Team:KAIST-Korea/Notebook/Memo/Data

From 2010.igem.org

(Difference between revisions)
(Data)
(Data)
Line 102: Line 102:
<span style=font-size:15px> <b> pDRAW32 </b> </span><br>
<span style=font-size:15px> <b> pDRAW32 </b> </span><br>
&nbsp;&nbsp;<b>Electrophoretic mobility shift assay (EMSA).</b><br>
&nbsp;&nbsp;<b>Electrophoretic mobility shift assay (EMSA).</b><br>
-
The acute-phase response element (APRE; 5'-GCGCCTTCTGGGAAGATCCTTACGGGAATTCAG-3') double-stranded oligonucleotide probe for STAT3 binding was end-labelled using polynucleotide kinase and -32-ATP. The STAT3 EMSA was performed on equal amounts of whole total cell extracts from COS-1 cells prepared as described elsewhere. Binding reactions (20 l) contained 2  104 cpm of APRE probe in 10 mM Hepes at pH 7.8, 50 mM KCl, 1 mM EDTA, 5 mM MgCl2, 10% glycerol, 25 mM DTT and 2 g poly dI-dC. Competitive inhibition experiments were performed using a 20-fold molar excess of unlabeled oligonucleotides: WT (indicated above) and mutant (5'-GCGCCTTCTGGGCCTATCCTTACGGGCCGTCAG-3'). Supershift assay was performed by addition of antibodies to the Flag epitope. Binding reaction mixture was incubated at room temperature for 30 min. STAT3–APRE complexes were resolved on 5% non-denaturing polyacrylamide gels, and radiolabelled bands were visualized by autoradiography.<br>
+
The acute-phase response element (APRE; 5'-GCGCCTTCTGGGAAGATCCTTACGGGAATTCAG-3') double-stranded<br> oligonucleotide probe for STAT3 binding was end-labelled using polynucleotide kinase and -32-ATP. <br>The STAT3 EMSA was performed on equal amounts of whole total cell extracts from COS-1 cells prepared as described elsewhere.<br> Binding reactions (20 l) contained 2  104 cpm of APRE probe in 10 mM Hepes at pH 7.8, 50 mM KCl, 1 mM EDTA,<br>5 mM MgCl2, 10% glycerol, 25 mM DTT and 2 g poly dI-dC.<br> Competitive inhibition experiments were performed using a 20-fold molar excess of unlabeled oligonucleotides:<br> WT (indicated above) and mutant (5'-GCGCCTTCTGGGCCTATCCTTACGGGCCGTCAG-3'). Supershift assay was performed by addition of antibodies to the Flag epitope.<br> Binding reaction mixture was incubated at room temperature for 30 min. STAT3–APRE complexes were resolved on 5% non-denaturing polyacrylamide gels, and radiolabelled bands were visualized by autoradiography.<br>
:http://www.nature.com/ncb/journal/v6/n6/full/ncb1138.html <br><br>
:http://www.nature.com/ncb/journal/v6/n6/full/ncb1138.html <br><br>
</td>
</td>

Revision as of 06:27, 4 August 2010

 

Data


pDRAW32
pDRAW32 is a program which draws plasmid or linear gene, and it scans restriction enzyme site of its own DB.
You can see RFLP pattern.
You can download it at http://www.acaclone.com/

Protein information for virus-inspired Drug delivery system.


HNMT Entrez ID : 3176

related mRNA or protein sequence

NM_001024074.2 → NP_001019245.1

histamine N-methyltransferase isoform 2

NM_001024075.1 → NP_001019246.1

histamine N-methyltransferase isoform 3

NM_006895.2 → NP_008826.1

histamine N-methyltransferase isoform 1

(3 kinds of isoform is obtained by alternative splicing)

Human Coronaviral Spike protein.

