Team:SDU-Denmark/primers

From 2010.igem.org

(Difference between revisions)
(New page: == '''Primers''' == On this page we list all the primers we designed and used during the summer. Numbers in paranthesis is basic temperature (celcius) ''Primers for FlhDC master operon'...)
 
(21 intermediate revisions not shown)
Line 1: Line 1:
-
== '''Primers''' ==
+
{{:Team:SDU-Denmark/css2}}
 +
{{:Team:SDU-Denmark/navi2}}
 +
<div id="subnavi">
 +
<div id="parts">
-
On this page we list all the primers we designed and used during the summer. Numbers in paranthesis is basic temperature (celcius)
+
= Our Parts =
 +
<groupparts>iGEM010 SDU-Denmark</groupparts>
-
''Primers for FlhDC master operon''
+
<br>
-
We needed to design 4 primers for this part. The FlhDC operon contains a PST1 restriction site, therefore we need to introduce a silent mutation, C --> T at position 822 in the operon.
+
 +
== '''Primers''' ==
 +
<p style="text-align: justify;">
 +
<br>
 +
On this page we list all the primers we designed and used during the summer. All primers were kindly provided by [http://www.dna-technology.dk/ DNA Technology]. <br><br>
-
''Reverse primer w. mutation at position 13:'' 5’-CATAAGCTGCGGTCAAAGCTGCCAA -3’ (59)
+
In the following, coding sequences are colored <span
-
 
+
style="color: rgb(88, 115, 248);">blue</span>, restriction sites are colored <span
-
''Forward primer w. mutation at position 13:'' 5’-TTGGCAGCTTTGACCGCAGCTTATG-3’        (59)
+
style="color: rgb(80, 204, 56);">green</span> and nucleotides that are both are shown in <span
 +
style="color: rgb(255, 153, 0);">orange</span>.<br>
 +
The mutation sites in the FlhDC mutation primers are shown in <span
 +
style="color: rgb(205, 51, 204);">purple</span>.
 +
<br><br>
 +
<html>
 +
<head>
 +
</head>
 +
<body>
 +
<table style="text-align: left; width: 630px; height: 508px;"
 +
border="1" cellpadding="2" cellspacing="2">
 +
  <tbody>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Primer
 +
name</td>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 638px;">Sequence</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">Tm
 +
(C)</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC
 +
fw</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span
 +
style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">TCTAG</span><span
 +
style="color: rgb(88, 115, 248);"><span
 +
style="color: rgb(255, 153, 0);">A</span>TGCATACCTCCGAGTTGCTGAAA</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">88.3</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC
 +
rv</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span
 +
style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCTACTATT<span
 +
style="color: rgb(88, 115, 248);">AAACAGCCTGTACTCTCTGTTC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">88.3</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC
 +
mutation fw*</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-<span
 +
style="color: rgb(88, 115, 248);">TTGGCAGCTTTGCC<span
 +
style="color: rgb(204, 51, 204);">C</span>GCAGCTTATG</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">FlhDC
 +
mutation rv*</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-<span
 +
style="color: rgb(88, 115, 248);">CATAAGCTGC<span
 +
style="color: rgb(204, 51, 204);">G</span>GGCAAAGCTGCCAA</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Photosensor
 +
fw</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span
 +
style="color: rgb(80, 204, 56);">GAATTC</span>GCGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">TCTAG</span><span
 +
style="color: rgb(88, 115, 248);"><span
 +
style="color: rgb(255, 102, 0);">A</span>TGGTGGGACTTACGACCTC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.1</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">Photosensor
 +
rv</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-GTTTCTTC<span
 +
style="color: rgb(80, 204, 56);">CTGCAG</span>CGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">ACTAGT</span>A<span
 +
style="color: rgb(88, 115, 248);">TCAGAAGGTTTCCCAGTTCGCATC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.9</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB
 +
fw</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-<span
 +
style="color: rgb(80, 204, 56);"><span
 +
style="color: black;">GTTTCTTC</span>GAATTC</span>GCGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">TCTAG</span><span
 +
style="color: rgb(88, 115, 248);"><span
 +
style="color: rgb(255, 102, 0);">A</span>TGGCAGCCGGTGTCTTCAAGAG</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">73.1</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB
 +
rv</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-<span
 +
style="color: rgb(80, 204, 56);"><span
 +
style="color: black;">GTGTCTTC</span>CTGCAG</span>CGGCCGCT<span
 +
style="color: rgb(80, 204, 56);">ACTAGT</span>A<span
 +
style="color: rgb(88, 115, 248);">CTAAATGGCATTGGGTGCAAACCATC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">72.4</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB
 +
2 fw**</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-CCGCT<span
 +
style="color: rgb(80, 204, 56);">TCTAG</span><span
 +
style="color: rgb(88, 115, 248);"><span
 +
style="color: rgb(255, 102, 0);">A</span>TGGCAGCCGGTGTCTTCAAGAG</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">68.1</td>
 +
    </tr>
 +
    <tr>
 +
      <td
 +
style="font-family: Helvetica,Arial,sans-serif; height: 44px; width: 60px;">NinaB
 +
2 rv**</td>
 +
      <td
 +
style="font-family: Courier New; height: 44px; width: 638px;">5'-CGCT<span
 +
style="color: rgb(80, 204, 56);">ACTAGT</span>A<span
 +
style="color: rgb(88, 115, 248);">CTAAATGGCATTGGGTGCAAACCATC</span>-3'</td>
 +
      <td
 +
style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">65.6</td>
 +
    </tr>
 +
  </tbody>
 +
</table>
 +
<br>
 +
</body>
 +
</html>
-
Lastly we added primers with prefix and suffix to the PCR result of the above:
 
 +
(*) Mutation primers were designed to introduce a silent mutation at position 822 in the operon to eliminate an illegal PstI site.<br>
 +
(**) Due to the formation of hairpin structures of primers ninaB fw and ninaB rv, new primers were designed containing only the innermost restriction sites (XbaI and SpeI).<br><br>
-
'''FlhDC forward:'''
+
</p>
-
''Prefixprimer:'' 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCATACCTCCGAGTTGCT-3' (Coding sequence: 52) (Primer total: 72)
 
-
 
-
'''FlhDC reverse:'''
 
-
''Suffixprimer:'' 5'-GTTTCTTCCTGCAGCGGCCGCTACTAGTAAACAGCCTGTACTCTCT-3' (Coding sequence: 45) (Primer total: 72)
+
</div>
 +
</div>

Latest revision as of 21:47, 27 October 2010

Retrieved from "http://2010.igem.org/Team:SDU-Denmark/primers"