Team:Korea U Seoul/Notebook

From 2010.igem.org

Revision as of 03:24, 28 October 2010 by Chjable (Talk | contribs)

무제 문서 Javascript DHTML Drop Down Menu Powered by dhtml-menu-builder.comJavascript DHTML Drop Down Menu Powered by dhtml-menu-builder.com

Contents

Brain storming & Work notes

Click on a date to see notes on the meeting & summary of labwork done on that day.


June
MTWTFSS
  [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/1_June_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/2_June_2010&action=edit 2] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/3_June_2010&action=edit 3] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/4_June_2010&action=edit 4] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/5_June_2010&action=edit 5] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/6_June_2010&action=edit 6]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/7_June_2010&action=edit 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_June_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/9_June_2010&action=edit 9] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/10_June_2010&action=edit 10] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/11_June_2010&action=edit 11] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_June_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/13_June_2010&action=edit 13]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/14_June_2010&action=edit 14] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/15_June_2010&action=edit 15] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/16_June_2010&action=edit 16] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/17_June_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/18_June_2010&action=edit 18] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/19_June_2010&action=edit 19] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/20_June_2010&action=edit 20]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/21_June_2010&action=edit 21] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/22_June_2010&action=edit 22] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/23_June_2010&action=edit 23] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/24_June_2010&action=edit 24] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/25_June_2010&action=edit 25] [http://2010.igem.org/Korea_U_Seoul/26_June_2010 26] [http://2010.igem.org/Korea_U_Seoul/27_June_2010 27]
[http://2010.igem.org/Korea_U_Seoul/28_June_2010 28] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/29_June_2010&action=edit 29] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/30_June_2010&action=edit 30]
July
MTWTFSS
      [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/1_July_2010&action=edit 1] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/2_July_2010&action=edit 2] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/3_July_2010&action=edit 3] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/4_July_2010&action=edit 4]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/5_July_2010&action=edit 5] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/6_July_2010&action=edit 6] [http://2010.igem.org/Korea_U_Seoul/7_July_2010 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_July_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/9_July_2010&action=edit 9] [http://2010.igem.org/Korea_U_Seoul/10_July_2010 10] [http://2010.igem.org/Korea_U_Seoul/11_July_2010 11]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_July_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/13_July_2010&action=edit 13] [http://2010.igem.org/Korea_U_Seoul/14_July_2010 14] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/15_July_2010&action=edit 15] [http://2010.igem.org/Korea_U_Seoul/16_July_2010 16] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/17_July_2010&action=edit 17] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/18_July_2010&action=edit 18]
[http://2010.igem.org/Korea_U_Seoul/19_July_2010 19] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/20_July_2010&action=edit 20] [http://2010.igem.org/Korea_U_Seoul/21_July_2010 21] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/22_July_2010&action=edit 22] [http://2010.igem.org/Korea_U_Seoul/23_July_2010 23] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/24_July_2010&action=edit 24] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/25_July_2010&action=edit 25]
[http://2010.igem.org/Korea_U_Seoul/26_July_2010 26] [http://2010.igem.org/Korea_U_Seoul/27_July_2010 27] [http://2010.igem.org/Korea_U_Seoul/28_July_2010 28] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/29_July_2010&action=edit 29] [http://2010.igem.org/Korea_U_Seoul/30_July_2010 30] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/31_July_2010&action=edit 31]
August
MTWTFSS
            [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/1_August_2010&action=edit 1]
[http://2010.igem.org/Korea_U_Seoul/2_August_2010 2] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/3_August_2010&action=edit 3] [http://2010.igem.org/Korea_U_Seoul/4_August_2010 4] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/5_August_2010&action=edit 5] [http://2010.igem.org/Korea_U_Seoul/6_August_2010 6] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/7_August_2010&action=edit 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_August_2010&action=edit 8]
[http://2010.igem.org/Korea_U_Seoul/9_August_2010 9] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/10_August_2010&action=edit 10] [http://2010.igem.org/Korea_U_Seoul/11_August_2010 11] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_August_2010&action=edit 12] [http://2010.igem.org/Korea_U_Seoul/13_August_2010 13] [http://2010.igem.org/Korea_U_Seoul/14_August_2010 14] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/15_August_2010&action=edit 15]
