Team:SDU-Denmark/primers

From 2010.igem.org

(Difference between revisions)
m (Primers)
(Primers)
Line 9: Line 9:
<br>
<br>
On this page we list all the primers we designed and used during the summer. All primers were kindly provided by [http://www.dna-technology.dk/ DNA Technology]. <br><br>
On this page we list all the primers we designed and used during the summer. All primers were kindly provided by [http://www.dna-technology.dk/ DNA Technology]. <br><br>
 +
 +
In the following, coding sequences are colored <span
 +
style="color: rgb(88, 115, 248);">blue</span>, restriction sites are colored <span
 +
style="color: rgb(80, 204, 56);">green</span> and nucleotides that are both are shown in <span
 +
style="color: rgb(255, 153, 0);">orange</span>.<br>
 +
The mutation sites in the FlhDC mutation primers are shown in <span
 +
style="color: rgb(205, 51, 204);">purple</span>.
 +
<br><br>
<html>
<html>
Line 57: Line 65:
       <td
       <td
  style="font-family: Courier New; height: 44px; width: 648px;">5'-<span
  style="font-family: Courier New; height: 44px; width: 648px;">5'-<span
-
  style="color: rgb(88, 115, 248);">TTGGCAGCTTTGCCCGCAGCTTATG</span>-3'</td>
+
  style="color: rgb(88, 115, 248);">TTGGCAGCTTTGCC<span
 +
style="color: rgb(204, 51, 204);">C</span>GCAGCTTATG</span>-3'</td>
       <td
       <td
  style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td>
  style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td>
Line 67: Line 76:
       <td
       <td
  style="font-family: Courier New; height: 44px; width: 648px;">5'-<span
  style="font-family: Courier New; height: 44px; width: 648px;">5'-<span
-
  style="color: rgb(88, 115, 248);">CATAAGCTGCGGGCAAAGCTGCCAA</span>-3'</td>
+
  style="color: rgb(88, 115, 248);">CATAAGCTGC<span
 +
style="color: rgb(204, 51, 204);">G</span>GGCAAAGCTGCCAA</span>-3'</td>
       <td
       <td
  style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td>
  style="width: 51px; font-family: Helvetica,Arial,sans-serif; height: 44px;">61.0</td>

Revision as of 13:58, 21 October 2010