NL63 strain

Nucleotide sequence is in

http://www.ncbi.nlm.nih.gov/nuccore/49169782/?from=20472&to=24542&report=fasta (Gene ID : 2943499)

protein sequence is in

http://www.ncbi.nlm.nih.gov/protein/45655909?report=genpept

SARS starin nucleotide sequence is in

http://www.ncbi.nlm.nih.gov/nuccore/30271926/?from=21492&to=25259&report=fasta (Gene ID : 1489668)

protein sequence is in

http://www.ncbi.nlm.nih.gov/protein/29836496?report=genpept



SARS-CoV Spike Protein
It seems very hard to get SARS-CoV spike protein cDNA in our country.
Since there was no patient of SARS, few researchers used it.
We can get the cDNA by 200 dollars from this overseas website.

http://www.bcgsc.ca/project/sars/SARS/clones

It is not easy to bring cDNA in here, so we should keep finding a better way.

Sequence we used
1. Cytokine Receptor

1.1 ER Receptor | making
1.2 HER2 Receptor | making

2. JAK JAK.fasta 3. STAT STAT.fasta 4. GFP GFP.fasta

ER, HER2 Receptor signal peptide sequence is P07110[1-24].
If we reverse-translate MKDRIPFAVNNITCVILLSLFCNA we can obtain outer membrane usher protein papC, Escherichia coli signal peptide

ATGAAGGACAGCATTCCATTCGCAGTAAACAACATCACGTGTGTCATACTGCTGTCCTTCTTCTGCAATGCG

Anti-estrogen kappa/gamma chain

M.musculus mRNA for anti-estrogen receptor IG JS34/32 kappa chain V region

http://www.ncbi.nlm.nih.gov/nuccore/51693

M.musculus mRNA for anti-estrogen receptor IG JS34/32 gamma chain V region

http://www.ncbi.nlm.nih.gov/nuccore/51690



Anti-estrogen Receptor

Mouse Anti-Estrogen Receptor alpha Monoclonal Antibody, Unconjugated, Clone 33

http://www.bioreagents.com/products/printProductDetail/printProductDetails.cfm?catnbr=MA1-310

Mouse Anti-Estrogen Receptor beta Monoclonal Antibody, Unconjugated, Clone 14C8

http://www.antibodies-online.com/antibody/137574/anti-estrogen+receptor+beta/

Mouse Anti-Estrogen Receptor alpha Monoclonal Antibody, Unconjugated, Clone 6F11

http://www.genwaybio.com/product_info.php?products_id=70970



Anti-estrogen Receptor
abcam makes this antigen, clone 1F3 Synthesize

http://www.biocompare.com/ProductDetails/304675/Mouse-Anti-Estrogen-Receptor-alpha-Monoclonal-Antibody-Unconjugated-Clone-1F3.html

The other antibody

http://www.biocompare.com/ProductListings/3194/Antibodies-Search.html?s=estrogen+receptor

NCBI information

http://www.ncbi.nlm.nih.gov/nuccore/AF003711.1

pDRAW32
  Electrophoretic mobility shift assay (EMSA).
The acute-phase response element (APRE; 5'-GCGCCTTCTGGGAAGATCCTTACGGGAATTCAG-3') double-stranded
oligonucleotide probe for STAT3 binding was end-labelled using polynucleotide kinase and -32-ATP.
The STAT3 EMSA was performed on equal amounts of whole total cell extracts from COS-1 cells prepared as described elsewhere.
Binding reactions (20 l) contained 2 104 cpm of APRE probe in 10 mM Hepes at pH 7.8, 50 mM KCl, 1 mM EDTA,
5 mM MgCl2, 10% glycerol, 25 mM DTT and 2 g poly dI-dC.
Competitive inhibition experiments were performed using a 20-fold molar excess of unlabeled oligonucleotides:
WT (indicated above) and mutant (5'-GCGCCTTCTGGGCCTATCCTTACGGGCCGTCAG-3'). Supershift assay was performed by addition of antibodies to the Flag epitope.
Binding reaction mixture was incubated at room temperature for 30 min. STAT3–APRE complexes were resolved on 5% non-denaturing polyacrylamide gels, and radiolabelled bands were visualized by autoradiography.

http://www.nature.com/ncb/journal/v6/n6/full/ncb1138.html