Revision history of "Team:LMU-Munich/Primer"

From 2010.igem.org

Diff selection: mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.

Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
  • (cur | prev) 17:45, 17 August 2010 Emanuel stiegeler (Talk | contribs) (437 bytes) (New page: {| class="wikitable" border="1" |+ '''Used primers and template''' |- ! Primernumber ! Primername ! Sequenz |- | 1 | pduA fwd | GCAGAATTCGCGGCCGCTTCTAGAGACTTTAAGAAGGAGATATACATATGCA |- | 2...)