A3</span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer</span></p><p class="c3"><span class="c2">2.1 uL H20</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase</span></p><p class="c3"><span class="c0">Total=10 uL</span></p><p class="c3"><span class="c2">leave in 4C overnight - labelled with a &ldquo;B&rdquo; on top.</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Repeat PCR of hybB.ompA+Aox1a F,R ligation (Christian)</span></p><p class="c3"><span class="c2">5 uL of product of ligation reaction -</span></p><p class="c3"><span class="c2">23.5 uL H2O-</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">PHUSION 5X Reaction buffer-</span></p><p class="c3"><span class="c2">5 uL hybbB F primer-</span></p><p class="c3"><span class="c2">5 uL AOX1a R primer-</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">PHUSION</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c2">Started 6:50pm</span></p><p class="c3"><span class="c2">iGEM 2</span></p><p class="c3"><span class="c2">Changed extension time to 2 mins</span></p><p class="c3"><span class="c2">Labeled &ldquo;A&rdquo; on top and sides</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of hybB.ompA+Aox1b F,R ligation (Christian)</span></p><p class="c3"><span class="c2">5 uL of product of ligation reaction -</span></p><p class="c3"><span class="c2">23.5 uL H2O-</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">PHUSION 5X Reaction buffer-</span></p><p class="c3"><span class="c2">5 uL hybB F primer-</span></p><p class="c3"><span class="c2">5 uL AOX1B R primer-</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">PHUSION</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c2">Started 6:50pm</span></p><p class="c3"><span class="c2">iGEM 2</span></p><p class="c3"><span class="c2">Changed extension time to 2 mins</span></p><p class="c3"><span class="c2">Labeled &ldquo;B&rdquo; on top and sides</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">1% Gel for gel extraction for </span><span class="c2"> aox1a-FR2 +RFP, aox1b-FR2+RFP</span></p><p class="c3"><span class="c2">Notes- about 70-80 mL</span></p><p class="c3"><span class="c0 c11">See Protocols page for Preparing 1% Agarose Gels</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Loading Gel for Gel Extract (going to perform 7pm today)</span></p><p class="c3"><span class="c2">order:</span></p><p class="c3"><span class="c2">empty....empty|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP</span></p><p class="c3"><span class="c2">[loaded 40 ul of each pcr reaction, 9.5 ul of ladder]</span></p><p class="c3"><span class="c2">start 6:40 pm</span></p><p class="c3"><img height="324.0" src="images/image1.png" width="328.0"><span class="c2 c11">Before Gel Extraction</span></p><p class="c3"><span class="c2">|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP</span></p><p class="c3"><span class="c2">Targeting the 1500 bp bands</span></p><p class="c3"><img height="288.0" src="images/image6.png" width="343.0"></p><p class="c3"><span class="c2 c11">AfterGel Extraction</span></p><p class="c3"><span class="c2">|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Gel Extraction</span></p><p class="c3"><span class="c2">Notes: similar to the previous ones, elute in 30 uL of water</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0">For Tomorromow</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Nanospec the gel extractions and run on gel to check for 1500 bp band</span></li><li class="c4"><span class="c2 c6">Order Primers!!:</span></li></ol><p class="c3"><span class="c2 c6">&nbsp;</span></p><p class="c3 c10"><span class="c2">Sequencing Primers for PSB1A3</span></p><p class="c3 c10"><span class="c2">20-30 bp bindign region</span></p><p class="c3 c10"><span class="c2">Tm~60</span></p><p class="c3 c10"><span class="c0">psb1a3-R1</span></p><p class="c3 c10"><span class="c2">5&rsquo; tcgccggcgacgtcag 3&rsquo;; Tm=62, GC=75%</span></p><p class="c3 c10"><span class="c0">psb1a3-F1</span></p><p class="c3 c10"><span class="c2">5&rsquo; tccttagctttcgctaaggatgatttctg &nbsp;3&rsquo; tTM=60 GC=41% &nbsp;</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Make sequence files for all constructs!</span></li><li class="c4"><span class="c2">Troubleshoot</span></li></ol><ol class="c5"><li class="c4" value="1"><span class="c2">[HybB.OmPa.AOX1a-FR] (pcr) (loaded gel 9.30.2010) (troubleshoot) (repeated PCR today)</span></li><li class="c4"><span class="c2">[HybB.OmPa.AOX1b-FR] (pcr) (loaded gel 9.30.2010) (troubleshoot) (repeated PCR today)</span></li><li class="c4"><span class="c2">[Aox1a-FR2.RFP] (pcr) (did gel extract today)(but PCR was messy)</span></li><li class="c4"><span class="c2">[Aox1b-FR2.RFP] (pcr) (did gel extract today)(but PCR was messy) &nbsp; &nbsp;</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0">10/1/2010</span></p><p class="c3"><span class="c2 c6">Goals</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Run gel to check for:</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">Gel extractions to check for 1500 bp band (aox+rfp)</span></li><li class="c1"><span class="c2">PCRs of:</span></li></ol><ol class="c14"><li class="c7" value="1"><span class="c2">[HybB.OmPa.AOX1a-FR] &nbsp;(from 9.30.2010)</span></li><li class="c7"><span class="c2">[HybB.OmPa.AOX1b-FR] (from 9.30.2010)</span></li></ol><ol class="c14"><li class="c7" value="1"><span class="c2">&nbsp;</span></li><li class="c7"><span class="c2 c6">Running Gel (Scott)</span></li><li class="c7"><span class="c2">Predicted:</span></li></ol><ol class="c5"><li class="c4" value="1"><span class="c2">[HybB.OmPa.AOX1a-FR] ~1500 bp</span></li><li class="c4"><span class="c2">[HybB.OmPa.AOX1b-FR]~1500 bp</span></li><li class="c4"><span class="c2">[Aox1a+RFP]~1700 bp</span></li><li class="c4"><span class="c2">[Aox1b+RFP~1700 bp</span></li></ol><ol class="c14"><li class="c7" value="1"><span class="c2 c6">Results</span></li></ol><ol class="c5"><li class="c4" value="1"><span class="c2">The PCRs of Hyb.Ompa.Aox were vey messy- PCR purify them and run them again on a gel</span><img height="351.0" src="images/image4.png" width="342.0"></li></ol><ol class="c14"><li class="c7" value="1"><span class="c2">Gel (Version 1) order:</span></li></ol><ol class="c5"><li class="c4" value="2"><span class="c2">1kb ladder|PCR of HybB.OmPa.AOX1a-FR|PCR of HybB.OmPa.AOX1b-FR|Gel extract of Aox1a+RFP|empty well| Gel extract of Aox1b+RFP| 1 kb ladder</span><img height="416.0" src="images/image8.png" width="372.0"></li></ol><ol class="c14"><li class="c7" value="1"><span class="c2">Gel (Version 2) (Same as Version 1)</span></li><li class="c7"><span class="c2">&nbsp;</span></li><li class="c7"><span class="c2">For Mitesh, Margo</span></li></ol><ol class="c5"><li class="c4" value="1"><span class="c2">I ran wrong PCR- Run on gel the PCR labeled from 9.30.2010 as &ldquo;Repeat&rdquo; with Christian&rsquo;s name on it.</span></li><li class="c4"><span class="c2">Gel extraction has two bands- one is the 1700 one we want, the other isn&rsquo;t. We need to plan how get the 1700 one; perhaps another gel extract?</span></li><li class="c4"><span class="c2">We need annotated sequence files-Richard has some starting ones.</span></li><li class="c4"><span class="c2">We need to design sequencing primers for all the parts once they are in pSB1A3</span></li><li class="c4"><span class="c2">Debika- Start starter cultures of colonies 9,10, 5 ,6 of hyb+RFP</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Protocols</span></p><p class="c3"><span class="c2 c6">Gel Pics</span><img height="362.0" src="images/image5.png" width="334.0"></p><p class="c3"><span class="c2 c11">Gel of Repeated PCRs:</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Lane 2 [HybB.OmPa.AOX1a-FR] &nbsp;(from 9.30.2010)</span></li><li class="c4"><span class="c2">Lane 3 [HybB.OmPa.AOX1b-FR] (from 9.30.2010)</span></li><li class="c4"><span class="c2">Ladder in lane 1 (left most well)</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">PCRs to troubleshoot hyb.ompa.aox pcrs</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of hybB.ompA.Aox1a F,R ligation using Hyb-F and OmpaR </span><span class="c2"> [tube label 1]</span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction -</span></p><p class="c3"><span class="c2">25.5 uL H2O-</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">Gotaq 5X Reaction buffer-</span></p><p class="c3"><span class="c2">5 uL hybB F primer-</span></p><p class="c3"><span class="c2">5 uL Ompa R primer-</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">Gotaq</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of hybB.ompA.Aox1b F,R ligation using Hyb-F and OmpaR </span><span class="c2">[tube label 2]</span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction -</span></p><p class="c3"><span class="c2">25.5 uL H2O-</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">Gotaq 5X Reaction buffer-</span></p><p class="c3"><span class="c2">5 uL hybB F primer-</span></p><p class="c3"><span class="c2">5 uL Ompa R