Team:INSA-Lyon/Project/Stage3/Strategy/curli promoter

From 2010.igem.org

(Difference between revisions)
(New page: <!-- {{INSA-Lyon_style}} --> {{INSA-Lyon/stylegroningen}} {{INSA-Lyon/header}} {{INSA-Lyon/maincontent}} {{INSA-Lyon/menugauche}} {{INSA-Lyon/menudroppy3}} <html xmlns="http://www.w3.org...)
 
(21 intermediate revisions not shown)
Line 37: Line 37:
});
});
</script>
</script>
 +
<div id="corps2">
<div id="corps2">
 +
<div id="menug" style="float:right; position: relative;">
 +
<ul>
 +
<li><a href="/Team:INSA-Lyon/Project/Stage3/Strategy" class="cteal"> < back </a></li>
 +
</ul>
-
<h3>Stage 3 : Strategy</h3>
+
</div>
 +
<h3> Design of parts </h3>
<br>
<br>
-
<p> We choose to follow two differents strategies to obtain our systems of regulation. <br>
+
<br/>
-
<ol id="list_extra">
+
<p>We can find below some explanations about the design of the Curli promoter and the ompR protein :
-
<li> Thermoregulation</li><br>
+
<br>
-
</ol>
+
<br></p>
 +
</html>
 +
{{Template:INSALyon2010_Designcurli}}
 +
 
 +
<html>
 +
<br><br><br>
 +
<h3><font color="purple">design of Curli promoter</font></h3><br><br>
 +
 
 +
 
 +
<ul style="margin-left:-65px;">
 +
<li>
 +
<p>One microbiology team of our university works actively on the characterization and regulation of the curli promoter.
 +
Thanks to their works, we had the complete sequence of the intergenic region between csgD and csgB. The curli promoter is localized in this region, and is regulated by the csgD protein.
</p>
</p>
-
<p>For this system of regulation, we decided to synthesized directly the sequence of the <a href="https://2010.igem.org/wiki/index.php?title=Team:INSA-Lyon/Project/Stage3/Strategy/curli_promoter">curli promoter</a> with the igem restriction sites. In the same time a part with the gene ompR234 is created by PCR, from the genome of the chassi PHL818.
+
<p>We wanted to only synthesize the promoter with the site of regulation by csgD. After analyzing the sequence, we decided to begin our promoter 20bp before the csgD box, and to finish it on the +1bp of transcription. It corresponds to 71 bp.
-
Then we ligate an igem reporter gene with the curli promoter and we wanted to make a double transformation with ompR234 to see if our parts work as we hoped.  
+
We added a non-CDS (non coding sequence) prefix and suffix to our sequence, to fit with iGEM standards.
-
The final plasmid construction of the thermometer RNA will contain a constitutive promoter(BBa_J23119), the thermometer RNA, the PPI-protein fused and a terminator.
+
 
</p>
</p>
 +
<br>
 +
<p>The final length of the biobrick is 129 pb synthesized by Mr gene.
 +
</p>
<br>
<br>
<p>
<p>
-
<ol id="list_extra">
+
<small> <small> <font color="#FF0000">GTTTCTTCGAATTCGCGGCCGCTTCTAGA</font <font color="#000000">GGAACTAAAAAAGAAAAATACAACGCGCGGGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCG</font <font color="blue">TACTAGTAGCGGCCGCTGCAGGAAGAA</font> </small></small>
-
<li> Control under Arabinose</li><br>
+
-
</ol>
+
-
 
+
</p>
</p>
 +
<br>
 +
<br>
 +
<p>The red sequence is the non-CDS prefix, the black one is the curli promoter and the blue one the non-CDS suffix.</p>
 +
<br>
 +
</li>
 +
</div>
 +
 +
<div id="corps4" style="border:0px;">
<div id="corps4" style="border:0px;">
Line 81: Line 107:
</div>
</div>
-
</div>
+
 
</html>
</html>

Latest revision as of 18:41, 27 October 2010




Design of parts



We can find below some explanations about the design of the Curli promoter and the ompR protein :

  1. Design Curli
  2. Design OmpR 234




    design of Curli promoter



    • One microbiology team of our university works actively on the characterization and regulation of the curli promoter. Thanks to their works, we had the complete sequence of the intergenic region between csgD and csgB. The curli promoter is localized in this region, and is regulated by the csgD protein.

      We wanted to only synthesize the promoter with the site of regulation by csgD. After analyzing the sequence, we decided to begin our promoter 20bp before the csgD box, and to finish it on the +1bp of transcription. It corresponds to 71 bp. We added a non-CDS (non coding sequence) prefix and suffix to our sequence, to fit with iGEM standards.


      The final length of the biobrick is 129 pb synthesized by Mr gene.


      GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGAACTAAAAAAGAAAAATACAACGCGCGGGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCGTACTAGTAGCGGCCGCTGCAGGAAGAA



      The red sequence is the non-CDS prefix, the black one is the curli promoter and the blue one the non-CDS suffix.


Retrieved from "http://2010.igem.org/Team:INSA-Lyon/Project/Stage3/Strategy/curli_promoter"