[http://2010.igem.org/Korea_U_Seoul/16_August_2010 16] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/17_August_2010&action=edit 17] [http://2010.igem.org/Korea_U_Seoul/18_August_2010 18] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/19_August_2010&action=edit 19] [http://2010.igem.org/Korea_U_Seoul/20_August_2010 20] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/21_August_2010&action=edit 21] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/22_August_2010&action=edit 22]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/23_August_2010&action=edit 23] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/24_August_2010&action=edit 24] [http://2010.igem.org/Korea_U_Seoul/25_August_2010 25] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/26_August_2010&action=edit 26] [http://2010.igem.org/Korea_U_Seoul/27_August_2010 27] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/28_August_2010&action=edit 28] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/29_August_2010&action=edit 29]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/30_August_2010&action=edit 30] [http://2010.igem.org/Korea_U_Seoul/31_August_2010 31]
September
MTWTFSS
    [http://2010.igem.org/Korea_U_Seoul/1_September_2010 1] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/2_September_2010&action=edit 2] [http://2010.igem.org/Korea_U_Seoul/3_September_2010 3] [http://2010.igem.org/Korea_U_Seoul/4_September_2010 4] [http://2010.igem.org/Korea_U_Seoul/5_September_2010 5]
[http://2010.igem.org/Korea_U_Seoul/6_September_2010 6] [http://2010.igem.org/Korea_U_Seoul/7_September_2010 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_September_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/9_September_2010&action=edit 9] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/10_September_2010&action=edit 10] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/11_September_2010&action=edit 11] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_September_2010&action=edit 12]
[http://2010.igem.org/Korea_U_Seoul/13_September_2010 13] [http://2010.igem.org/Korea_U_Seoul/14_September_2010 14] [http://2010.igem.org/Korea_U_Seoul/15_September_2010 15] [http://2010.igem.org/Korea_U_Seoul/16_September_2010 16] [http://2010.igem.org/Korea_U_Seoul/17_September_2010 17] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/18_September_2010&action=edit 18] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/19_September_2010&action=edit 19]
[http://2010.igem.org/Korea_U_Seoul/20_September_2010 20] [http://2010.igem.org/Korea_U_Seoul/21_September_2010 21] [http://2010.igem.org/Korea_U_Seoul/22_September_2010 22] [http://2010.igem.org/Korea_U_Seoul/23_September_2010 23] [http://2010.igem.org/Korea_U_Seoul/24_September_2010 24] [http://2010.igem.org/Korea_U_Seoul/25_September_2010 25] [http://2010.igem.org/Korea_U_Seoul/26_September_2010 26]
[http://2010.igem.org/Korea_U_Seoul/27_September_2010 27] [http://2010.igem.org/Korea_U_Seoul/28_September_2010 28] [http://2010.igem.org/Korea_U_Seoul/29_September_2010 29] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/30_September_2010&action=edit 30]
October
MTWTFSS
        [http://2010.igem.org/Korea_U_Seoul/1_October_2010 1] [http://2010.igem.org/Korea_U_Seoul/2_October_2010 2] [http://2010.igem.org/Korea_U_Seoul/3_October_2010 3]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/4_October_2010&action=edit 4] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/5_October_2010&action=edit 5] [http://2010.igem.org/Korea_U_Seoul/6_October_2010 6] [http://2010.igem.org/Korea_U_Seoul/7_October_2010 7] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/8_October_2010&action=edit 8] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/9_October_2010&action=edit 9] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/10_October_2010&action=edit 10]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/11_October_2010&action=edit 11] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/12_October_2010&action=edit 12] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/13_October_2010&action=edit 13] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/14_October_2010&action=edit 14] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/15_October_2010&action=edit 15] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/16_October_2010&action=edit 16] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/17_October_2010&action=edit 17]
[http://2010.igem.org/Korea_U_Seoul/18_October_2010 18] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/19_October_2010&action=edit 19] [http://2010.igem.org/Korea_U_Seoul/20_October_2010 20] [http://2010.igem.org/Korea_U_Seoul/21_October_2010 21] [http://2010.igem.org/Korea_U_Seoul/22_October_2010 22] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/23_October_2010&action=edit 23] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/24_October_2010&action=edit 24]
[http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/25_October_2010&action=edit 25] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/26_October_2010&action=edit 26] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/27_October_2010&action=edit 27] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/28_October_2010&action=edit 28] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/29_October_2010&action=edit 29] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/30_October_2010&action=edit 30] [http://2010.igem.org/wiki/index.php?title=Korea_U_Seoul/31_October_2010&action=edit 31]


