Team:Harvard/allergy/notebook

(Difference between revisions)

notebook calendar

Week 1	06-14-2010	06-15-2010	06-16-2010	06-17-2010	06-18-2010
Week 2	06-21-2010	06-22-2010	06-23-2010	06-24-2010	06-25-2010
Week 3	06-28-2010	06-29-2010	06-30-2010	07-01-2010	07-02-2010
Week 4		07-06-2010	07-07-2010	07-08-2010	07-09-2010
Week 5	07-12-2010	07-13-2010	07-14-2010	07-15-2010	07-16-2010
Week 6	07-19-2010	07-20-2010	07-21-2010	07-22-2010	07-23-2010
Week 7	07-26-2010	07-27-2010	07-28-2010	07-29-2010	07-30-2010
Week 8	08-02-2010	08-03-2010	08-04-2010	08-05-2010	08-06-2010
Week 9	08-09-2010	08-10-2010	08-11-2010	08-12-2010	08-13-2010

06-14-2010 [ top ]

06-15-2010 [ top ]

06-16-2010 [ top ]

06-17-2010 [ top ]

06-18-2010 [ top ]

06-21-2010 [ top ]

• PCR amplification of gDNA from Arabadopsis thaliana for sense and antisense parts of LTP, Bet v 1, and Ger3.
• Diagnostic Digest of PCR products

Results

Lane 2 is LTP sense, lanes 11 and 12 are Ger 3 sense and antisense.

06-22-2010 [ top ]

• Gel electrophoresis of PCR products
• Gel digest and purification of LTP sense, Ger sense and Ger antisense
• Digest with Xba and Pst
• Purification of parts

Results
Gel purification yielded 2.6, 7.8, and 7.9 ng/μL of LTP sense, Ger sense, and Ger antisense parts. We were able to obtain 1.5, 4.3 and 0.5 ng/μL of digested LTP sense, Ger 3 sense, and Ger 3 antisense, respectively, from the digest purification.

06-23-2010 [ top ]

• Digest and purification of vector V0120
• Ligation of LTP sense, Ger sense, and Ger antisense parts into V0120

Results
Ligations were plated.

06-24-2010 [ top ]

06-25-2010 [ top ]

06-28-2010 [ top ]

06-29-2010 [ top ]

06-30-2010 [ top ]

07-01-2010 [ top ]

• Ligations for full amiRNA and V0120 (w/o death gene)

note: .5 denotes multistep pcr reaction from yesterday in which .5 uL of part 3 of gfp/ltp were use in one of the giant assemblies of parts 1,2,3 w/ primers A&B

Ligation Reactions

	Bet	GFP	LTP	LTP(.5)	GFP(.5)
DNA Insert (after 1:10 dilutions)	3	4.5	3	4.71	4.1
T4 DNA ligase buffer (10x)	2	2	2	2	2
diH2O	11.5	10	11.5	9.79	10.4
T4 DNA ligase	1	1	1	1	1
DNA Backbone	2.5	2.5	2.5	2.5	2.5

• • Used 50 ng of backbone and 150 ng of insert (ratio of insert to vector ~.14
  • Did 1:10 dilutions for the digested inserts

• PCR of PME3 and PAL2
  • saw no bands from last night's pcr so we re ran it

Annealing Temp: 69C Extension Time: 30 sec

2 reactions (PME & PAL)

Name	Amount (uL)
10mM dNTPs	1
5x Phusion Buffer	10
Phusion Polymerase	.5
Arabadopsis Genomic DNA	1
Fwd/Rev Primer	.5 uM each (1uL 50x)
Water	35.5

Concentrations: PME: 250 ng/uL PAL: 134 ng/uL

• gel: lane 1:ladder; lane 2: Pal3; lane 3: Pme 2; lane 4: ladder

• Sent amiRNA Bet for sequencing

• Ligation of Antisense/sense allergens into V0120 (lacking death gene)

Ligation Reactions

	BetS	BetA	LTPS	LTPA	GerS	GerA	Bet 1.2S	Bet 1.2 A	Negative Control
DNA Insert (after 1:10 dilutions) ~ 3 times excess	3	3	3	3	3	3	3	3	0
T4 DNA ligase buffer (10x)	2	2	2	2	2	2	2	2	2
diH2O	12	12	12	12	12	12	12	12	15
T4 DNA ligase	1	1	1	1	1	1	1	1	1
DNA Backbone	2	2	2	2	2	2	2	2	2

