Team:KAIST-Korea/Notebook/Memo/Data

From 2010.igem.org

(Difference between revisions)
(Data)
(Data)
Line 63: Line 63:
It is not easy to bring cDNA in here, so we should keep finding a better way.<br><br>
It is not easy to bring cDNA in here, so we should keep finding a better way.<br><br>
-
<span style=font-size:15px> <b> Sequence we used </b> </span>
+
<span style=font-size:15px> <b> Sequence we used </b> </span><br>
1. Cytokine Receptor  
1. Cytokine Receptor  
:1.1 ER Receptor | making
:1.1 ER Receptor | making

Revision as of 05:49, 21 July 2010

 

Data


pDRAW32
pDRAW32 is a program which draws plasmid or linear gene, and it scans restriction enzyme site of its own DB.
You can see RFLP pattern.
You can download it at http://www.acaclone.com/

Protein information for virus-inspired Drug delivery system.


HNMT Entrez ID : 3176

related mRNA or protein sequence

NM_001024074.2 → NP_001019245.1

histamine N-methyltransferase isoform 2

NM_001024075.1 → NP_001019246.1

histamine N-methyltransferase isoform 3

NM_006895.2 → NP_008826.1

histamine N-methyltransferase isoform 1

(3 kinds of isoform is obtained by alternative splicing)

Human Coronaviral Spike protein.

NL63 strain

Nucleotide sequence is in

http://www.ncbi.nlm.nih.gov/nuccore/49169782/?from=20472&to=24542&report=fasta (Gene ID : 2943499)

protein sequence is in

http://www.ncbi.nlm.nih.gov/protein/45655909?report=genpept

SARS starin nucleotide sequence is in

http://www.ncbi.nlm.nih.gov/nuccore/30271926/?from=21492&to=25259&report=fasta (Gene ID : 1489668)

protein sequence is in

http://www.ncbi.nlm.nih.gov/protein/29836496?report=genpept



SARS-CoV Spike Protein
It seems very hard to get SARS-CoV spike protein cDNA in our country.
Since there was no patient of SARS, few researchers used it.
We can get the cDNA by 200 dollars from this overseas website.

http://www.bcgsc.ca/project/sars/SARS/clones

It is not easy to bring cDNA in here, so we should keep finding a better way.

Sequence we used
1. Cytokine Receptor

1.1 ER Receptor | making
1.2 HER2 Receptor | making

2. JAK JAK.fasta 3. STAT STAT.fasta 4. GFP GFP.fasta

ER, HER2 Receptor signal peptide sequence is P07110[1-24]. If we reverse-translate MKDRIPFAVNNITCVILLSLFCNA we can obtain outer membrane usher protein papC, Escherichia coli signal peptide

ATGAAGGACAGCATTCCATTCGCAGTAAACAACATCACGTGTGTCATACTGCTGTCCTTCTTCTGCAATGCG