Experimental notes

[Discussion] 2010-08-02 ~ 2010-08-29


1. Strategy and overview of iGEM 2010 experiment Kuprojectmain.png

2. Design of primers

Primer Sequence ( 5’ → 3’ )
PyodA(EcoRI)_F CCGGAATTCCTTCATATTGCCGACAAAGTACG
mAAA(SpeI)_R GGACTAGTTTATCACAGGGGCCGTCCG
PzntA(XbaI)_F GCTCTAGACGTCCGCTCGCTGTATCTC
RFP(PstI)_R AACTGCAGCGGCCGCTACTAGTTTATTAAGCACCGGTGGAGTGA
ParsR(XbaI)_F GCTCTAGACCAACTCAAAATTCACACCTATTAC
GFP(PstI)_R AACTGCAGTTAAGGCCTTTTGTATAGTTCATCC
figure1. lane1;M-lane2;E. coli K12 genomic DNA extraction













































[ Preparation of competent cells ] 2010-09-01 ~ 2010-09-03


1. Inoculation of E. coli DH5α and E. coli BL21(DE3) to 3mL LB broth

2. Preparation of 200mL 2x LB broth, TSS solution and LB plates with ampicillin(100μg/mL) and chloramphenicol(25μg /mL), respectively

3. Inoculation of subcultured E. coli to 200mL 2x LB borth

4. Preparation of competent cells by CSBL laboratory protocol

5. Transformation of pUC19 plasmid(10ng/μL) to competent cells for transformation efficiency check



[ Transformation efficiency ] 2010-09-04


Strain Number of colonies (colonies/μg DNA)
E. coli DH5α Number of colonies (colonies/μg DNA)
E. coli BL21(DE3) 1.5 x 105



[ Amplification of BioBrick parts : pSB1A2 and pSB1C3 ] 2010-09-05


1. Confirmed location : pSB1A2-BBa_E0040 (2010 Kit plate 1/ 14K) and pSB1C3-BBa_J04450 (2010 Kit plate 1/ 3A)

2. 20uL suspension by autoclaved distilled water

3. 3uL transformation to E. coli DH5α

4. Plating to LB(Amp100), LB(Cm25)

[ Genomic DNA extraction ] 2010-09-06


1. Inoculation for plasmid DNA purification

2. E. coli K12 genomic DNA extraction by AccuPrep® Genomic DNA Extraction Kit

3. Confirmation of genomic DNA by agarose gel electrophoresis (Figure 1)

4. Quantification of DNA concentration by NanoDrop : 137.5ng/μL

[ Plasmid DNA extraction : pSB1A3 and pSB1C3 ] 2010-09-07


1. Plasmid miniprep by LaboPass™ Plasmid Mini (Plasmid DNA purification kit)

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 2)

3. Quantification of DNA concentration by NanoDrop

figure2.lane1;M-lane2;pSB1A2-lane3;pSB1C3


































[ PCR : promoters and reporter genes ] 2010-09-13 ~ 2010-09-16


1. PCR : PyodA-mAAA, PzntA-RFP(BBa_E1010) and ParsR-GFP(BBa_E0040)

Reagent Volume (μL)
2.5mM dNTP 3
10x buffer 5
Plasmid template (20ng/μL) 2
Primers (10pmole/μL) 4
α-Taq DNA polymerase (5U/μL) 0.5
D.W. 35.5/total=50
95˚C(2’)-[95˚C(20”)-55˚C(20”)-72˚C(2’)]30-72˚C(5’)-4˚C


2. Confirmation of PCR products by agarose gel electrophoresis (Figure 3)

3. Purified PCR products

4. Quantification of DNA concentration by NanoDrop


figure3.lane1;M-lane2;(PyodA-mAAA)-lane3;(Pznt-RFP)-lane4;(ParsR-GFP)








