• • Used 34 ng of backbone and 10 ng of insert (ratio of insert to vector ~.09375

07-02-2010 [ top ]

• Check on sequences for Bet
• Digest Pme3 and Pal 2 introns/Ligate w/ V0120/Transform
  • Digestions

Digestion Reactions

	PME 3 (4 digestions)	Pal 2 (4 digestions)	Backbone (B21 w/ YFP)
DNA	4 (~1000ng)	7 (~1000ng)	3 (~900 ng)
FD Buffer (10x)	2	2	2
diH2O	12	9	13
EcoRI	1	1	1
SpeI	1	1	1

• • PCR purified digests
    • Concentrations: Pme (ranges from 20-36 ng/uL); Pal (ranges from 20 to 28 ng/uL)
  • Ran backbone on gel and gel purified (Concentration: 3.1 ng/uL)

• Ligations of Pme/Pal w/ V0120

Ligation Reactions

	Pme4	Pal3	Pme5	Pal1
DNA Insert	1.85	1	1	4.86 after 1 in 10 dilution
T4 DNA ligase buffer (10x)	2	2	2	2
diH2O	14.15	15	6.3	--
T4 DNA ligase	1	1	1	1
DNA Backbone	1 (bbone 2)	1 (bbone 2)	14	9.64

• • bbone 2 was potentially contaminated at a higher concentration 96.1 ng/uL

• Check on transformations of amiRNA (5 transformations) and antisense/sense allergens (8 transformations)
  • There were colonies from the amiRNA transformations
    • We grew up 24 colonies (3 for each GFP, GFP .5, LTP, LTP .5, BET) ~ 10 am to be ready ~3 pm for minipreps)
    • The other 8 transformations did not show any colonies--we put it back in to see if we would get colonies (only 100 uL instead of 200 uL was plated)
    • To do: Grow up colonies to miniprep, run on gel, sequence

• pHannibal and pKannibal arrived today (hannibal is amp resistant and kannibal is kan resistant)
  • We transformed these plasmids

07-06-2010 [ top ]

Team Allergy

Today, we isolated plasmid that contained antisense and sense sequences of the allergen panel and introns PME and PAL that we grew last week.

Procedures

For amiRNA

1. Nanodrop of miniprepped amiRNA plasmids
2. Diagnostic digest of amiRNA plasmids
3. E Gel of digested amiRNA
4. Send plasmids to Genewiz for sequencing

For ihpRNA

1. Miniprep of plasmids containing introns for hpRNA
2. Nanodrop of miniprepped intron plasmids
3. Miniprep of plasmids containing Allergen Panel sense and antisense
4. Nanodrop of minipreped allergen plasmids
5. Diagnostic Digest of introns and allergens
6. E Gel of digested parts
7. Extract pKannibal and pHannibal vectors and transform into E. coli
8. PCR of the PDK intron in pKannibal and pHannibal

Results

For amiRNA

Miniprep of turbo bacteria for plasmids containing sequences for amiRNA

Should obtain plasmids containing the complete sequence for amiRNA. The resulting concentration should be relatively high (<100ng/μL) because all growing bacteria would have the plasmids inside.

Nanodrop of miniprepped amiRNA plasmids

We used 2μL of DNA per nanodrop.

Concentrations in ng/μL

Sample # -->	One	Two	Three
GFP	134.4	167.6	207.2
GFP 0.5	163.3	106.9	230.9
LTP	134.0	127.8	165.5
LTP 0.5	158.5	137.2	113.5
Bet	129.4	78.9	124.4

Diagnostic digest of amiRNA plasmids Digested 200~500ng of plasmids with EcoR1 and Spe1. We will then run the digested vectors on an E Gel and look for DNA that is the length of the insert. If such DNA appears on the gel, then we will send it off to be sequenced.

