Revision history of "Team:Harvard/allergy/amiRNA"

From 2010.igem.org

Diff selection: mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.

Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
  • (cur | prev) 08:05, 13 October 2010 Anugraha (Talk | contribs) (141 bytes) (New page: '''Primers:''' Forward Primer: CCTTGAATTCGCGGCCGCATCTAGA CCCACAAACACACGCTCGGA Reverse Primer: AAGGCTGCAGCGGCCGCTACTAGT CCCCATGGCGATGCCTTAAA)
Retrieved from "http://2010.igem.org/Team:Harvard/allergy/amiRNA"