primer-</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">Gotaq</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of hybB.ompA.Aox1a F,R ligation using &nbsp;OmpaF and Aox1a-R </span><span class="c2">[tube label 3]</span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction -</span></p><p class="c3"><span class="c2">25.5 uL H2O-</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">Gotaq 5X Reaction buffer-</span></p><p class="c3"><span class="c2">5 uL Ompa &nbsp;F primer-</span></p><p class="c3"><span class="c2">5 uL AOX1a R primer-</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">Gotaq</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2 c6">PCR of hybB.ompA.Aox1b F,R ligation using &nbsp;OmpaF and Aox1b-R </span><span class="c2">[tube label 4]</span></p><p class="c3"><span class="c2">3 uL of product of ligation reaction -</span></p><p class="c3"><span class="c2">25.5 uL H2O-</span></p><p class="c3"><span class="c2">10 uL </span><span class="c0">Gotaq 5X Reaction buffer-</span></p><p class="c3"><span class="c2">5 uL<br> 5 uL Ompa F primer-</span></p><p class="c3"><span class="c2">5 uL AOX1B R primer-</span></p><p class="c3"><span class="c2">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c3"><span class="c2">0.5 uL polymerase enzyme, </span><span class="c0">Gotaq</span></p><p class="c3"><span class="c0">Total Volume= 50 uL</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c0">Suggestions</span></p><p class="c3"><span class="c2">Dr. &nbsp;Gaucher suggested doing a PCR purification of the Ligation reactions, since PCR is sensitive to salts and buffers.</span></p><p class="c3"><span class="c2">Also a gradient would be useful.</span></p><p class="c3"><span class="c2">Try increasign annealing temp to 56 or so, 52 is too low he said!</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">Triple Ligation</span></p><p class="c3"><span class="c2">richard suggested triple ligation, screen with 20 colonies</span></p><p class="c3"><span class="c2 c6">Sequences</span></p><p class="c3"><span class="c2">Primers:</span></p><p class="c3"><span class="c0">Ompa_3&rsquo; end_F_Seq</span></p><p class="c3"><span class="c2">5&rsquo; GCTACCGTTGCGCAAGCT3&rsquo;</span></p><p class="c3"><span class="c2">tm=60</span></p><p class="c3"><span class="c2">GC= 61%</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0">Hybb_3&rsquo; end_F_Seq</span></p><p class="c3"><span class="c2">5&rsquo; GCCGCCACCATGGGGTTAAGTAG 3&rsquo;</span></p><p class="c3"><span class="c2">tm=63</span></p><p class="c3"><span class="c2">GC= 61%</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">Sequencing Primers for PSB1A3</span></p><p class="c3"><span class="c2">20-30 bp binding region</span></p><p class="c3"><span class="c2">Tm~60</span></p><p class="c3"><span class="c0">psb1a3-R1</span></p><p class="c3"><span class="c2">5&rsquo; tcgccggcgacgtcag 3&rsquo;; Tm=62, GC=75%</span></p><p class="c3"><span class="c0">psb1a3-F1</span></p><p class="c3"><span class="c2">5&rsquo; tccttagctttcgctaaggatgatttctg &nbsp;3&rsquo; tTM=60 GC=41% &nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">Primer to construct hyb.omp.rfp</span></p><p class="c3"><span class="c0">RFP-F3</span></p><p class="c3"><span class="c2">5&rsquo;[GAGAGA ][CCCGGG]ATGGCGTCTTCTGAAGACGTTAT</span></p><p class="c3"><span class="c2">RE from RFP-F2 replaced with an XmaI site</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">For Tomorrow</span></p><p class="c3"><span class="c2 c6">(</span><span class="c2">Check to make sure the proposed actions for tomorrow make sense!)</span></p><ol class=""><li class="c4" value="1"><span class="c2">Troubleshooting the PCR of hyb.ompa.aox</span></li></ol><ol class=""><li class="c1" value="1"><span class="c2">run the troubleshooting PCRs Margo did today on a gel to check results</span></li></ol><ol class="c5"><li class="c4" value="2"><span class="c2">Prepare the reactions needed to make hyb.ompa+aox+psb1a3 using a triple ligation</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">Digest the Pcr of hyb.ompa from</span></li><li class="c1"><span class="c2">Ligate hyb.ompa+aox+psb1a3</span></li></ol><ol class=""><li class="c4" value="3"><span class="c2">Order primers!</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0">10/2/2010</span></p><p class="c3"><span class="c2">Goals</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">If Gaucher lab is open, run results on gel and visualize</span></li><li class="c4"><span class="c2">Else, start Triple ligation</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">Do we start from the digested products we have or start from scratch?</span></li></ol><ol class=""><li class="c4" value="3"><span class="c2">Problem: we didn&rsquo;t transform the triple ligation (hyb.ompa+aox+psb1a4) from 9.30.2010 that Gita did! We can transform that today and start a new triple ligation, and make sure to transform that tomorrow</span></li><li class="c4"><span class="c2">Make cryo stocks of starter cultures</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Protocols</span><span class="c2">:</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Heat shock transformation of the NB with triple ligations (hyb.ompa+aox_psb1a3) (Scott)</span></p><p class="c3"><span class="c2">1. hyb.ompa+aox1a-FR+psb1a3</span></p><p class="c3"><span class="c2">2. hyb.ompa+aoox1b-FR+psb1a3</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">10 &#1405;L Nova Blue cells + 5 &#1405;L of Ligation Reaction (hyb.ompa+aox+psb1a3) from 9.30.2010 that Gita did</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0 c11">See Protocols page for Heat Shock Transformation </span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">Observations of Starter cultures</span></p><p class="c3"><span class="c2">Culture1 has a slight pink hue, while culture 2 does not; the rest have pink hues less than that of culture 1.</span></p><p class="c3"><span class="c2">CryoStocks of Start cultures from 10.1.2010 of hyb+RFP+psb1a3 in BL21</span></p><p class="c3"><span class="c2 c6">Cryostocks</span></p><p class="c3"><span class="c2">Colonies 1,2,3,4,5,6,8 of HybB+RFP+pSB1A3 in Bl21 cells</span></p><p class="c3"><span class="c2">600 uL of cells</span></p><p class="c3"><span class="c2">900 uL Glycerol</span></p><p class="c3"><span class="c0">Total 1.5 mL</span></p><p class="c3"><span class="c2">Mix, place in -80c Freezer</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">Repeat of Triple Ligations (hyb.ompa +aox+psb1a3)</span></p><p class="c3"><span class="c2 c6">Triple Ligation of AOX1a-FR to HybB.Ompa and psb1a3 (Margo)</span></p><p class="c3"><span class="c2">using AOX1a-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c3"><span class="c2 c11">Calculating equivalents:</span></p><p class="c3"><span class="c2">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c3"><span class="c2">AOX1a-FR -[ 25 ng/uL]/1035 bp = 0.0241 eq/uL</span></p><p class="c3"><span class="c2">pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL</span></p><p class="c3"><span class="c2">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c3"><span class="c2">Ligation:</span></p><p class="c3"><span class="c2">1.4 uL of Aox1a/b-FR -</span></p><p class="c3"><span class="c2">2 uL of Hyb.Ompa</span></p><p class="c3"><span class="c2">3 ul pSB1A3</span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer</span></p><p class="c3"><span class="c2">2.1 uL H20</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase</span></p><p class="c3"><span class="c0">Total=10 uL</span></p><p class="c3"><span class="c0">&nbsp;</span></p><p class="c3"><span class="c2">1 hr RT, labeled A</span></p><p class="c3"><span class="c2">Ligation Start: 1:14 pm</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Triple Ligation of AOX1b-FR to HybB.Ompa (Margo)</span></p><p class="c3"><span class="c2">using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c3"><span class="c2 c11">Calculating equivalents:</span></p><p class="c3"><span class="c2">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c3"><span class="c2">AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL</span></p><p class="c3"><span class="c2">pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL</span></p><p class="c3"><span class="c2">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c3"><span class="c2">Ligation:</span></p><p class="c3"><span class="c2">1.2 uL of Aox1b-FR -</span></p><p class="c3"><span class="c2">2 uL of Hyb.Ompa</span></p><p class="c3"><span class="c2">3 ul pSB1A3</span></p><p class="c3"><span class="c2">1 uL 10x Ligase Buffer</span></p><p class="c3"><span class="c2">2.3 uL H20</span></p><p class="c3"><span class="c2">0.5 uL T4 Ligase</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0">Total=10 uL</span></p><p class="c3"><span class="c2">1 hr RT labeled B</span></p><p class="c3"><span class="c2">Ligation Start: 1:14 pm</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Checking PCR from 10.1.2010 on Gel</span></p><p class="c3"><span class="c2">Gel start 1:11 pm</span><img height="1040.0" src="images/image7.png" width="800.0"></p><p class="c3"><span class="c2">Order :</span></p><p class="c3"><span class="c2">1kb ladder|PCR 1|PCR 2|PCR3|PCR 4 hyb+ompa from 9.28.2010|ladder</span></p><p class="c3"><span class="c2 c6">PCR1=</span><span class="c2"> &nbsp;PCR of hybB.ompA.Aox1a F,R ligation using Hyb-F and OmpaR</span></p><p class="c3"><span class="c2 c6">PCR2=</span><span class="c2"> &nbsp;PCR of hybB.ompA.Aox1b F,R ligation using Hyb-F and OmpaR</span></p><p class="c3"><span class="c2 c6">PCR3=</span><span class="c2"> &nbsp;PCR of &nbsp;hybB.ompA.Aox1a F,R ligation using &nbsp;OmpaF and Aox1a-R</span></p><p class="c3"><span class="c2 c6">PCR4=</span><span class="c2"> &nbsp;PCR of &nbsp;hybB.ompA.Aox1b F,R ligation using &nbsp;OmpaF and Aox1a-R</span></p><p class="c3"><span class="c2 c6">Observations of Gel</span></p><p class="c3"><span class="c2">Well 3 (the empty one) should not be empty! Perhaps misloaded?