E Gel of digested amiRNA

We had to run 21 samples, so we used two gels. The orders were:

Gel #1

1. 1kb Ladder
2. GFP 1
3. GFP 2
4. GFP3
5. GFP 0.5 1
6. GFP 0.5 2
7. GFP 0.5 3
8. LTP 1
9. LTP 2
10. LTP 3
11. LTP 0.5 1 no visible band for neither plasmid nor insert
12. LTP 0.5 2

Gel #2

1. 1kb Ladder
2. LTP 0.5 3
3. Bet 1
4. Bet 2
5. Bet 3
6. Neg Control for hpRNA (digested with Xba and Pst, and ligated without new inserts) no visible insert band
7. Neg Control for intron (digested with Eco and Spe, and ligated without new inserts)
8. PME Good no visible insert band
9. PME Dubious no visible insert band
10. PAL Good colony 1 no visible insert band
11. PAL Good colony 2
12. 1kb Ladder

For ihpRNA

Miniprep of plasmids containing introns for hpRNA Nanodrop of miniprepped intron plasmids

We used 2μL of DNA per nanodrop.

Concentrations in ng/μL, cells are filled when applicable

Insert Name	Good	Dubious	Colony 1	Colony 2	Colony 3
PME	85.6	66.8
PAL			67.7	108.8
Neg Control, Intron	74.0
Neg Contron, hpRNA			63.5	30.1	37.3

1. Miniprep of plasmids containing Allergen Panel sense and antisense (from overnight cultures)--still need to do preps of cultures grown today
2. Nanodrop of minipreped allergen plasmids
3. Diagnostic Digest of introns and allergens
4. E Gel

Gel #1

Lane 1: 1kb Ladder

Lanes 2-4: Ger Sense

Lanes 5-7: Ger Antisense

Lanes 8-10: LTP Sense

Lanes 11-13: LTP Antisense

Lanes 14-16: Bet 2 Sense

Lanes 17-19: Bet 2 Antisense

Lanes 20-22: Bet 1 Sense

Lanes 23-25: Bet 1 Antisense

phannibal and pkannibal Extracted vectors from a piece of paper per instructions. Transformed vectors into E. coli. Miniprep and PCR to extract PDK intron.

• pcr to get out pdk intron

07-07-2010 [ top ]

Yesterday, we ended by transforming pKannabil and pHannibal into E. coli and running a diagnostic digest of digested allergen panel. Yesterday's plates did not grow, and the diagnostic digest did not have good results.

• Today, we will be redoing diagnostic digests of the allergen panel plasmids to see if we can see our desired bands (300 bp and 3200) and re-transforming pKannabil and pHannibal.
  • If the digested allergen panel runs correctly on a gel, then we will send the plasmids off for sequencing.
  • If nothing gel does not run correctly, then we will go back to re-digest V0120 with a death gene insert instead of YFP and ligate allergen inserts, transform, miniprep, and see if we get the correct insert. **If some run correctly and some did not, we will collect more samples from our culture plates for the allergens that did not work and redo the digests until we find a sample with the correct plasmid.
• If the pKannabil and pHannibal plates grow, then we will miniprep to purify the plasmids containing the PDK intron, PCR the intron, and purify the intron.
• Today, we are also running the PDK intron obtained yesterday to see if it is the correct length.

First thing tomorrow, we will culture E. coli containing plasmids for our allergen panel to obtain more plasmids.

Procedures

For pKannabil and pHannibal:

1. Electronic Gel Electrophoresis of PDK introns (from PCR reaction yesterday, PCR off DNA from the eluted vectors)
2. Re-grow E. coli containing pKannabil and pHannibal plasmids
3. Culture colonies
4. Miniprep colonies
5. PCR for PDK intron
6. Diagnostic Gel to check for correct length
7. Repeat PCR of PDK intron using different Tm (gradient pcr)

For Allergen panel

1. Digest of Plasmids containing allergen inserts
2. Diagnostic Gel
3. Collect additional samples for allergens that did not work

Results

For pKannabil and pHannibal

Transformation of pHannibal pKannibal

This transformation we performed slightly differently from the one yesterday. This protocol is nicknamed the "quick and dirty transform." The transformation we started yesterday of pH and pK didn't work (no growth on either plate).

