Data
pDRAW32
pDRAW32 is a program which draws plasmid or linear gene, and it scans restriction enzyme site of its own DB.
You can see RFLP pattern.
You can download it at http://www.acaclone.com/
Protein information for virus-inspired Drug delivery system.
HNMT
Entrez ID : 3176
- related mRNA or protein sequence
NM_001024074.2 → NP_001019245.1
- histamine N-methyltransferase isoform 2
NM_001024075.1 → NP_001019246.1
- histamine N-methyltransferase isoform 3
NM_006895.2 → NP_008826.1
- histamine N-methyltransferase isoform 1
(3 kinds of isoform is obtained by alternative splicing)
Human Coronaviral Spike protein.
- NL63 strain
Nucleotide sequence is in
- http://www.ncbi.nlm.nih.gov/nuccore/49169782/?from=20472&to=24542&report=fasta (Gene ID : 2943499)
protein sequence is in
- http://www.ncbi.nlm.nih.gov/protein/45655909?report=genpept
SARS starin
nucleotide sequence is in
- http://www.ncbi.nlm.nih.gov/nuccore/30271926/?from=21492&to=25259&report=fasta (Gene ID : 1489668)
protein sequence is in
- http://www.ncbi.nlm.nih.gov/protein/29836496?report=genpept
SARS-CoV Spike Protein
It seems very hard to get SARS-CoV spike protein cDNA in our country.
Since there was no patient of SARS, few researchers used it.
We can get the cDNA by 200 dollars from this overseas website.
- http://www.bcgsc.ca/project/sars/SARS/clones
It is not easy to bring cDNA in here, so we should keep finding a better way.
Sequence we used
1. Cytokine Receptor
- 1.1 ER Receptor | making
- 1.2 HER2 Receptor | making
2. JAK JAK.fasta
3. STAT STAT.fasta
4. GFP GFP.fasta
ER, HER2 Receptor signal peptide sequence is P07110[1-24]. If we reverse-translate MKDRIPFAVNNITCVILLSLFCNA we can obtain outer membrane usher protein papC, Escherichia coli signal peptide
- ATGAAGGACAGCATTCCATTCGCAGTAAACAACATCACGTGTGTCATACTGCTGTCCTTCTTCTGCAATGCG
Anti-estrogen kappa/gamma chain
M.musculus mRNA for anti-estrogen receptor IG JS34/32 kappa chain V region
- http://www.ncbi.nlm.nih.gov/nuccore/51693
M.musculus mRNA for anti-estrogen receptor IG JS34/32 gamma chain V region
- http://www.ncbi.nlm.nih.gov/nuccore/51690
Anti-estrogen Receptor
Mouse Anti-Estrogen Receptor alpha Monoclonal Antibody, Unconjugated, Clone 33
- http://www.bioreagents.com/products/printProductDetail/printProductDetails.cfm?catnbr=MA1-310
Mouse Anti-Estrogen Receptor beta Monoclonal Antibody, Unconjugated, Clone 14C8
- http://www.antibodies-online.com/antibody/137574/anti-estrogen+receptor+beta/
Mouse Anti-Estrogen Receptor alpha Monoclonal Antibody, Unconjugated, Clone 6F11
- http://www.genwaybio.com/product_info.php?products_id=70970
Anti-estrogen Receptor
abcam makes this antigen, clone 1F3 Synthesize
- http://www.biocompare.com/ProductDetails/304675/Mouse-Anti-Estrogen-Receptor-alpha-Monoclonal-Antibody-Unconjugated-Clone-1F3.html
The other antibody
- http://www.biocompare.com/ProductListings/3194/Antibodies-Search.html?s=estrogen+receptor
NCBI information
- http://www.ncbi.nlm.nih.gov/nuccore/AF003711.1
pDRAW32
Electrophoretic mobility shift assay (EMSA).
The acute-phase response element (APRE; 5'-GCGCCTTCTGGGAAGATCCTTACGGGAATTCAG-3') double-stranded oligonucleotide probe for STAT3 binding was end-labelled using polynucleotide kinase and -32-ATP. The STAT3 EMSA was performed on equal amounts of whole total cell extracts from COS-1 cells prepared as described elsewhere. Binding reactions (20 l) contained 2 104 cpm of APRE probe in 10 mM Hepes at pH 7.8, 50 mM KCl, 1 mM EDTA, 5 mM MgCl2, 10% glycerol, 25 mM DTT and 2 g poly dI-dC. Competitive inhibition experiments were performed using a 20-fold molar excess of unlabeled oligonucleotides: WT (indicated above) and mutant (5'-GCGCCTTCTGGGCCTATCCTTACGGGCCGTCAG-3'). Supershift assay was performed by addition of antibodies to the Flag epitope. Binding reaction mixture was incubated at room temperature for 30 min. STAT3–APRE complexes were resolved on 5% non-denaturing polyacrylamide gels, and radiolabelled bands were visualized by autoradiography.
- http://www.nature.com/ncb/journal/v6/n6/full/ncb1138.html
|