</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">Heat shock transformation of the NB with triple ligations (HybB.OmpA+AOX_psb1a3) (Margo)</span></p><p class="c3"><span class="c2">1. hyb.ompa+aox1a-FR+psb1a3 (from 10.2.2010)</span></p><p class="c3"><span class="c2">2. hyb.ompa+aoox1b-FR+psb1a3 (from 10.2.2010)</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2">10 &#1405;L Nova Blue cells + 5 &#1405;L of Ligation Reaction (hyb.ompa+aox+psb1a3) from 2 OCT 2010 that Margo did</span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c0 c11">See Protocols page for Heat Shock Transformation </span></p><p class="c3"><span class="c2">&nbsp;</span></p><p class="c3"><span class="c2 c6">For Tomorrow</span></p><ol class="c5"><li class="c4" value="1"><span class="c2">Run on a gel</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">aoxa, aoxb next to the troubleshooting pcrs from today, specifically of the PCRS using Ompa-F and Aoxa/b-R since they are similar sizes</span></li></ol><ol class="c5"><li class="c4" value="2"><span class="c2">Take out plates from incubator. Record observations</span></li></ol><ol class="c8"><li class="c1" value="1"><span class="c2">Run colony PCRs on at least 20 colonies per construct (yes 20)</span></li></ol><ol class="c14"><li class="c7" value="1"><span class="c2">Check which primers to use for colony pcr! We can likely use the primers we already have</span></li><li class="c7"><span class="c2">Run results on gel</span></li></ol><p class="c3"><span class="c2">&nbsp;</span></p>
+<title>9/26-10/2</title><style type="text/css">ol{margin:0;padding:0}p{margin:0}.c3{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:108.0pt}.c8{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:72.0pt}.c15{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:144.0pt}.c7{padding-left:0pt;line-height:1.15;direction:ltr;margin-left:36.0pt}.c1{line-height:1.15;text-indent:0pt;direction:ltr}.c0{color:#ffffff;font-size:10pt;font-family:Arial}.c4{font-weight:bold}.c5{list-style-type:disc}.c13{list-style-type:lower-roman}.c16{background-color:#ffffff}.c2{text-decoration:underline}.c14{list-style-type:decimal}.c10{margin-left:36.0pt}.c6{list-style-type:circle}.c12{list-style-type:square}.c11{font-style:italic}.c9{list-style-type:lower-latin}</style></head><body class="c16"><p class="c1"><span class="c0 c4">9/27/2010</span></p><p class="c1"><span class="c0 c2">Goals</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">PCR purify digests of building blocks from 9/25/2010</span></li><li class="c7"><span class="c0">Start first round of ligations for each construct</span></li><li class="c7"><span class="c0">Check ligations on gel</span></li><li class="c7"><span class="c0">Digest; troubleshoot ligations if necessary</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Protocols</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR Purification of Digests from 9/25/2010</span><span class="c0"> (Ompa FR , AOX1a/b FR and FR2, RFP F2R)</span></p><p class="c1"><span class="c0">Reactions I am purifying:</span></p><p class="c1"><span class="c0">RFP-F2R (NdeI, SpeI)</span></p><p class="c1"><span class="c0">OmpA FR (NotI, XmaI)</span></p><p class="c1"><span class="c0">Aox1a-FR (Xma, SpeI)</span></p><p class="c1"><span class="c0">Aox1a-FR2 (Xma, NdeI)</span></p><p class="c1"><span class="c0">Aox1b-FR (Xma, SpeI)</span></p><p class="c1"><span class="c0">Aox1b-FR2 (Xma, NdeI)</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4 c11">See Protocols page for PCR Purification</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Nanospec of Purified digests</span></p><p class="c1"><span class="c0">RFP-F2R (NdeI, SpeI)= 28.6 ng/uL</span></p><p class="c1"><span class="c0">OmpA FR (NotI, XmaI)= 15 ng/uL</span></p><p class="c1"><span class="c0">Aox1a-FR (Xma, SpeI)= 12 ng/uL</span></p><p class="c1"><span class="c0">Aox1a-FR2 (Xma, NdeI)= 25 ng/uL</span></p><p class="c1"><span class="c0">Aox1b-FR (Xma, SpeI)= 23 ng/uL</span></p><p class="c1"><span class="c0">Aox1b-FR2 (Xma, NdeI)= 21.3 ng/uL</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Ligations</span></p><p class="c1"><span class="c0">hyb= [26.2 ng/ul ]/ 393 bp = 0.067 eq/uL</span></p><p class="c1"><span class="c0">ompa = [15 ng/uL]/81 bp = 0.185 eq/uL</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Ligation of HyBb+ Ompa</span></p><p class="c1"><span class="c0">5.7 uL H20</span></p><p class="c1"><span class="c0"> 2 uL of HybB</span></p><p class="c1"><span class="c0"> 0.8 &nbsp;uL of Ompa </span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase (enzyme-- keep in freezer-- add last of all)</span></p><p class="c1"><span class="c0 c11">Total 10 uL</span></p><p class="c1"><span class="c0">RT for 1 hr. - Start time: 11:25 am</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Aliquot T4 Buffer:</span></p><p class="c1"><span class="c0">Make aliquots (5 uL) of the T4 Ligase Buffer so as to not continuously repeat freeze-thaw cycles. </span></p><p class="c1"><span class="c0">USE FROM ALIQUOTS FROM NOW ON - NOT THE GREEN-CAPPED EPPENDORF.</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Miniprep of pSB1A3+hybB+ompA</span></p><p class="c1"><span class="c0">1. Remove inoculation tubes from inoculation (37C shaker).</span></p><p class="c1"><span class="c0">2. Obtain P1 buffer from 4C refrigerator.</span></p><p class="c1"><span class="c0">3. Take centrifuge tubes and add 1.5mL of inoculated cells. </span></p><p class="c1"><span class="c0">4. Centrifuge at 3000 rpm (low) for 1-2 min. </span></p><p class="c1"><span class="c0">5. Spin until white pellet of cells forms at the bottom and liquid is more clear. </span></p><p class="c1"><span class="c0">6. Take off supernatant and discard. </span></p><p class="c1"><span class="c0">7. Repeat steps 4-6. </span></p><p class="c1"><span class="c0">8. Resuspend pelleted bacterial cells in 250&#1405;L P1 buffer. </span></p><p class="c1"><span class="c0">9. &nbsp;Add 250&#1405;L P2 buffer and invert 4-6 times (DO NOT VORTEX - doing so will shear DNA!)</span></p><p class="c1"><span class="c0">10. Add 350&#1405;L buffer N3 and immediately invert 4-6 times. </span></p><p class="c1"><span class="c0">11. Centrifuge for 10 min. at 13,000 rpm. </span></p><p class="c1"><span class="c0">12. Take supernatant and add to spin columns. </span></p><p class="c1"><span class="c0">13. Spin 30-60 sec. and discard flow through. </span></p><p class="c1"><span class="c0">14. Wash column with 750&#1405;L buffer PE and centrifuge 1 min. </span></p><p class="c1"><span class="c0">15. Discard flow through and centrifuge and additional minute.</span></p><p class="c1"><span class="c0">16. Please column into a clean 1.5mL microcentrifuge tube.</span></p><p class="c1"><span class="c0">17. Elute DNA by adding 30&#1405;L dH2O. </span></p><p class="c1"><span class="c0">18. Let stand for 1 min., then centrifuge for 1 min. </span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Making a 1 % gel </span></p><p class="c1"><span class="c0">25*4=100 mL</span></p><p class="c1"><span class="c0">We found that we had extra left over. </span></p><p class="c1"><span class="c0">Start at 1:13 pm</span></p><p class="c1"><span class="c0">End: 2:13 pm</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of Hyb+OmpA ligation </span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction</span></p><p class="c1"><span class="c0">25.5 uL H2O</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">PHUSION 5X Reaction buffer</span></p><p class="c1"><span class="c0">5 uL HybB-F forward primer </span></p><p class="c1"><span class="c0">5 uL OmpA-R reverse primer</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">PHUSION</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0">Start: 12:57 pm</span></p><p class="c1"><span class="c0">End: 3:00 pm (approx)</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">Plan:</span></p><p class="c1"><span class="c0">Once PCR is finished, run 4 uL of the reaction on the gel. Check for a band running at a size of 393+81=474 bp, so approximately mid 400-500 bp. If band is observed, prepare for the digest (check for the RE sites based on what primers were used).