Quick and Dirty Transform:

1. Mix
   1. 2ul 10x {pHannibal, pKannibal}
   2. 20ul Turbo E. Coli
   3. 220ul SOC Broth
2. Plate on {LB+(pHannibal->LB+Amp, pKannibal->LB+Kan), LB} Agar, grow

PCR of PDK intron

• PCR of PME3 and PAL2
  • saw no bands from last night's pcr so we re ran it

Annealing Temp: 69C Extension Time: 30 sec

2 reactions

Name	Amount (uL)
10mM dNTPs	1
5x Phusion Buffer	10
Phusion Polymerase	.5
Arabadopsis Genomic DNA	7 ng
Fwd/Rev Primer	.5 uM each (1uL 50x)
Water	35.5

Concentrations: PDK:46.5 ng/uL & 36.5 ng/uL Didn't work. Our theory is that the Tm we used (the one IDT sent us) was too high. IDT assumes that the entire primer is going to anneal to a strand of DNA when they calculate their Tm, but since half of our primer won't anneal (the half that doesn't anneal was used to prepend/postpend the biobrick sequences) the Tm IDT calculates will be too high. Here are more correct calculations from Primer3:

OLIGO            start  len      tm     gc%   any    3' seq 

LEFT PRIMER       4229   20   51.11   30.00  8.00  3.00 CCAATTGGTAAGGAAATAAT
RIGHT PRIMER      5021   20   61.95   45.00  6.00  0.00 TTCGAACCCAATTTCCCAAC

See Gel Image Below: ladder, lane 3 and 5 are pdk intron

Gradient PCR

Annealing Temps: 50,55,60,65

Extension Time: 30 sec

8 reactions

Name	Amount (uL)
10mM dNTPs	1
5x Phusion Buffer	10
Phusion Polymerase	.5
Arabadopsis Genomic DNA	7 ng
Fwd/Rev Primer	.5 uM each (1uL 50x)
Water	35.5

Concentrations: PDK: 12.7 ng/uL

Remaining steps

1. Culture colonies
2. Miniprep colonies
3. PCR for PDK intron
4. Diagnostic Gel to check for correct length
5. Repeat PCR of PDK intron using different Tm.

For Allergen panel

Digest of Plasmids containing allergen inserts

Digested with Xba and Pst using Fast Fermentas digest protocol. Added 3 μL of DNA and 17μL of master mix (with 0.5μL of each restriction enzyme) to each reaction.

Diagnostic Digest

• • Digestions

Digestion Reactions

	LTPS (3)	LTPA (3)	GRES (3)	GREA (3)	Bet1S	Bet1A	Bet1.2S	Bet1.2A
DNA	(~200 ng)	(~200 ng)|align="center" | (~200 ng)|align="center" | (~200 ng)|
FD Buffer (10x)	2	2	2	2
diH2O	x	x	x	x
Xba1	1	1	1	1
Pst1	1	1	1	1

• • Ran on a gel

240 px

Out of the 24 lanes, 6 were successful. Of the 8 allergens, 3 were successful. Samples of LTP sense, Betv1 sense, and Ger sense had one band at around 3kbps and one band at 300bps. The other genes had one band at 3kbps and additional longer bands on the scale of twice or three times the length of the plasmid.

For the allergens that did not work, we will go back to our bacteria plates and sample 5 additional colonies for each allergen, grow up 10 mL overnight cultures, and miniprep so that we can redo the diagnostic digest. We are hoping that a larger sample size would allow us to find colonies with the correct plasmid.

Remaining Steps

1. Collect additional samples for allergens that did not work
2. Culture them
3. Miniprep
4. Diagnostic Digest and Gel

07-08-2010 [ top ]

amiRNA

• Sent out plasmids for sequencing w/ new primers

Allergen Panel

• Sent out for sequencing this morning using new primers
• Minipreps of Allergen Panel
  • Concentrations:

LTP 1,2,3: 265.5 ng/uL, 507.1 ng/uL, 275.5 ng/uL;

GerA 1,2,3,4: 283.1 ng/uL, 185.9 ng/uL, 182.4 ng/uL, 314.7 ng/uL;

Bet 2A 1,2,3,4: 246.6 ng/uL, 251.4ng/uL, 550.3 ng/uL, 235.8 ng/uL;

Bet 2S 1,2,3,4,5,6: 613 ng/uL, 296.8 ng/uL, 333.1 ng/uL, 467.3 ng/uL, 230.3 ng/uL, 129.4 ng/uL;

Bet 1A 1,2,3,4,5: 505.8 ng/uL, 632.1 ng/uL, 561.7 ng/uL, 594.4 ng/uL, 609.2 ng/uL

• Diagnostic Digest

PDK intron

• Gradient PCR of PDK intron

Gel of gradient PCR of the 741bp PDK intron out of pHANNIBAL and pKANNIBAL. Lanes are (left to right, temperatures are annealing temperatures used in the gradient PCR) 1kb+ ladder, pHAN 50ºC, pKAN 50ºC, pHAN 55ºC, pKAN 55ºC, pHAN 60ºC, pKAN 60ºC, pHAN 65ºC, pKAN 65ºC.

