Team:ULB-Brussels/QAModule

From 2010.igem.org

(Difference between revisions)

Latest revision as of 20:43, 27 October 2010

Homologous recombination

Modeling

Quorum Addiction

Table of content

List of used abreviations
Introduction
Materials and methods
- Assembly of genetic sequences
Results
Annex
Primers sequences
- Antidote plasmid
- Poison plasmid

List of used abreviations

Abreviation	Signification
HSL	3-oxo-hexanoyl-homoserine lactone
aiiA	HSL degrading protein (BBa_C0060)

Introduction

In our project, it was important to make sure that Hydrocoli would not be released into the environment of the sewage treatment plant. The QUORUM ADDICTION MODULE ensures that bacteria escaping the sewage treatment plant are killed.

Concept used
Quorum sensing : The quorum sensing is a mechanism used by bacteria to perceive their own concentration, or the concentration of other species in their environment. To do that, the bacteria secretes homoserine lactones which vary depending on the bacterial species. These molecules control the expression of hundreds of genes such as genes involved in biofilm formation or virulence factor. In the Hydrocoli project, we used two genes belonging to the lux operon of Vibrio fischeri (luxR and luxI).
The parDE poison-antidote system : Poison-antidote systems are composed of 2 genes; one encoding a toxic protein and the other encoding its cognate antidote. These systems are abundant in bacterial genomes, although their role in bacterial physiology is still uncertain. When they are located on plasmids, these systems contribute to plasmid stability.
The Quorum addiction module is based on two plasmids that ‘interact’ with each other. These plasmids, once integrated into the bacterial strain, allow the bacteria to survive in condition in which the bacterial density is high enough. In condition in which the bacterial density decreases, a toxin gene is expressed and the toxin will eventually lead to cell death.

For the construction of this module, BioBricks of cell-cell signaling pathways were used as well as the well-characterized parDE poison-antidote system.

The first construction was named the antitoxin plasmid. It contains the ‘HSL-LuxR activated’ promoter (BBa_R0062), the luxI gene (BBa_C0061), the luxR gene (BBa_C0062), the parD (antitoxin) gene and a double terminator sequence (BBa_B0015).

The second construction was named the toxin plasmid. It contains the ‘HSL-LuxR repressed’ promoter (BBa_R0061), the aiiA gene (BBa_C0060), the parE (toxin) gene and a double terminator sequence (BBa_B0015).

In the sewage treatment plant:
When bacteria are in the sewage treatment plant, the genes of the antitoxin plasmid are expressed to a basal level and the LuxI, LuxR and ParD proteins are produced. Expression of LuxI leads to HSL production. As HSL is able to diffuse ‘in and out’ of the bacterial cell, both the ‘outside’ and intracellular HSL concentration will be high. This will have an opposite effect on the antitoxin and toxin plasmids. On the one hand, the LuxR-HSL complex binds to the ‘HSL-LuxR activated’ promoter and activates the transcription of luxI, luxR and parD genes located on the antitoxin plasmid. This is a positive feedback loop. More and more HSL, LuxR and ParD are produced. On the other hand, the same LuxR-HSL complex has an opposite effect on expression of the genes encoded by the toxin plasmid. It binds to the ‘HSL-LuxR repressed’ promoter and inhibits the aiiA and parE gene expression. In these conditions, bacteria are growing ‘happily’ and do their job in the sewage treatment plan

Out of the sewage treatment plant:
If bacteria escape out of the sewage treatment plant and end up in the outside environment, the HSL concentration will immediately drop. This will lead to a drastic drop of the intracellular HSL concentration and therefore, expression of the antitoxin plasmid genes will be inhibited while that of the toxin plasmid genes will be activated. The ParE toxin will be produced as well as AiiA, an HSL degrading enzyme (aiiA, (BBa_C0060)). The ParE toxin will kill the bacteria and the AiiA enzyme will ensure a complete removal of HSL.

Materials and methods

Assembly of genetic sequences

Given the many parts to be assembled, a different technique from the usual technique was used. The assembly of the two constructions was performed by PCR. Primers have been designed to "stick" together two genes (see primer sequences in annex).
The first step was to amplify each part separately.

Here (at the top and bottom of the image) the oligos of the first step “stick” to the gene of interest (in orange in the center). After this first PCR we obtain the gene of interest able to “stick” together in the right order. Indeed, each gene has a sticky end with one upstream and another with the downstream.
For the second step we put all genes involved in the construction together and adding just 2 oligos (one with préfix+beginning of the promotor (5’-3’) second with suffix+end of the terminator (3’-5’)) for replicate by PCR all the construction.

