Team:Kyoto/Parts
From 2010.igem.org
Parts
Original
List
<groupparts>iGEM010 Kyoto</groupparts>
BBa_K358000: Lac promoter with GFP
The lac promoter will be repressed and not induce GFP in the presence of lacI. We measured the strength of fluorescence with low copy plasmid vector, pSB4K5.
BBa_K358001: Measurement Standard
Constitutive promoter BBa_J23101 with GFP on low plasmid pSB4K5.
BBa_K358004: lambda lysis cassette[SRRz/Rz1]
This part causes cell death. It contains Holin/Antiholin, Endolysin and Rz/Rz1 genes.
BBa_K358006: lambda lysis cassette with terminator
λ lysis cassette BBa_K358004 with double terminator BBa_B0015.
BBa_K358010: anti-killer gene with GFP
It codes SΔTMD1 as the anti-killer gene, which is derived from λ phage DNA and against the lambda lysis cassette[ BBa_K358005 ]: the killer gene.
BBa_K358012: SΔTMD1
S gene, which is derived from lambda phage DNA, contains holin and antiholin. These proteins have three transmembrane domains. This SΔTMD1, however, lacks one of those domains and works as the anti-killergene against the lysis cassette, killer gene.
BBa_K358013: SΔTMD1 with terminator
SΔTMD1 with double terminator.
BBa_K358015: pLac+anti-killer gene
The anti-killer gene with GFP BBa_K358010 is expressed under the control of lac promoter.
BBa_K358016: pLac+anti-killer gene+pConst
pLac+anti-killergene+pConst.
BBa_K358017: low promoter+anti-killer gene
Low constitutive promoter [J23105] and anti-killer gene BBa_K358010.
BBa_K358018: Low promoter+anti-killergene+lacP
Constitutive promoter BBa_J23105 + anti-killergene BBa_358010 + lactose promoter BBa_R0011.
BBa_K358019: Lysis cassette regulated by lacP
Lysis cassette[SRRz] is regulated by lactose promoter. Activating lactose promoter and expressing SRRz gene, it causes the cell lysis. So, lactose promoter must be repressed when transform this part.
To repress lactose promoter tightly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX, not TOP10. KRX has lacI in its genome and TOP10 hasn't (see genotype [1], [2]).
BBa_K358020: Lysisbox
This part consists two module. Constantly expressed killer gene BBa_K358004 by low promoter and regulatory expressed anti-killer gene with GFP by lac promoter.
BBa_K358021: Lysisbox -module2-
Anti-killergene is induced constitutively and killergene is regulated by lactose promoter.
BioBrick
Parts
Name | Description | Well*1 | Plasmid | Resistance | Insert Length | Vector Length |
---|---|---|---|---|---|---|
BBa_J23100 | Constitutive promoter family member | 1-18-C | BBa_J61002 | Ampicillin | 35 | 2948 |
BBa_J23105 | Constitutive promoter family member | 1-18-M | BBa_J61002 | Ampicillin | 35 | 2948 |
BBa_J23116 | Constitutive promoter family member | 1-20-M | BBa_J61002 | Ampicillin | 35 | 2948 |
BBa_R0011 | Promoter (lacI regulated, lambda pL hybrid) | 1-6-G | BBa_pSB1A2 | Ampicillin | 55 | 2079 |
BBa_B0015 | Double terminator (BBa_B0010-BBa_B0012) | 1-23-L | BBa_pSB1AK3 | Ampicillin, Kanamycin | 129 | 3189 |
BBa_E0840 | GFP generator | 1-12-O | BBa_pSB1A2 | Ampicillin | 878 | 2079 |
BBa_E0240 | GFP generator | 1-12-M | BBa_pSB1A2 | Ampicillin | 876 | 2079 |
BBa_I20260 | Measurement Kit Test of BBa_J23101 | 2-17-F | BBa_pSB3K3 | Kanamycin | 919 | 2750 |
BBa_J06702 | mCherry, bacterial with RBS and forward terminator | 2-8-E | BBa_pSB1A2 | Ampicillin | 869 | 2079 |
BBa_pSB3K3 | RFP Coding Device | 1-5-E | BBa_pSB3K3 | Kanamycin | 1069 | 2750 |
BBa_pSB4K5 | Low copy BioBrick standard vector | 1-5-G | BBa_pSB4K5 | Kanamycin | 1069 | 3419 |
BBa_pSB1C3 | High copy BioBrick assembly plasmid | BBa_pSB1C3 | Chloramphenicol | 2072 |
- *1 "1-18-C" means well 18C in Spring 2010 DNA Distribution Kit Plate 1.
Primers
Name | Description | Sequence |
---|---|---|
BBa_G00100 | Forward primer for sequencing/amplifying BioBrick parts (VF2) | tgccacctgacgtctaagaa |
BBa_G00101 | Reverse primer for sequencing/amplifying BioBrick parts (VR) | attaccgcctttgagtgagc |