It appears that pHANNIBAL worked at 50, 55ºC but pKANNIBAL didn't.

Concentration: hannibal pdk 12.7 ng/uL kannibal pdk: 15.6 ng/uL

Did a PCR of the PCR product

Annealing Temps: hannibal pdk (50 C); kannibal pdk (55 C)

Extension Time: 30 sec

12 reactions (6 hannibal pdk; 6 kannibal pdk)

Name	Amount (uL)
10mM dNTPs	1
5x Phusion Buffer	10
Phusion Polymerase	.5
pdk	1 uL DNA (12.6 and 16.5 ng)
Fwd/Rev Primer	.5 uM each (1uL 50x) at .5 uM
Water	35.5

• Growing up 5 mL cultures of pHannibal and pKannibal for getting more DNA for pdk pcr
  • Gel purifying/digesting/ligating/transforming pdk intron into e.coli

07-09-2010 [ top ]

• PCRd pHAN.pdk, pKAN.pdk (they're the same 741bp pdk) using the values that worked in the gradient, got them in high ODs. Put them in box a2 rows 3-4.

Concentration of PCR products in ng/ul

Temp(ºC)	Source	Label	Concentrations
55	H	HPDK55	64.0,190.9,66.4
50	H	HPDK50	119.3,125.5,92.4
55	K	KPDK55	84.3,97.3,106.5
50	K	KPDK50	52.5,93.5,71.0

07-12-2010 [ top ]

Today, we received sequences for the allergen , intron, and amiRNA inserts. Since 4 of the 8 allergen inserts were not correctly done (and were not set for sequencing) and we want to repeat the inserts that DID work, we will redo ligations for the entire panel.

Procedures

1. Check Sequencing Results
2. Redo Ligations for allergen Panel

Results

Sequencing Results

• amiRNA
  • GFP #1 & GFP.5 #3 worked
  • Bet,LTP did not work
• intron
  • Pal(#2) matched
• ihpRNA
  • LTP Sense 1,2,3 and Ger Sense 1 matched
  • Bet sense did not match

Full report (annotated sequences): File:Report.zip

Redo Ligations w/ phosphatized backbone for entire allergen panel,

PME did not grow, we will not use it since we have good PDK and PAL introns.

PAL and PDK will be digested and inserted into a plasmid containing a sense strand of an allergen.

Add PDK to amiRNA vectors if sequences match up

07-13-2010 [ top ]

Digestion

Digestion Reactions for Backbones (plasmids containing sense)

	pLTPS1	pLTPS2	pLTPS3	GerS1
DNA	10	8	7	10
FD Buffer (10x)	2	2	2	2
diH2O	6	8	9	6
Spe	1	1	1	1
Pst	1	1	1	1

• add phosphatase to backbone (15 min)

Digestion Reactions for Inserts

	Pal2	PDK
DNA (~ 1 ug)	9
FD Buffer (10x)	2	2
diH2O	7
Xba1	1	1
Pst1	1	1

• gel purify backbones LTPS: 8.7 ng/uL Ger: 9.4 ng/uL
• pcr purify digested pdk: PDK1 14.4 ng/uL; PDK2 22.4 ng/uL; PDK3 11.4 ng/uL; PDK4 15.3 ng/uL

Ligations

Ligations of PDK w/ V0120 (lacking YFP)

Ligation Reactions

	Pdk1	Pdk2	Pdk3	Pdk4
DNA Insert	2.36	2.98	1.52	2.22
T4 DNA ligase buffer (10x)	2	2	2	2
diH2O	12.64	12.02	13.48	12.78
T4 DNA ligase	1	1	1	1
DNA Backbone (~50ng)	2uL	2uL	2uL	2uL

Ligations of PDK/Pal into V0120 + Sense Allergens (LTP & GER)