Results

As explained above we started our PCR assembly. The first gel below shows the PCR products (first step) obtained for luxI, luxR, parD, parE and the double terminator. The second gel shows the PCR product for aiiA.

PCR amplification of the individual parts.
1. SMART ladder ; 2. Lux pR Promoter ; 3. Lux pR Promotor negative control; 4. LuxI ; 5. LuxI negative control ; 6. LuxR ; 7. LuxR negative control ; 8. ParD ; 9. ParD negative control ; 10. Double terminator ; 11. Double terminator negative control ; 12. iiai ; 13. iiai negative control ; 14. ParE ; 15. ParE negative control ; 16. SMART ; 17. SMART ; 18. Double terminator ; 19. Double terminator negative control.

A gel purification was then performed in order to extract the DNA fragment before the second step of PCR assembly.

We were able to obtain PCR amplification
Despite numerous attempts, it was impossible to amplify the promoter by PCR (HSL-LuxR activated (BBa_R0062)). We don't know why it failed, although we tried several annealing temperature and primer concentrations. Because of this problem we couldn't put together the genes of the first construction. As such, it was impossible to proceed with transformation and measurements.
In contrast, for the second construction we succeeded in the assembly of all the genes (see gel below).

However, due to its inherent toxicity, the second construction cannot be transformed in bacteria, the first construction is a prerequisite of the second construction's implementation.

Annex

Primer sequences

Antidote plasmid

‐ Prefix + promoter :

CCCCGAATTCGCGGCCGCTTCTAGAGACCTGTAGGATCGTACAGG

‐ Promoter+RBS+LuxI :

GTTTGTTATAGTCGAATAAAAAAGAGGAGAAAATGACTATAATGATAAAAAAATCGCGATTTTTTTATCATTATAGTCATTTTCTCCTCTTTTTTATTCGACTATAACAAAC

‐ LuxI + RBS + LuxR :

CGCTTTAGTAGCTTAATAAAAAGAGGAGAAAATGAAAAACATAAATGCCGCGGCATTTATGTTTTTCATTTTCTCCTCTTTTTATTAAGCTACTAAAGCG

‐ LuxR + RBS + ParD :

CATACTTTAAAAATTAATAAAAAGAGGAGAAAATGAGCCGCCTGACAATCGCGATTGTCAGGCGGCTCATTTTCTCCTCTTTTTATTAATTTTTAAAGTATG

‐ ParD + double terminator :

CAGCGGGGATCGCGCTTGACCAGGCATCAAATAAAACGCGTTTTATTTGATGCCTGGTCAAGCGCGATCCCCGCTG

‐ Double terminator + suffix :

CCCCCTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGCCC

Poison plasmid

‐ Prefix + promoter +RBS + aiiA :

CCCCGAATTCGCGGCCGCTTCTAGAGTTGACACCTGTAGGATCGTACAGGTATAATAAAGAGGAGAAAATGACAGTAAAGAAGCTTTATTTCG

- aiiA + RBS + ParE:

CGCTTTAGTAGCTTAATAAAAAGAGGAGAAATTGACGGCCTACATCCTCACGTGAGGATGTAGGCCGTCAATTTCTCCTCTTTTTATTAAGCTACTAAAGCG

‐ParE+doubleterminator :

CCGACAGGCTCAAGGGCTGACCAGGCATCAAATAAAACGCGTTTTATTTGATGCCTGGTCAGCCCTTGAGCCTGTCGG

- Doubleterminator+suffix :

CCCCCTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGCCC

Homologous recombination

Modeling

@@ Line 1: / Line 1: @@
 {{ULB_Header_2}}
-<html><body><br><br>
+<html><body><div align="center"><table border="0">
+  <tr>
+    <td><img src="https://static.igem.org/mediawiki/2010/3/33/ULBFleche_gauche.gif"></td>
+    <td><a href="https://2010.igem.org/Team:ULB-Brussels/Homologous">Homologous recombination</a></td>
+    <td>&nbsp;&nbsp;&nbsp;</td>
+    <td><a href="https://2010.igem.org/Team:ULB-Brussels/Modeling">Modeling</a></td>
+    <td><img src="https://static.igem.org/mediawiki/2010/a/a8/ULBFleche_droite.gif"></td>
+  </tr>
+</table></div>
 <div align="center">