</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Gel Picture</span></p><p class="c1"><span class="c0">insert gel pic from computer</span></p><p class="c1"><span class="c0">band around 500 bp. </span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Nanospec PCR</span></p><p class="c1"><span class="c0">Christina</span></p><p class="c1"><span class="c0">326 ng/uL</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4 c2">BASIC PLAN FOR BUILDING PLASMID CONSTRUCTS</span></p><p class="c1"><span class="c0">from the primered building blocks, which are stored in our freezer</span></p><p class="c1"><span class="c0">A) RUN GEL - 2 uL each - to check size - this step completed for all building blocks</span></p><p class="c1"><span class="c0">B) PCR PURIFY leftovers - this step completed for all building blocks</span></p><p class="c1"><span class="c0">C) NANOSPEC - record concentrations - this step completed for all building blocks</span></p><p class="c1"><span class="c0 c4">D) DIGEST</span><span class="c0"> with restriction enzymes, overnight</span></p><p class="c1"><span class="c0 c4">E) PCR PURIFY</span><span class="c0"> digestion products</span></p><p class="c1"><span class="c0 c4">F) LIGATION</span><span class="c0"> of gene building blocks - we are starting with HybB &amp; RFP</span></p><p class="c1"><span class="c0 c4">G) PCR </span><span class="c0">ligation products, HybB-RFP</span></p><p class="c1"><span class="c0 c4">H) DIGEST</span><span class="c0"> products, HybB-RFP</span></p><p class="c1"><span class="c0 c4">I) RUN GEL</span><span class="c0"> on small amount of digestion products, HybB-RFP</span></p><p class="c1"><span class="c0 c4">J) PCR PURIFY</span><span class="c0"> the rest of the digestion products, HybB-RFP</span></p><p class="c1"><span class="c0 c4">K) DIGEST</span><span class="c0"> the vector - we are using pBS1A3</span></p><p class="c1"><span class="c0 c4">L) PCR PURIFY</span><span class="c0"> the vector</span></p><p class="c1"><span class="c0 c4">M) LIGATION </span><span class="c0">of gene with vector, HybB-RFP and pBS1A3</span></p><p class="c1"><span class="c0 c4">N) TRANSFORMATION </span><span class="c0">of plasmid into E. coli, run overnight</span></p><p class="c1"><span class="c0 c2">Note- </span><span class="c0"> Do a nanospec after PCR purifications</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">NOTES:</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Steps in BOLD are going to be repeated with each plasmid construct. Steps A,B, and C have already been done for each building block and won&rsquo;t be repeated unless there is a specific issue with a particular building block.</span></li><li class="c7"><span class="c0">Steps K and L do not necessarily need to wait until step J is completed to be run. They are listed this way so there is no confusion about what is being digested or PCR purified at each step.</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4">9/28/2010</span></p><p class="c1"><span class="c0 c2">Results from 9/27/2010:</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">The gel picture of the hybB+ompa is in the folder.</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">The band is bright at 500 bp, and our predictions confirm the results.</span></li><li class="c8"><span class="c0">Nanospec results - 326.6 ng/uL</span></li><li class="c8"><span class="c0">Goals for 9/28/10: PCR purify the PCR (in the yellow box)</span></li><li class="c8"><span class="c0">&nbsp;</span></li></ol><p class="c1"><span class="c0 c4">Experimental Procedures:</span></p><p class="c1"><span class="c0">1. Make cryostocks of mRFP:NB cells from starter cultures made on 9/27/2010. &nbsp;900uL cells+100uL DMSO. Stored in -80C fridge in Gaucher Lab (iGEM box).</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Notes</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Christina+Rob PCR purified the hyb+ompa PCR.</span></li><li class="c7"><span class="c0">Richard suggested we can PCR Aox+RFP, then pcr that to the hyb+ompa. This wil take care of two constructs. The other two require Aox a/b to be attached to the hybb+ompa construct</span></li><li class="c7"><span class="c0">For the constructs that have Aox+RFP, we can do a ligation of Aox to RFP; then, PCR that part and ligate it to the Hyb+ompa.</span></li></ol><ol class="c9"><li class="c8" value="1"><span class="c0">For the AOX-RFP constructs:</span></li></ol><ol class="c13"><li class="c3" value="1"><span class="c0">Ligate Aox1a-FR2 to RFP-F2R</span></li><li class="c3"><span class="c0">LigateAox1b-FR2 to RFP-F2R</span></li><li class="c3"><span class="c0">PCR each ligation reaction</span></li><li class="c3"><span class="c0">PCR purify</span></li><li class="c3"><span class="c0">Check results on gel</span></li></ol><ol class="c14"><li class="c15" value="1"><span class="c0">Gel extract if PCR results in multiple bands</span></li></ol><ol class="c13"><li class="c3" value="6"><span class="c0">Digest the Aox-RFP construct</span></li><li class="c3"><span class="c0">PCR purify</span></li><li class="c3"><span class="c0">Ligate the Aox-RFP digests to Hyb-Ompa digest</span></li><li class="c3"><span class="c0">PCR the entire constructs</span></li></ol><ol class="c9"><li class="c8" value="2"><span class="c0">For the HybB-Ompa-Aox constructs:</span></li></ol><ol class="c13"><li class="c3" value="1"><span class="c0">Ligate the HybB-Ompa to Aox1a-FR or Aox1b-FR</span></li><li class="c3"><span class="c0">PCR the constructs</span></li><li class="c3"><span class="c0">PCR Purify</span></li><li class="c3"><span class="c0">Check results on gel</span></li></ol><ol class="c14"><li class="c15" value="1"><span class="c0">if multiple bands, gel extract</span></li></ol><ol class="c13"><li class="c3" value="5"><span class="c0">Ligate Hyb-Ompa-Aox to pSB1A3</span></li><li class="c3"><span class="c0">Transform into cells or PCR entire vector</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4">9/29/2010</span></p><p class="c1"><span class="c0 c2">Goals</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Ligate Aox1a-FR2 to RFP-F2R (1hr) -COMPLETED</span></li><li class="c7"><span class="c0">LigateAox1b-FR2 to RFP-F2R (1hr at same time as step 1) -COMPLETED</span></li><li class="c7"><span class="c0">Digest HybB.Ompa (3 hours) &nbsp;- COMPLETED</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">PCR purify hybB.ompA -COMPLETED</span></li><li class="c8"><span class="c0">Ligate the digested, purified HybB-Ompa to Aox1a-FR &nbsp;-COMPLETED</span></li><li class="c8"><span class="c0">Ligate the digested, purified HybB-Ompa to Aox1b-FR -COMPLETED</span></li></ol><ol class="c5"><li class="c7" value="4"><span class="c0">PCR each ligation reaction (3 hr, run simultaneously)</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">Use Phusion Polymerase</span></li><li class="c8"><span class="c0">Only 3 ul or so is needed for the PCR</span></li><li class="c8"><span class="c0">PCR volume can be 30 or 50 uL (50 works fine and gets us lots of DNA)</span></li></ol><ol class="c5"><li class="c7" value="5"><span class="c0">PCR purify (45 mins max)</span></li><li class="c7"><span class="c0">Check results on gel (40 mins max)</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">Gel extract if PCR results in multiple bands (1hr)</span></li></ol><ol class="c5"><li class="c7" value="7"><span class="c0">Digest the Aox-RFP construct (3 hours or overnight)</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Protocols</span></p><p class="c1"><span class="c0">Make sure all products are digested</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">hyb.ompa is not digested, so start that today</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Ligation of AOX1a-FR2 to RFP-F2R (Scott)</span></p><p class="c1"><span class="c0">using AOX1a-FR2 from 9/27/2010 and RFP-F2R from 9/27/2010</span></p><p class="c1"><span class="c0 c11">Calculating equivalents:</span></p><p class="c1"><span class="c0">RFPF2R- [ 29 ng/uL]/678 bp= 0.0428 eq/uL</span></p><p class="c1"><span class="c0">AOX1a-FR2-[ 25 ng/uL]/1035 bp = 0.0242 eq/uL</span></p><p class="c1"><span class="c0">for linear ligations, use a 1:1 ratio of products</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Ligation:</span></p><p class="c1"><span class="c0">1.1 uL of RFP F2R</span></p><p class="c1"><span class="c0">2 uL of AOX1a-FR2</span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c1"><span class="c0">5.4 uL H20</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c1"><span class="c0 c4">Total=10 uL</span></p><p class="c1"><span class="c0">Leave RT for 1 hour</span></p><p class="c1"><span class="c0">Started 10:42 am</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Ligation of AOX1b-FR2 to RFP-F2R (Scott)</span></p><p class="c1"><span class="c0">using AOX1a-FR2 from 9/27/2010 and RFP-F2R from 9/27/2010</span></p><p class="c1"><span class="c0 c11">Calculating equivalents:</span></p><p class="c1"><span class="c0">RFP F2,R- [ 29 ng/uL]/678 bp= 