Ligation Reactions 3:1 excess

	PDK1	PDK2	PDK 3	PDK 4
DNA Insert (~36ng/ ~32 ng))	2.51; 2.27	1.62;1.46	3.18; 2.86	2.37;2.13
T4 DNA ligase buffer (10x)	2	2	2	2
diH2O	8.49; 9.73	9.38; 10.54	7.82;9.14	8.63;9.87
T4 DNA ligase	1	1	1	1
DNA Backbone (~50ng/(~47ng)	LTP1S 6; GerS 5	LTP1S 6; GerS 5	LTP1S 6; GerS 5	LTP1S 6; GerS 5

07-14-2010 [ top ]

• Genomic DNA extraction
  • PCR for allergen panel from genomic DNA
• Grew up cultures of transformations from yesterday (LTPS+intron; GerS+intron; PDK+V0120)--tubes weren't cloudy so we grew overnight cultures again

8 reactions (Ger S/A; BetS/A; Bet1.2 S/A; LTP S/A)

Annealing Temp: 65 C Extension Temp: 30 sec

Name	Amount (uL)
10mM dNTPs	1
5x Phusion Buffer	10
Phusion Polymerase	.5
DNA	1 uL
AB primer mix (1x)	2.5
Water	35

Concentrations: BetS: 109.1 ng/uL; BetA: 90.5 ng/uL; GerS: 69 ng/uL; GerA: 46 ng/uL; LTPS:36.7 ng/uL; LTPA:5.2 ng/uL; Bet1.2S: 77.4 ng/uL; Bet1.2A:66.2 ng/uL; PME: 64.2 ng/uL; PAL: 62.9 ng/uL; PDK: 35.7 ng/uL; PDK(2): 81.3 ng/uL; PDK(3): 21.5 ng/uL

07-15-2010 [ top ]

Today, we did minipreps of intron and backbone. Would have also done minipreps of intron plus allergen part but none of those colonies grew.

We also miniprepped Betv1.2 Sense, Betv1.1 Sense, Bet 1.2 Antisense, and Ger Sense of the plates that we grew on Monday. The rest of the allergen panel did not grow properly. What colonies that WERE on the plate grew probably because AMP was not spread properly on the plate. We deduced this because those colonies could not grow in liquid media. We are waiting on more LB amp plates so that we can redo ligations, which is probably the reason for our lack of colonies.

We will do diagnostic digests of all miniprepped DNA.

Results

• Minipreps of PDK+V0120 (LTPS+ PDK and Ger_S + PDK did not grow)
  • Made glycerol stocks 500uL of 80% glycerol + 500 uL cells

• • Concentrations of pPDK: 414.2 ng/uL; 478.8 ng/uL; 510.2 ng/uL; 119.2 ng/uL
    • Tomorrow, sending PDK+V0120 for sequencing

• Looking at sequencing results for our other amiRNA parts
  • Only GFP worked from our first sequencing order. This time, none of the artificial parts had the right sequence
  • Repicking amiRNA colonies to miniprep (6 of each LTP, LTP 0.5, and Bet. We have correct GFP from our first sequencing order)

• Minipreps of Bet 1S (2 colonies); Bet 1.2 S (1 colony); Bet 1.2 A (1 colony); Ger S (3 colonies)
  • Redoing Ligations & Transformations of Sense/Antisense Parts once we have LB + amp plates
  • Bet 1.1 S: 161 ng/uL & 199.2 ng/uL; Bet 1.2 A: 199.4 ng/uL; Bet 1.2S: 162.5 ng/uL
  • Concentrations of GerS: 347.7 ng/uL; 428.6 ng/uL 541.6 ng/uL

• Diagnostic Digest of (PDK+V0120; GERS; BetS; Bet 1.2S/A)

Digestions

	pPDK (1-4)	pGERSPDK (1-3)	Bet1S (2); Bet2S/A
DNA	1	1	1
FD Buffer (10x)	2	2	2
diH2O	15	15	15
Xba1	1	1	1
Pst	1	1	1

• Ran on gel (Ladder, pdk, V0120 Backbone, Gers (1-3), Bet 1S (1,2), PDK (1-4), Bet 1.2 S, Bet 1.2 A

To send for sequencing: ger s, Bet 1S, PDK 2

• Looking at PCR results for Allergen Panel from Genomic DNA that we extracted (did not work)

Ladder, GFPS, GFPA (These first two should not work), LTPS, LTPA, BetS, BetA, Bet2S, Bet2A, GerS, GerA, PME, PAL, PDK

07-16-2010 [ top ]

More arabadopsis DNA arrived today. We are going to obtain more hpRNA parts and

• Did a second PCR/Purification of our allergen panel from Julia's arabidopsis genomic DNA. It worked!

