Team:KAIST-Korea/Notebook/Memo/Data
From 2010.igem.org
Line 5: | Line 5: | ||
<tr> | <tr> | ||
- | <td valign="top | + | <td valign="top"> |
<table width="100%"> | <table width="100%"> | ||
Line 71: | Line 71: | ||
4. GFP GFP.fasta | 4. GFP GFP.fasta | ||
- | ER, HER2 Receptor signal peptide sequence is P07110[1-24]. If we reverse-translate MKDRIPFAVNNITCVILLSLFCNA we can obtain outer membrane usher protein papC, Escherichia coli signal peptide<br> | + | ER, HER2 Receptor signal peptide sequence is P07110[1-24]. <br>If we reverse-translate MKDRIPFAVNNITCVILLSLFCNA we can obtain outer membrane usher protein papC,<br> Escherichia coli signal peptide<br> |
:ATGAAGGACAGCATTCCATTCGCAGTAAACAACATCACGTGTGTCATACTGCTGTCCTTCTTCTGCAATGCG<br><br> | :ATGAAGGACAGCATTCCATTCGCAGTAAACAACATCACGTGTGTCATACTGCTGTCCTTCTTCTGCAATGCG<br><br> | ||
- | + | ||
- | + | ||
</td> | </td> |
Revision as of 05:58, 21 July 2010
Data
NM_001024074.2 → NP_001019245.1
NM_001024075.1 → NP_001019246.1
NM_006895.2 → NP_008826.1
(3 kinds of isoform is obtained by alternative splicing) Human Coronaviral Spike protein.
Nucleotide sequence is in
protein sequence is in
SARS starin nucleotide sequence is in
protein sequence is in
It is not easy to bring cDNA in here, so we should keep finding a better way. Sequence we used
2. JAK JAK.fasta 3. STAT STAT.fasta 4. GFP GFP.fasta ER, HER2 Receptor signal peptide sequence is P07110[1-24].
|