0.0428 eq/uL</span></p><p class="c1"><span class="c0">AOX1b F,R2-[ 21.3 ng/uL]/1047 bp = 0.0203 eq/uL</span></p><p class="c1"><span class="c0">for linear ligations, use a 1:1 ratio of products</span></p><p class="c1"><span class="c0 c2">Ligation:</span></p><p class="c1"><span class="c0">1 uL of RFP F2R</span></p><p class="c1"><span class="c0">2 uL of Aox1b-FR2</span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c1"><span class="c0">5.5 uL H20</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c1"><span class="c0 c4">Total=10 uL</span></p><p class="c1"><span class="c0">Leave RT for 1 hour</span></p><p class="c1"><span class="c0">Started 10:42 am</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Digest of HybB.Ompa (Christina)</span></p><p class="c1"><span class="c0">17 uL of Hyb.Ompa (58.2 ng/uL)</span></p><p class="c1"><span class="c0">8.5 uL h20</span></p><p class="c1"><span class="c0">3 uL 10x Buffer B (Promega)</span></p><p class="c1"><span class="c0">0.75 uL EcoRI</span></p><p class="c1"><span class="c0">0.75 uL XmaI</span></p><p class="c1"><span class="c0 c4">Total= 30 uL</span></p><p class="c1"><span class="c0">37c heating block (with water) for 3 hours</span></p><p class="c1"><span class="c0">Start: 10:00 pm</span></p><p class="c1"><span class="c0">End: 1pm</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">Following digestion, perform a PCR purification according to kit instructions. </span><span class="c0 c4">(</span><span class="c0 c4 c11">See Protocols page for PCR Purification)</span></p><p class="c1"><span class="c0 c4 c11"> </span></p><p class="c1"><span class="c0">Nanospec results of purified, digested hybB.OmpA: 4.1 ng/uL</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of Aox1a-FR2.RFP ligation</span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction</span></p><p class="c1"><span class="c0">25.5 uL H2O</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">PHUSION 5X Reaction buffer</span></p><p class="c1"><span class="c0">5 uL Aox1a-F forward primer</span></p><p class="c1"><span class="c0">5 uL RFP-R reverse primer</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">PHUSION</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of Aox1b-FR2.RFP ligation</span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction</span></p><p class="c1"><span class="c0">25.5 uL H2O</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">PHUSION 5X Reaction buffer</span></p><p class="c1"><span class="c0">5 uL Aox1b-F forward primer</span></p><p class="c1"><span class="c0">5 uL RFP-R reverse primer</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">PHUSION</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">PCR ended at 3- Scott and Christina will grab them.</span></p><p class="c1"><span class="c0">The tube labels could not be read! The tubes were crushed- I have had this happen to me as well. Slight pressure is sufficient. I don&rsquo;t know which one is aox1a+rfp or aox1b+rfp. I assume the one that looked like &ldquo;b&rdquo; is aox1b. PCRS are the in yellow box- I put pcrs in there usually. &nbsp;Note: (@Scott - I (Christina) &nbsp;looked again at the tubes and I think they were labelled &ldquo;1&rdquo; and &ldquo;2&rdquo; - I in front of the ones you put in the yellow box to verify)</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Heat shock transformation of the plasmids into our bacteria</span></p><p class="c1"><span class="c0">10 &#1405;L BL21 cells + 5 &#1405;L of plasmid</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4 c11">See Protocols page for Heat Shock Transformation </span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">Picked colonies from plates of HybB+RFP and added to 25 ul of water each. Used 5 ul for PCR, and added 250 ul of LB media to the rest. These tubes are in a &nbsp;green holder in the 37 degrees incubator.</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Colony PCR of Hyb.RFP</span></p><p class="c1"><span class="c0">5 uL of cells</span></p><p class="c1"><span class="c0">25.5 uL H2O</span></p><p class="c1"><span class="c0">10 uL GOTAQ</span><span class="c0 c4"> 5X Reaction buffer</span></p><p class="c1"><span class="c0">5 uL HybB-F forward primer</span></p><p class="c1"><span class="c0">5 uL RFP-R reverse primer</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, TAQ</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c4">10 tubes in Block B. Should end at 5 pm. First 5 tubes are from plate 1, and the -10 are from plate 2. Wrote details in Scott&rsquo;s notebook. Ran out of GOTAQ enzymed for tube 10. Got some from Ryan for this specific PCR, but still ran out =/ So tube 10 may have funky results.</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c2">nanospec of digested and purified hybB.ompA: </span><span class="c0">4.1 ng/uL</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Ligation of AOX1a-FR to HybB.Ompa</span></p><p class="c1"><span class="c0">using purified, digested AOX1a-FR from 9/27/2010 and digested Hyb.Ompa from 9/29/2010</span></p><p class="c1"><span class="c0 c11">Calculating equivalents:</span></p><p class="c1"><span class="c0">HybB.Ompa - [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c1"><span class="c0">AOX1a-FR-[ 12 ng/uL]/1035 bp = &nbsp;0.0116 eq/uL</span></p><p class="c1"><span class="c0">for linear ligations, use a 1:1 ratio of products</span></p><p class="c1"><span class="c0">Ligation:</span></p><p class="c1"><span class="c0">2 uL of Aox1a-FR -</span></p><p class="c1"><span class="c0">2.5 uL of Hyb.Ompa-</span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer-</span></p><p class="c1"><span class="c0">4 uL H20 -</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c1"><span class="c0 c4">Total=10 uL</span></p><p class="c1"><span class="c0">leave in 4C overnight.labelled with an &ldquo;A&rdquo; on top.</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Ligation of AOX1b-FR to HybB.Ompa</span></p><p class="c1"><span class="c0">using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c1"><span class="c0 c11">Calculating equivalents:</span></p><p class="c1"><span class="c0">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c1"><span class="c0">AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL</span></p><p class="c1"><span class="c0">for linear ligations, use a 1:1 ratio of products</span></p><p class="c1"><span class="c0">Ligation:</span></p><p class="c1"><span class="c0">1 uL of Aox1b-FR -</span></p><p class="c1"><span class="c0">2.4 uL of Hyb.Ompa</span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c1"><span class="c0">5.1 uL H20</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c1"><span class="c0 c4">Total=10 uL</span></p><p class="c1"><span class="c0">leave in 4C overnight - labelled with a &ldquo;B&rdquo; on top.</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4">9/30/2010</span></p><p class="c1"><span class="c0 c2">Goals</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Check results form 9.29.2010</span></li><li class="c7"><span class="c0">Richard/Megan suggested we can do a double ligation for:</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">[HybB.OmPa.AOX1a-FR.]+[pSB1A3]</span></li><li class="c8"><span class="c0">[HybB.OmPa.AOX1b-FR].+[pSB1A3]</span></li></ol><ol class="c5"><li class="c7" value="3"><span class="c0">Similarly, we can do a triple ligation of:</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">[Hyb.Ompa]+[Aox1a-FR2.RFP]+[pSB1A3]</span></li><li class="c8"><span class="c0">[Hyb.Ompa]+[Aox1b-FR2.RFP]+[pSB1A3]</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Results from 9/29/2010</span></p><p class="c1"><span class="c0">Plates from 9/29/2010 of the hyb+rfp construct have many red colonies. Each colony has a red center and brownish outer ring surrounding that center.</span></p><p class="c1"><span class="c0">I put the plates in the refrigerator.</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Two gels were prepared to check the results from 9/29:</span></p><p class="c1"><span class="c0">Gel 1:</span></p><p class="c1"><span class="c0">Lane 1: 1KB Ladder</span></p><p class="c1"><span class="c0">Lane 2: Colony &nbsp;pcr tube 1</span></p><p class="c1"><span class="c0">Lane 3: Colony pcr tube 2</span></p><p class="c1"><span class="c0">Lane 4: Colony &nbsp;pcr tube 3</span></p><p class="c1"><span class="c0">Lane 5: Colony pcr tube 4</span></p><p class="c1"><span class="c0">Lane 6: Colony pcr tube 5</span></p><p class="c1"><span class="c0">Lane 7: Colony pcr tube 6</span></p><p class="c1"><span class="c0">Lane 8: Colony pcr tube 7</span></p><p class="c1"><span class="c0 c4">Results:</span></p><p class="c1"><img height="740.0" src="images/image2.png" width="569.0"></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0">Gel 2:</span></p><p class="c1"><span class="c0">Lane 1: 1KB Ladder</span></p><p class="c1"><span class="c0">Lane 2: Colony tube 8</span></p><p class="c1"><span class="c0">Lane 3: Colony tube 9</span></p><p class="c1"><span class="c0">Lane 4: Colony tube 10</span></p><p class="c1"><span class="c0">Lane 5: [Aox1a-FR2.RFP] (9.29.2010)</span></p><p class="c1"><span class="c0">Lane 6: [Aox1b-FR2.RFP] (9.29.2010)</span></p><p class="c1"><span class="c0">Lane 7:</span></p><p class="c1"><span class="c0">Lane 8:</span></p><p class="c1"><span class="c0 c4">Results: </span><img height="800.0" src="images/image0.png" width="615.0"></p><p class="c1"><span class="c0 c2">Results</span></p><p class="c1"><span class="c0">The pcrs of Aoxa/b+RFP do not appear clean. The predicted 1700 bp is very faint. &nbsp; We need to troubleshoot !