GFP didn't show up (first 2 lanes). The plants for the extraction weren't the GFP variety so this is expected.

• gel purifying PCR products
  • Concentrations: LTPS: LTPA: GERS: GERA: BETS: BETA: BET2S: BET2A: PME: PAL:

• Digested Xba1 Pst1
• Sent BetS, PDK2, and GerS (3) for sequencing
• Miniprep amiRNA

Nanodrop of Miniprepped amiRNA Concentrations

Concentrations in ng/μL of colonies 1~6

	1	2	3	4	5	6
LTP	320.7	359.4	290.2	238.5	N/A	212.4
Bet	156.8	267.7	340.0	287.4	278.9	273.5
LTP 0.5	296.4	268.8	244.2	212.0	292.6	208.3

Diagnostic Gel: Ladder, Bet1-6, LTP1-LTP4, Ladder; Ladder, LTP6, LTP.5 (1-6), Ladder

07-19-2010 [ top ]

• Got back sequencing results of GerS, BetS, PDK
  • All three samples of GerS and PDK sent in matched their corresponding sequences

• Ran PCR of Friday's digested B21. The gel suggested a partial digest: we saw two bands of backbone where we should have seen only one:

• Sending 6 samples of amiRNA (LTP.5), 5 samples of amiRNA (LTP), 6 samples of amiRNA (Bet)

• Second digest of B21 appears to have been more successful:

Digestion Reactions

	V0120
DNA	~2.1 ugrams
FD Buffer (10x)	2
diH2O	20-rest
Xba1	1
EcoRI	1

• phosphatized backbone afterwards for 20 min after letting digestion run for an hour
• concentrations
  • backbone: (5 copies each ~ 35 ng/uL)
  • Bet S/A:  ; Bet2S/A:  ; GerS/A:  ; LTPS/A:  ; PME:  ; Pal:

Ligation Reactions

	BetS/A	Bet2S/A	LTPS/A	GerS/GerA	Pme	Pal
diH2O	10-rest	10-rest	10-rest	10-rest	10-rest	10-rest
T4 DNA ligase buffer (10x)	1	1	1	1	1	1
DNA Insert	3 times excess	3 times excess	3 times excess	3 times excess	3 times excess	3 times excess
DNA Backbone	~50ng	~50ng	~50ng	~50ng	~50ng	~50ng
T4 DNA ligase	1	1	1	1	1	1

• Ligated and transformed
  • allergen parts
  • Pme/pal

07-20-2010 [ top ]

07-21-2010 [ top ]

07-22-2010 [ top ]

07-23-2010 [ top ]

07-26-2010 [ top ]

07-27-2010 [ top ]

07-28-2010 [ top ]

07-29-2010 [ top ]

07-30-2010 [ top ]

08-02-2010 [ top ]

08-03-2010 [ top ]

• Grew up cultures of completed ihpRNA constructs (Bet, LTP, Ger) in pORE expression vector
• amiRNA PCR
  • Will look at results of PCR tommorrow

08-04-2010 [ top ]

Tasks

• amiRNA PCR appears to have worked at every Tm we tried:

• Digested V9/V10 to insert our constructs into
  • Realized that we hadn't gel purified our ihpRNA inserts
  • Gel purification of inserts (entire ihpRNA parts)

Ladder, 9, 11c1, 11c2, ladder, 25c1, 28c1, 28c2, 36c1, 36c2, ladder

Results

• Successfully gel purified our inserts and digested backbones that we will ligate into

08-05-2010 [ top ]

• Gel extracted V9/V10 backbone

Lanes: Ladder, V9, Ladder, V10

Concentrations: V9 (9.4 ng/uL; V10 (16.4 ng/uL)

• Ligated ihpRNA inserts into V9/V10 and transformed
  • For our ligations we only used ~ 2uL of backbone (around 18 and 32 ng of backbone)and used a 3x excess of insert
• Verified that amiRNA stitching of Bet, LTP yielded the proper insert with a low level of background through PCR:

Lanes: 1-7: Bet, corresponding to 65.55 degrees C for stitching Tm (even spacing)

Lanes: 8-10: LTP, corresponding to 65.55 degrees C during stitching annealing, even spacing