[ Digestion] 2010-09-17

1. Digestion of PCR products and pSB1A2

1) PyodA-mAAA : EcoRI and SpeI
2) PzntA-RFP : XbaI and PstI
3) pSB1A3 : EcoRI and PstI


Reagent Volume (μL)
DNA (about 30ng/μL) 30
10x NEB buffer 2 5
BSA (10mg/mL) 0.5
Appropriate 1st and 2nd restriction enzymes 2 (each 1)
D.W. 12.5 / total = 50
Completely digestion at 37˚C for 2 hours (at least)

and stop at 80˚C for 20min


2. Confirmation of digested products by agarose gel electrophoresis (Figure 4)

3. Quantification of DNA concentration by NanoDrop



figure4.M pSB1A2(EcoRI/PstI) PyodA-mAAA(EcoRI/SpeI) PzntA-RFP(XbaI/PstI)








































[Chuseok, Korean thanksgiving day] 2010-09-20 ~ 2010-09



[ Ligation & Transformation ] 2010-09-27


1. Ligation of each parts : PyodA-mAAA, PzntA-RFP and pSB1A2

Reagent Volume (μL)
10x T4 DNA ligase reaction buffer 2
T4 DNA ligase 2
Each of the digests 2 + 2 + 2 = 8
D.W. 8 / total = 20
Incubation at room temperature for 30min

and stop at 80˚C for 20min


2. Transformation to E. coli DH5α

[ Confirmation of 1st cloning ] 2010-09-28


1. Check : the color of colonies (pSB1A2 : green, recombinant plasmid : white)

2. Inoculation of white colonies to 3mL LB(Amp100)

[ Plasmid DNA extraction : pSB1A2-( PyodA-mAAA-PzntA-RFP) ] 2010-09-29


1. Plasmid DNA purification by LaboPass™ Plasmid Mini

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 5)

3. Recombinant plasmid sequencing by COSMO GeneTech

lane1;M-lane2; (pSB1A2)-[PyodA-mAA-Pznt-RFP] #1,2,3















































[ Digestion ] 2010-10-01 ~ 2010-10-03


1. Check : recombinant plasmid sequence 2. Selection of correct clones 3. Digestion of PCR products(ParsR-GFP) and pSB1C3

1) PyodA-mAAA-PzntA-RFP : EcoRI and SpeI
2) ParsR-GFP : EcoRI and SpeI
3) pSB1C3 : EcoRI and PstI


Reagent Volume (μL)
DNA (about 30ng/μL) 30
10x NEB buffer 2 5
BSA (10mg/mL) 0.5
Appropriate 1st and 2nd restriction enzymes 2 (each 1)
D.W. 12.5 / total = 50
Completely digestion at 37˚C for 2 hours (at least)

and stop at 80˚C for 20min


4. Confirmation of digested products by agarose gel electrophoresis (Figure 6)

5. Quantification of DNA concentration by NanoDrop

6. Ligation of each parts : PyodA-mAAA-PzntA-RFP, ParsR-GFP and pSB1C3


Reagent Volume (μL)
10x T4 DNA ligase reaction buffer 2
T4 DNA ligase 2
Each of the digests 2 + 2 + 2 = 8
D.W. 8 / total = 20
Incubation at room temperature for 30min

and stop at 80˚C for 20min


7. Transformation to E. coli DH5α

[ Confirmation of 2nd cloning ] 2010-10-06


1. Check : the color of colonies (pSB1C3 : red, recombinant plasmid : white)

2. Inoculation of white colonies to 3mL LB(Amp100)

[ Plasmid DNA extraction : pSB1C3-( PyodA-mAAA-PzntA-RFP-ParsR-GFP) ] 2010-10-07


1. Plasmid DNA purification by LaboPass™ Plasmid Mini

2. Confirmation of extracted plasmids by agarose gel electrophoresis (Figure 7)

3. Recombinant plasmid full-sequencing by COSMO GeneTech

[ Completion : Heavy-metal detector ] 2010-10-18


1. Check : recombinant plasmid sequence

2. Selection of correct clones

3. Transformation to E. coli BL21(DE3) for expression test



Retrieved from "http://2010.igem.org/Team:Korea_U_Seoul/Notebook"