</span></p><p class="c1"><span class="c0">Successful tubes (All except 7 + 10) placed in 37C shaker in Gauche lab at 3:00pm</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Protocols</span></p><p class="c1"><span class="c0">Ask Richard/Megan volume for triple ligation. Do we need to check concentration of ligations?</span></p><p class="c1"><span class="c0">I have laid out the proposed &nbsp;double ligation recipes, but check with Richard/Megan. I predict the triple ligations are similar except less water will be used .</span></p><p class="c1"><span class="c0">What is our plan- do digests from the ligations, or PCR them up and then digest?</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of hybB.ompA-Aox1a F,R ligation (Christina)</span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction -</span></p><p class="c1"><span class="c0">25.5 uL H2O-</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">PHUSION 5X Reaction buffer-</span></p><p class="c1"><span class="c0">5 uL hybB forward primer-</span></p><p class="c1"><span class="c0">5 uL AOX1a reverse primer-</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">PHUSION</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">labelled &ldquo;A, 9-30-10&rdquo;</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of hybB.ompA-Aox1b F,R ligation (Christina)</span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction -</span></p><p class="c1"><span class="c0">25.5 uL H2O-</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">PHUSION 5X Reaction buffer-</span></p><p class="c1"><span class="c0">5 uL hybB forward primer-</span></p><p class="c1"><span class="c0">5 uL AOX1B reverse primer-</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">PHUSION</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">labelled &ldquo;B, 9-30-10&rdquo;</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c2">Gel for hyb.ompa.aox1a/b PCRs</span></p><p class="c1"><span class="c0">order:</span></p><p class="c1"><span class="c0">Lane 1:1kb ladder|</span></p><p class="c1"><span class="c0">Lane 2: HybB.OmPa.AOX1a-FR (predicted=1509)</span></p><p class="c1"><span class="c0">Lane 3: HybB.OmPa.AOX1b-FR (predicted=1521 bp)</span></p><p class="c1"><img height="781.0" src="images/image3.png" width="601.0"></p><p class="c1"><span class="c0 c2">Results</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Inconclusive- the predicted bands do not appear.</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">List of what is done now:</span></p><p class="c1"><span class="c0">[HybB.OmPa.AOX1a-FR.] &nbsp;(low volume) (ligations)</span></p><p class="c1"><span class="c0">[HybB.OmPa.AOX1b-FR] &nbsp;(low volume) (ligations)</span></p><p class="c1"><span class="c0">[HybB.OmPa.AOX1a-FR] (pcr) (loaded on gel 9.30.2010) (troubleshoot)</span></p><p class="c1"><span class="c0">[HybB.OmPa.AOX1b-FR] (pcr) (loaded on gel 9.30.2010) (troubleshoot)</span></p><p class="c1"><span class="c0">[Aox1a-FR2.RFP] (pcr) (doing gel extract today)</span></p><p class="c1"><span class="c0">[Aox1b-FR2.RFP] (pcr) (doing gel extract today)</span></p><p class="c1"><span class="c0">[hyb.RFP] (in NB and BL21) (create expression profile)</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Notes:</span></p><p class="c1"><span class="c0">Troubleshooting the</span></p><p class="c1"><span class="c0">[HybB.OmPa.AOX1a-FR] and [HybB.OmPa.AOX1b-FR] :</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">make sure elongation time is 2 minutes</span></li><li class="c7"><span class="c0">make thermocycler compatible with lowest melting temp of primers</span></li><li class="c7"><span class="c0">troubleshoot pcr by making shorter pcr products, like ompa+aox or hyb+ompa, to make sure template is there</span></li><li class="c7"><span class="c0">Or just not do PCR and do a triple ligation</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">[Aox1a-FR2.RFP] and [Aox1b-FR2.RFP]:</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Richard suggested we gel extract the aox1a/b+RFP</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Triple Ligation of AOX1a/b-FR to HybB.Ompa and pSB1a3(Gita)</span></p><p class="c1"><span class="c0">using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c1"><span class="c0 c11">Calculating equivalents:</span></p><p class="c1"><span class="c0">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c1"><span class="c0">AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL</span></p><p class="c1"><span class="c0">pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL</span></p><p class="c1"><span class="c0">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c1"><span class="c0">Ligation:</span></p><p class="c1"><span class="c0">1.2 uL of Aox1b-FR -</span></p><p class="c1"><span class="c0">2 uL of Hyb.Ompa</span></p><p class="c1"><span class="c0">3 ul pSB1A3</span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c1"><span class="c0">2.3 uL H20</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c1"><span class="c0 c4">Total=10 uL</span></p><p class="c1"><span class="c0">leave in 4C overnight - labelled with a &ldquo;B&rdquo; on top.</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Triple Ligation of AOX1a/b-FR to HybB.Ompa and psb1a3 (Gita)</span></p><p class="c1"><span class="c0">using AOX1a-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c1"><span class="c0 c11">Calculating equivalents:</span></p><p class="c1"><span class="c0">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c1"><span class="c0">AOX1a-FR -[ 25 ng/uL]/1035 bp = 0.0241 eq/uL</span></p><p class="c1"><span class="c0">pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL</span></p><p class="c1"><span class="c0">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c1"><span class="c0">Ligation:</span></p><p class="c1"><span class="c0">1.4 uL of Aox1a/b-FR -</span></p><p class="c1"><span class="c0">2 uL of Hyb.Ompa</span></p><p class="c1"><span class="c0">3 ul pSB1A3</span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c1"><span class="c0">2.1 uL H20</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c1"><span class="c0 c4">Total=10 uL</span></p><p class="c1"><span class="c0">leave in 4C overnight - labelled with a &ldquo;B&rdquo; on top.</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Repeat PCR of hybB.ompA+Aox1a F,R ligation (Christian)</span></p><p class="c1"><span class="c0">5 uL of product of ligation reaction -</span></p><p class="c1"><span class="c0">23.5 uL H2O-</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">PHUSION 5X Reaction buffer-</span></p><p class="c1"><span class="c0">5 uL hybbB F primer-</span></p><p class="c1"><span class="c0">5 uL AOX1a R primer-</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">PHUSION</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0">Started 6:50pm</span></p><p class="c1"><span class="c0">iGEM 2</span></p><p class="c1"><span class="c0">Changed extension time to 2 mins</span></p><p class="c1"><span class="c0">Labeled &ldquo;A&rdquo; on top and sides</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of hybB.ompA+Aox1b F,R ligation (Christian)</span></p><p class="c1"><span class="c0">5 uL of product of ligation reaction -</span></p><p class="c1"><span class="c0">23.5 uL H2O-</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">PHUSION 5X Reaction buffer-</span></p><p class="c1"><span class="c0">5 uL hybB F primer-</span></p><p class="c1"><span class="c0">5 uL AOX1B R primer-</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">PHUSION</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0">Started 6:50pm</span></p><p class="c1"><span class="c0">iGEM 2</span></p><p class="c1"><span class="c0">Changed extension time to 2 mins</span></p><p class="c1"><span class="c0">Labeled &ldquo;B&rdquo; on top and sides</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">1% Gel for gel extraction for </span><span class="c0"> aox1a-FR2 +RFP, aox1b-FR2+RFP</span></p><p class="c1"><span class="c0">Notes- about 70-80 mL</span></p><p class="c1"><span class="c0 c4 c11">See Protocols page for Preparing 1% Agarose Gels</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Loading Gel for Gel Extract (going to perform 7pm today)</span></p><p class="c1"><span class="c0">order:</span></p><p class="c1"><span class="c0">empty....empty|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP</span></p><p class="c1"><span class="c0">[loaded 40 ul of each pcr reaction, 9.5 ul of ladder]</span></p><p