• Digested
  • Bet,LTP inserts with X+P; B21 with X+P+phosphatase
• Ligated, Transformed

08-06-2010 [ top ]

amiRNA

• amiRNA-transformed turbo cells didn't grow in YEB medium. There should be more LB+Amp available by the end of the day. In the meantime, we're digesting some more backbone (8x20ul X+P+B21)
  • ligations of Bet/LTP into V0120

ihpRNA

• no colonies on plates from transformations done yesterday after 16 hours (we let these plates grow for longer)
• redoing ligations of ihpRNA inserts in V9/V10
  • Redigested and gel purified some backbone

• Concentrations: V9 (5 ng/uL); V10 (6 ng/uL)
  • 12 ligations each for V9 and V10

08-09-2010 [ top ]

• DTLs of amiRNA insert were unsuccessful. Yesterday we concluded this was because turbo cells + amp resistance don't grow on YEB media (we were out of LB+amp media). Today we must adopt a new hypothesis as 0/16 colonies grew on LB+amp media. Working theory is that the backbone digestions pictured below have the digested backbone and inserts as the two bands (top to bottom) instead of the undigested & digested backbone (in hindsight, I was trying to ligate into YFP*2, the original insert of B21). The confusion arose from the 1kb ladder, which at first appeared to match another ladder far better than 1kb (see Thursday's entry or thereabouts). This, combined with the fact that the 1kb ladder was hand-labeled, led me to suspect that it was in fact the other ladder (pR322 as pictured [http://openwetware.org/wiki/Image:Ladders.jpg here]). This, in turn, supported the (theorized incorrect) conclusion that the top & bottom bands [http://openwetware.org/wiki/Image:Bbcut1.jpg here] and [http://openwetware.org/wiki/Image:Bbcut2.jpg here] were undigested & digested backbone, respectively, and that the insert had diffused. I've DTL'd again, this time using the upper band (which didn't separate into digested & undigested bands after running for 30m on a .7% agarose gel) for ligation. We'll see on Monday how it went.

• New Plan of action:

1. Redigest V9/V10 (three digests of each backbone to use more DNA in ligations)
2. Grew up V9/V10+ ihpRNA colonies
3. Re pcrd amiRNA and digested to ligate into V9/V10
4. Catalog parts to be ready for the registry

08-10-2010 [ top ]

ihpRNA

• Only 2 colonies grew up (V10 9 (37c1) and V10 12 B(38 c2)) ger ihprna constructs
  • growing up colonies again in 5 mL cultures w/less antibiotic (50 ng/uL of kan)
  • concentrations: V10_9: 21.4 ng/uL V10_12B: 16.9 ng/uL
• Diagnostic Digest (Should see ~ 7 kb band and 840 band)

• Did not see exepcted bands (waiting on cultures grown up today to miniprep and hopefully transform into agrobacterium tommorow)

amiRNA

• Ligated into V9/V10 and transformed

08-11-2010 [ top ]

• Minipreps of (V95, V91, V99, V99b, V1011, V107B, V1012, V109b)
  • Concentrations (20-60 ng/uL range)
• Diagnostic Digest (should see ~ 7 kb and 840 bp)

Ladder, V9 5 (Bet2), V91(LTP), V99 (Ger), V99B (Ger), V1011 (Ger), V107b(Ger), V1012 (Ger), V109B (Ger)

V10 7B (Ger worked)

08-12-2010 [ top ]

ihpRNA

• Minipreps of more V9/V10 colonies
• Diagnostic Digest of minipreps w/ Eco and Pst (Should see ~840 and 7000 bp)

ladder, V92, V92b, V94, V94b, V95, V96b, V97, V97b, V98, V98b

Lanes 2&3: LTP (11c1); Lanes 4&5: Bet2 (25c1); Lane 6: Bet2 (25c2); Lane 7: Bet2 (28c1); Lanes 8&9: Ger (36c1); Lanes 10&11 Ger (36c2)

• Digested V9/V10 backbone for ligations w/ Eco & Pst (redoing ihpRNA ligations into V9/V10)

amiRNA

• Ligated into V9/V10 and transformed (mutagenesis sites confirmed through pcr using 20 bp sepecific primers)
  • still need to be sequenced

08-13-2010 [ top ]

• Organized parts so we could find them when we came back

<Note: remember to add more pics/less text>