Revision history of "Team:Harvard/f8"

From 2010.igem.org

Diff selection: mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.

Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
  • (cur | prev) 17:17, 25 October 2010 Mpaull (Talk | contribs) (705 bytes) (New page: {{Harvard_fence}} <html> <div id="maincontent"> <div id="abstract"> <h1>Gal4 DNA Binding Domain</h1> aagctactgtcttctatcgaacaagcatgcgatatttgccgactta<br> aaaagctcaagtgctccaaagaaaaaccgaag...)
Retrieved from "http://2010.igem.org/Team:Harvard/f8"