class="c1"><span class="c0">start 6:40 pm</span></p><p class="c1"><img height="324.0" src="images/image1.png" width="328.0"><span class="c0 c11">Before Gel Extraction</span></p><p class="c1"><span class="c0">|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP</span></p><p class="c1"><span class="c0">Targeting the 1500 bp bands</span></p><p class="c1"><img height="288.0" src="images/image6.png" width="343.0"></p><p class="c1"><span class="c0 c11">AfterGel Extraction</span></p><p class="c1"><span class="c0">|1kb ladder|(1)aox1aFR2+RFP|(2)aox1bFR2+RFP</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Gel Extraction</span></p><p class="c1"><span class="c0">Notes: similar to the previous ones, elute in 30 uL of water</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4">For Tomorromow</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Nanospec the gel extractions and run on gel to check for 1500 bp band</span></li><li class="c7"><span class="c0 c2">Order Primers!!:</span></li></ol><p class="c1"><span class="c0 c2">&nbsp;</span></p><p class="c1 c10"><span class="c0">Sequencing Primers for PSB1A3</span></p><p class="c1 c10"><span class="c0">20-30 bp bindign region</span></p><p class="c1 c10"><span class="c0">Tm~60</span></p><p class="c1 c10"><span class="c0 c4">psb1a3-R1</span></p><p class="c1 c10"><span class="c0">5&rsquo; tcgccggcgacgtcag 3&rsquo;; Tm=62, GC=75%</span></p><p class="c1 c10"><span class="c0 c4">psb1a3-F1</span></p><p class="c1 c10"><span class="c0">5&rsquo; tccttagctttcgctaaggatgatttctg &nbsp;3&rsquo; tTM=60 GC=41% &nbsp;</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Make sequence files for all constructs!</span></li><li class="c7"><span class="c0">Troubleshoot</span></li></ol><ol class="c5"><li class="c7" value="1"><span class="c0">[HybB.OmPa.AOX1a-FR] (pcr) (loaded gel 9.30.2010) (troubleshoot) (repeated PCR today)</span></li><li class="c7"><span class="c0">[HybB.OmPa.AOX1b-FR] (pcr) (loaded gel 9.30.2010) (troubleshoot) (repeated PCR today)</span></li><li class="c7"><span class="c0">[Aox1a-FR2.RFP] (pcr) (did gel extract today)(but PCR was messy)</span></li><li class="c7"><span class="c0">[Aox1b-FR2.RFP] (pcr) (did gel extract today)(but PCR was messy) &nbsp; &nbsp;</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4">10/1/2010</span></p><p class="c1"><span class="c0 c2">Goals</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Run gel to check for:</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">Gel extractions to check for 1500 bp band (aox+rfp)</span></li><li class="c8"><span class="c0">PCRs of:</span></li></ol><ol class="c12"><li class="c3" value="1"><span class="c0">[HybB.OmPa.AOX1a-FR] &nbsp;(from 9.30.2010)</span></li><li class="c3"><span class="c0">[HybB.OmPa.AOX1b-FR] (from 9.30.2010)</span></li></ol><ol class="c12"><li class="c3" value="1"><span class="c0">&nbsp;</span></li><li class="c3"><span class="c0 c2">Running Gel (Scott)</span></li><li class="c3"><span class="c0">Predicted:</span></li></ol><ol class="c5"><li class="c7" value="1"><span class="c0">[HybB.OmPa.AOX1a-FR] ~1500 bp</span></li><li class="c7"><span class="c0">[HybB.OmPa.AOX1b-FR]~1500 bp</span></li><li class="c7"><span class="c0">[Aox1a+RFP]~1700 bp</span></li><li class="c7"><span class="c0">[Aox1b+RFP~1700 bp</span></li></ol><ol class="c12"><li class="c3" value="1"><span class="c0 c2">Results</span></li></ol><ol class="c5"><li class="c7" value="1"><span class="c0">The PCRs of Hyb.Ompa.Aox were vey messy- PCR purify them and run them again on a gel</span><img height="351.0" src="images/image4.png" width="342.0"></li></ol><ol class="c12"><li class="c3" value="1"><span class="c0">Gel (Version 1) order:</span></li></ol><ol class=""><li class="c7" value="2"><span class="c0">1kb ladder|PCR of HybB.OmPa.AOX1a-FR|PCR of HybB.OmPa.AOX1b-FR|Gel extract of Aox1a+RFP|empty well| Gel extract of Aox1b+RFP| 1 kb ladder</span><img height="509.0" src="images/image8.png" width="455.0"></li></ol><ol class="c12"><li class="c3" value="1"><span class="c0">Gel (Version 2) (Same as Version 1)</span></li><li class="c3"><span class="c0">&nbsp;</span></li><li class="c3"><span class="c0">For Mitesh, Margo</span></li></ol><ol class="c5"><li class="c7" value="1"><span class="c0">I ran wrong PCR- Run on gel the PCR labeled from 9.30.2010 as &ldquo;Repeat&rdquo; with Christian&rsquo;s name on it.</span></li><li class="c7"><span class="c0">Gel extraction has two bands- one is the 1700 one we want, the other isn&rsquo;t. We need to plan how get the 1700 one; perhaps another gel extract?</span></li><li class="c7"><span class="c0">We need annotated sequence files-Richard has some starting ones.</span></li><li class="c7"><span class="c0">We need to design sequencing primers for all the parts once they are in pSB1A3</span></li><li class="c7"><span class="c0">Debika- Start starter cultures of colonies 9,10, 5 ,6 of hyb+RFP</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Protocols</span></p><p class="c1"><span class="c0 c2">&nbsp;</span></p><p class="c1"><img height="362.0" src="images/image5.png" width="334.0"></p><p class="c1"><span class="c0 c11">Gel of Repeated PCRs:</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Lane 2 [HybB.OmPa.AOX1a-FR] &nbsp;(from 9.30.2010)</span></li><li class="c7"><span class="c0">Lane 3 [HybB.OmPa.AOX1b-FR] (from 9.30.2010)</span></li><li class="c7"><span class="c0">Ladder in lane 1 (left most well)</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">PCRs to troubleshoot hyb.ompa.aox pcrs</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of hybB.ompA.Aox1a F,R ligation using Hyb-F and OmpaR </span><span class="c0"> [tube label 1]</span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction -</span></p><p class="c1"><span class="c0">25.5 uL H2O-</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">Gotaq 5X Reaction buffer-</span></p><p class="c1"><span class="c0">5 uL hybB F primer-</span></p><p class="c1"><span class="c0">5 uL Ompa R primer-</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">Gotaq</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of hybB.ompA.Aox1b F,R ligation using Hyb-F and OmpaR </span><span class="c0">[tube label 2]</span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction -</span></p><p class="c1"><span class="c0">25.5 uL H2O-</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">Gotaq 5X Reaction buffer-</span></p><p class="c1"><span class="c0">5 uL hybB F primer-</span></p><p class="c1"><span class="c0">5 uL Ompa R primer-</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">Gotaq</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of hybB.ompA.Aox1a F,R ligation using &nbsp;OmpaF and Aox1a-R </span><span class="c0">[tube label 3]</span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction -</span></p><p class="c1"><span class="c0">25.5 uL H2O-</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">Gotaq 5X Reaction buffer-</span></p><p class="c1"><span class="c0">5 uL Ompa &nbsp;F primer-</span></p><p class="c1"><span class="c0">5 uL AOX1a R primer-</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">Gotaq</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c2">PCR of hybB.ompA.Aox1b F,R ligation using &nbsp;OmpaF and Aox1b-R </span><span class="c0">[tube label 4]</span></p><p class="c1"><span class="c0">3 uL of product of ligation reaction -</span></p><p class="c1"><span class="c0">25.5 uL H2O-</span></p><p class="c1"><span class="c0">10 uL </span><span class="c0 c4">Gotaq 5X Reaction buffer-</span></p><p class="c1"><span class="c0">5 uL<br> 5 uL Ompa F primer-</span></p><p class="c1"><span class="c0">5 uL AOX1B R primer-</span></p><p class="c1"><span class="c0">1 uL dNTP 10 mM - (thawed &amp; kept on ice)</span></p><p class="c1"><span class="c0">0.5 uL polymerase enzyme, </span><span class="c0 c4">Gotaq</span></p><p class="c1"><span class="c0 c4">Total Volume= 50 uL</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0 c4">Suggestions</span></p><p class="c1"><span class="c0">Dr. &nbsp;Gaucher suggested doing a PCR purification of the Ligation reactions, since PCR is sensitive to salts and buffers.</span></p><p class="c1"><span class="c0">Also a gradient would be useful.</span></p><p class="c1"><span class="c0">Try increasign annealing temp to 56 or so, 52 is too low he said!