Team:SDU-Denmark/primers
From 2010.igem.org
(Difference between revisions)
(New page: == '''Primers''' == On this page we list all the primers we designed and used during the summer. Numbers in paranthesis is basic temperature (celcius) ''Primers for FlhDC master operon'...) |
|||
(21 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
- | == | + | {{:Team:SDU-Denmark/css2}} |
+ | {{:Team:SDU-Denmark/navi2}} | ||
+ | <div id="subnavi"> | ||
+ | <div id="parts"> | ||
- | + | = Our Parts = | |
+ | <groupparts>iGEM010 SDU-Denmark</groupparts> | ||
- | + | <br> | |
- | + | ||
+ | == '''Primers''' == | ||
+ | <p style="text-align: justify;"> | ||
+ | <br> | ||
+ | On this page we list all the primers we designed and used during the summer. All primers were kindly provided by [http://www.dna-technology.dk/ DNA Technology]. <br><br> | ||
- | + | In the following, coding sequences are colored <span | |
- | + | style="color: rgb(88, 115, 248);">blue</span>, restriction sites are colored <span | |
- | + | style="color: rgb(80, 204, 56);">green</span> and nucleotides that are both are shown in <span | |
+ | style="color: rgb(255, 153, 0);">orange</span>.<br> | ||
+ | The mutation sites in the FlhDC mutation primers are shown in <span | ||
+ | style="color: rgb(205, 51, 204);">purple</span>. | ||
+ | <br><br> | ||
+ | <html> | ||
+ | <head> | ||
+ | </head> | ||
+ | <body> | ||
+ | <table style="text-align: left; width: 630px; height: 508px;" | ||
+ | border="1" cellpadding="2" cellspacing="2"> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Primer | ||
+ | name</td> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 638px;">Sequence</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">Tm | ||
+ | (C)</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC | ||
+ | fw</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span | ||
+ | style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span | ||
+ | style="color: rgb(80, 204, 56);">TCTAG</span><span | ||
+ | style="color: rgb(88, 115, 248);"><span | ||
+ | style="color: rgb(255, 153, 0);">A</span>TGCATACCTCCGAGTTGCTGAAA</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">88.3</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC | ||
+ | rv</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span | ||
+ | style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCTACTATT<span | ||
+ | style="color: rgb(88, 115, 248);">AAACAGCCTGTACTCTCTGTTC</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">88.3</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC | ||
+ | mutation fw*</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-<span | ||
+ | style="color: rgb(88, 115, 248);">TTGGCAGCTTTGCC<span | ||
+ | style="color: rgb(204, 51, 204);">C</span>GCAGCTTATG</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC | ||
+ | mutation rv*</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-<span | ||
+ | style="color: rgb(88, 115, 248);">CATAAGCTGC<span | ||
+ | style="color: rgb(204, 51, 204);">G</span>GGCAAAGCTGCCAA</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Photosensor | ||
+ | fw</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span | ||
+ | style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span | ||
+ | style="color: rgb(80, 204, 56);">TCTAG</span><span | ||
+ | style="color: rgb(88, 115, 248);"><span | ||
+ | style="color: rgb(255, 102, 0);">A</span>TGGTGGGACTTACGACCTC</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.1</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Photosensor | ||
+ | rv</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span | ||
+ | style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCT<span | ||
+ | style="color: rgb(80, 204, 56);">ACTAGT</span>A<span | ||
+ | style="color: rgb(88, 115, 248);">TCAGAAGGTTTCCCAGTTCGCATC</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.9</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB | ||
+ | fw</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-<span | ||
+ | style="color: rgb(80, 204, 56);"><span | ||
+ | style="color: black;">GTTTCTTC</span>GAATTC</span>GCGGCCGCT<span | ||
+ | style="color: rgb(80, 204, 56);">TCTAG</span><span | ||
+ | style="color: rgb(88, 115, 248);"><span | ||
+ | style="color: rgb(255, 102, 0);">A</span>TGGCAGCCGGTGTCTTCAAGAG</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.1</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB | ||
+ | rv</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-<span | ||
+ | style="color: rgb(80, 204, 56);"><span | ||
+ | style="color: black;">GTGTCTTC</span>CTGCAG</span>CGGCCGCT<span | ||
+ | style="color: rgb(80, 204, 56);">ACTAGT</span>A<span | ||
+ | style="color: rgb(88, 115, 248);">CTAAATGGCATTGGGTGCAAACCATC</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">72.4</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB | ||
+ | 2 fw**</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-CCGCT<span | ||
+ | style="color: rgb(80, 204, 56);">TCTAG</span><span | ||
+ | style="color: rgb(88, 115, 248);"><span | ||
+ | style="color: rgb(255, 102, 0);">A</span>TGGCAGCCGGTGTCTTCAAGAG</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">68.1</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td | ||
+ | style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB | ||
+ | 2 rv**</td> | ||
+ | <td | ||
+ | style="font-family: Courier New; height: 44px; width: 638px;">5'-CGCT<span | ||
+ | style="color: rgb(80, 204, 56);">ACTAGT</span>A<span | ||
+ | style="color: rgb(88, 115, 248);">CTAAATGGCATTGGGTGCAAACCATC</span>-3'</td> | ||
+ | <td | ||
+ | style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">65.6</td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | <br> | ||
+ | </body> | ||
+ | </html> | ||
- | |||
+ | (*) Mutation primers were designed to introduce a silent mutation at position 822 in the operon to eliminate an illegal PstI site.<br> | ||
+ | (**) Due to the formation of hairpin structures of primers ninaB fw and ninaB rv, new primers were designed containing only the innermost restriction sites (XbaI and SpeI).<br><br> | ||
- | + | </p> | |
- | |||
- | |||
- | |||
- | + | </div> | |
+ | </div> |
Latest revision as of 21:47, 27 October 2010