</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">Triple Ligation</span></p><p class="c1"><span class="c0">richard suggested triple ligation, screen with 20 colonies</span></p><p class="c1"><span class="c0 c2">Sequences</span></p><p class="c1"><span class="c0">Primers:</span></p><p class="c1"><span class="c0 c4">Ompa_3&rsquo; end_F_Seq</span></p><p class="c1"><span class="c0">5&rsquo; GCTACCGTTGCGCAAGCT3&rsquo;</span></p><p class="c1"><span class="c0">tm=60</span></p><p class="c1"><span class="c0">GC= 61%</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4">Hybb_3&rsquo; end_F_Seq</span></p><p class="c1"><span class="c0">5&rsquo; GCCGCCACCATGGGGTTAAGTAG 3&rsquo;</span></p><p class="c1"><span class="c0">tm=63</span></p><p class="c1"><span class="c0">GC= 61%</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">Sequencing Primers for PSB1A3</span></p><p class="c1"><span class="c0">20-30 bp binding region</span></p><p class="c1"><span class="c0">Tm~60</span></p><p class="c1"><span class="c0 c4">psb1a3-R1</span></p><p class="c1"><span class="c0">5&rsquo; tcgccggcgacgtcag 3&rsquo;; Tm=62, GC=75%</span></p><p class="c1"><span class="c0 c4">psb1a3-F1</span></p><p class="c1"><span class="c0">5&rsquo; tccttagctttcgctaaggatgatttctg &nbsp;3&rsquo; tTM=60 GC=41% &nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">Primer to construct hyb.omp.rfp</span></p><p class="c1"><span class="c0 c4">RFP-F3</span></p><p class="c1"><span class="c0">5&rsquo;[GAGAGA ][CCCGGG]ATGGCGTCTTCTGAAGACGTTAT</span></p><p class="c1"><span class="c0">RE from RFP-F2 replaced with an XmaI site</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">For Tomorrow</span></p><p class="c1"><span class="c0 c2">(</span><span class="c0">Check to make sure the proposed actions for tomorrow make sense!)</span></p><ol class=""><li class="c7" value="1"><span class="c0">Troubleshooting the PCR of hyb.ompa.aox</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">run the troubleshooting PCRs Margo did today on a gel to check results</span></li></ol><ol class=""><li class="c7" value="2"><span class="c0">Prepare the reactions needed to make hyb.ompa+aox+psb1a3 using a triple ligation</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">Digest the Pcr of hyb.ompa from</span></li><li class="c8"><span class="c0">Ligate hyb.ompa+aox+psb1a3</span></li></ol><ol class="c5"><li class="c7" value="3"><span class="c0">Order primers!</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4">10/2/2010</span></p><p class="c1"><span class="c0">Goals</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">If Gaucher lab is open, run results on gel and visualize</span></li><li class="c7"><span class="c0">Else, start Triple ligation</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">Do we start from the digested products we have or start from scratch?</span></li></ol><ol class="c5"><li class="c7" value="3"><span class="c0">Problem: we didn&rsquo;t transform the triple ligation (hyb.ompa+aox+psb1a4) from 9.30.2010 that Gita did! We can transform that today and start a new triple ligation, and make sure to transform that tomorrow</span></li><li class="c7"><span class="c0">Make cryo stocks of starter cultures</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Protocols</span><span class="c0">:</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Heat shock transformation of the NB with triple ligations (hyb.ompa+aox_psb1a3) (Scott)</span></p><p class="c1"><span class="c0">1. hyb.ompa+aox1a-FR+psb1a3</span></p><p class="c1"><span class="c0">2. hyb.ompa+aoox1b-FR+psb1a3</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">10 &#1405;L Nova Blue cells + 5 &#1405;L of Ligation Reaction (hyb.ompa+aox+psb1a3) from 9.30.2010 that Gita did</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4 c11">See Protocols page for Heat Shock Transformation </span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">Observations of Starter cultures</span></p><p class="c1"><span class="c0">Culture1 has a slight pink hue, while culture 2 does not; the rest have pink hues less than that of culture 1.</span></p><p class="c1"><span class="c0">CryoStocks of Start cultures from 10.1.2010 of hyb+RFP+psb1a3 in BL21</span></p><p class="c1"><span class="c0 c2">Cryostocks</span></p><p class="c1"><span class="c0">Colonies 1,2,3,4,5,6,8 of HybB+RFP+pSB1A3 in Bl21 cells</span></p><p class="c1"><span class="c0">600 uL of cells</span></p><p class="c1"><span class="c0">900 uL Glycerol</span></p><p class="c1"><span class="c0 c4">Total 1.5 mL</span></p><p class="c1"><span class="c0">Mix, place in -80c Freezer</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">Repeat of Triple Ligations (hyb.ompa +aox+psb1a3)</span></p><p class="c1"><span class="c0 c2">Triple Ligation of AOX1a-FR to HybB.Ompa and psb1a3 (Margo)</span></p><p class="c1"><span class="c0">using AOX1a-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c1"><span class="c0 c11">Calculating equivalents:</span></p><p class="c1"><span class="c0">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c1"><span class="c0">AOX1a-FR -[ 25 ng/uL]/1035 bp = 0.0241 eq/uL</span></p><p class="c1"><span class="c0">pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL</span></p><p class="c1"><span class="c0">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c1"><span class="c0">Ligation:</span></p><p class="c1"><span class="c0">1.4 uL of Aox1a/b-FR -</span></p><p class="c1"><span class="c0">2 uL of Hyb.Ompa</span></p><p class="c1"><span class="c0">3 ul pSB1A3</span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c1"><span class="c0">2.1 uL H20</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c1"><span class="c0 c4">Total=10 uL</span></p><p class="c1"><span class="c0 c4">&nbsp;</span></p><p class="c1"><span class="c0">1 hr RT, labeled A</span></p><p class="c1"><span class="c0">Ligation Start: 1:14 pm</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Triple Ligation of AOX1b-FR to HybB.Ompa (Margo)</span></p><p class="c1"><span class="c0">using AOX1b-FR from 9/17/2010 [Edit 9.29.2010 is this from 17th or 27th?] and HybB.Ompa from 9/29/2010</span></p><p class="c1"><span class="c0 c11">Calculating equivalents:</span></p><p class="c1"><span class="c0">HybB.Ompa- [ 4.1 ng/uL]/474 bp= 0.009 eq/uL</span></p><p class="c1"><span class="c0">AOX1b-FR -[ 23 ng/uL]/1047bp = 0.022 eq/uL</span></p><p class="c1"><span class="c0">pSB1A3- [6ng/uL]/2056bp=0.003 eq/uL</span></p><p class="c1"><span class="c0">for linear ligations, use a 2:2:1 ratio of products:product:vector</span></p><p class="c1"><span class="c0">Ligation:</span></p><p class="c1"><span class="c0">1.2 uL of Aox1b-FR -</span></p><p class="c1"><span class="c0">2 uL of Hyb.Ompa</span></p><p class="c1"><span class="c0">3 ul pSB1A3</span></p><p class="c1"><span class="c0">1 uL 10x Ligase Buffer</span></p><p class="c1"><span class="c0">2.3 uL H20</span></p><p class="c1"><span class="c0">0.5 uL T4 Ligase</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4">Total=10 uL</span></p><p class="c1"><span class="c0">1 hr RT labeled B</span></p><p class="c1"><span class="c0">Ligation Start: 1:14 pm</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Checking PCR from 10.1.2010 on Gel</span></p><p class="c1"><span class="c0">Gel start 1:11 pm</span><img height="1040.0" src="images/image7.png" width="800.0"></p><p class="c1"><span class="c0">Order :</span></p><p class="c1"><span class="c0">1kb ladder|PCR 1|PCR 2|PCR3|PCR 4 hyb+ompa from 9.28.2010|ladder</span></p><p class="c1"><span class="c0 c2">PCR1=</span><span class="c0"> &nbsp;PCR of hybB.ompA.Aox1a F,R ligation using Hyb-F and OmpaR</span></p><p class="c1"><span class="c0 c2">PCR2=</span><span class="c0"> &nbsp;PCR of hybB.ompA.Aox1b F,R ligation using Hyb-F and OmpaR</span></p><p class="c1"><span class="c0 c2">PCR3=</span><span class="c0"> &nbsp;PCR of &nbsp;hybB.ompA.Aox1a F,R ligation using &nbsp;OmpaF and Aox1a-R</span></p><p class="c1"><span class="c0 c2">PCR4=</span><span class="c0"> &nbsp;PCR of &nbsp;hybB.ompA.Aox1b F,R ligation using &nbsp;OmpaF and Aox1a-R</span></p><p class="c1"><span class="c0 c2">Observations of Gel</span></p><p class="c1"><span class="c0">Well 3 (the empty one) should not be empty! Perhaps misloaded?</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">Heat shock transformation of the NB with triple ligations (HybB.OmpA+AOX_psb1a3) (Margo)</span></p><p class="c1"><span class="c0">1. hyb.ompa+aox1a-FR+psb1a3 (from 10.2.2010)</span></p><p class="c1"><span class="c0">2. hyb.ompa+aoox1b-FR+psb1a3 (from 10.2.2010)</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0">10 &#1405;L Nova Blue cells + 5 &#1405;L of Ligation Reaction (hyb.ompa+aox+psb1a3) from 2 OCT 2010 that Margo did</span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c4 c11">See Protocols page for Heat Shock Transformation </span></p><p class="c1"><span class="c0">&nbsp;</span></p><p class="c1"><span class="c0 c2">For Tomorrow</span></p><ol class="c5"><li class="c7" value="1"><span class="c0">Run on a gel</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">aoxa, aoxb next to the troubleshooting pcrs from today, specifically of the PCRS using Ompa-F and Aoxa/b-R since they are similar sizes</span></li></ol><ol class="c5"><li class="c7" value="2"><span class="c0">Take out plates from incubator. Record observations</span></li></ol><ol class="c6"><li class="c8" value="1"><span class="c0">Run colony PCRs on at least 20 colonies per construct (yes 20)</span></li></ol><ol class="c12"><li class="c3" value="1"><span class="c0">Check which primers to use for colony pcr! We can likely use the primers we already have</span></li><li class="c3"><span class="c0">Run results on gel</span></li></ol><p class="c1"><span class="c0">&nbsp;</span></p>