

Revision as of 10:46, 23 October 2010 by Kleinsorg (Talk | contribs)




Primer Table

ID Name Sequence (5' to 3') amplified origin for backbone
001 Casp8FWEcoR1 ttttgaattcatggacttcagcagaaatc Caspase8 death gene Caspase8
002 CMV_AgeI_fw ttttaccggtagaatctgcttagggttagg CMV, shRNA pcDNA5/FRT-shRNA pTR-UF3
003 CMVshRNApA_BglII_rv taatagatctcagaagccatagagcccacc CMV, shRNA pcDNA5/FRT-shRNA pTR-UF3
004 EGFPRVFse1 ttttggccggcccttgtacagctcgtccatg EGFP GFP
005 ElenasFirstSyntheticRNA_F aatatgtctaaactattatttatgccaaccagccaatctagctactgctaggc part 2 Elenas first synthetic shRNA miRsAg pC-DNA5
006 ElenasFirstSyntheticRNA_R aataatagtttagacatatttatgccagccagccagaccagctctgctaagg part 3 Elenas first synthetic shRNA miRsAg pC-DNA5
007 ElenasSecondSyntheticRNA_F gacatgtctaaactattgtcttcggtagcgtcgtagactagctactgctaggc part 2 Elenas second synthetic shRNA miRsAg pC-DNA5
008 ElenasSecondSyntheticRNA_R gacaatagtttagacatgtcttcggtatcgtcgtatcccagctctgctaagg part 3 Elenas second synthetic shRNA miRsAg pC-DNA5
009 ElenasThirdSyntheticRNA_F tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc part 2 Elenas third synthetic shRNA miRsAg pC-DNA5
010 ElenasThirdSyntheticRNA_R tattatagtttagacaaataattcgcgtctggccttcccagctctgctaagg part 3 Elenas third synthetic shRNA miRsAg pC-DNA5
011 ElenasFifthSyntheticRNA_F tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc part 2 Elenas fifth synthetic shRNA miRsAg pC-DNA5
012 ElenasFifthSyntheticRNA_R atctatagtttagacaagatgaaacgccgagttaacgccagctctgctaagg part 3 Elenas fifth synthetic shRNA miRsAg pC-DNA5
013 ElenasSixthSyntheticRNA_F ttattgtctaaactatataactgccgtaactccaaatctagctactgctaggc part 2 Elenas sixth synthetic shRNA miRsAg pC-DNA5
014 ElenasSixthSyntheticRNA_R ttatatagtttagacaataactgccgtcactccaacgccagctctgctaagg part 3 Elenas sixth synthetic shRNA miRsAg pC-DNA5
015 ElenasSeventhSyntheticRNA_F atcttgtctaaactatagataactgccatcactccccctagctactgctaggc part 2 Elenas seventh synthetic shRNA miRsAg pC-DNA5
016 ElenasSeventhSyntheticRNA_R atctatagtttagacaagataactgccgtcactccaaccagctctgctaagg part 3 Elenas seventh synthetic shRNA miRsAg pC-DNA5
017 ElenasEighthSyntheticRNA_F tacatgtctaaactattgtagtcggttcatgcagcccctagctactgctaggc part 2 Elenas eighth synthetic shRNA miRsAg pC-DNA5
018 ElenasEighthSyntheticRNA_R tacaatagtttagacatgtagtcggtttatgcagcaaccagctctgctaagg part 3 Elenas eighth synthetic shRNA miRsAg pC-DNA5
019 ElenasNinethSyntheticRNA_F aaattgtctaaactatatttgatccagagatacagaactagctactgctaggc part 2 Elenas nineth synthetic shRNA miRsAg pC-DNA5
020 ElenasNinethSyntheticRNA_R aaatatagtttagacaatttgatccagcgatacagcgccagctctgctaagg part 3 Elenas nineth synthetic shRNA miRsAg pC-DNA5
021 ElenasTenthSyntheticRNA_F attatgtctaaactattaatatcggtgaccgtggtacctagctactgctaggc part 2 Elenas tenth synthetic shRNA miRsAg pC-DNA5
022 ElenasTenthSyntheticRNA_R attaatagtttagacataatatcggtggccgtggtgtccagctctgctaagg part 3 Elenas tenth synthetic shRNA miRsAg pC-DNA5
023 FADDFWEcoR1 ttttgaattcatgggcggtaggcgtgtacg FADD
024 gE1A-Fse1_rev tttttccggccggttatggcctggggcctttaca E1A rescue gene
025 Hcrfor_HindIII_AgeI_TL gagtcaagcttaccggttggaggtgaagttaacaccttcgtg part 1 shRNA against everything; cutting site: HindIII, AgeI miRsAg pC-DNA5
026 Hcrrev_ApaI_SalI_TL ctcgagggcccgtcgacaagcaaacgatgccaagacatttatcg part 4 shRNA against everything; cutting site: ApaI, SalI miRsAg pC-DNA5
027 HSVluc_norm_BglII_fw tttttagatcttgcaggagcttcagggagtg HSV-TK, Firefly Luciferase psiCHECK2 pTR-UF3
028 HSVluc_norm_BglII_rv ttttagatctggttccgcgcacatttccc HSV-TK, Firefly Luciferase psiCHECK2 pTR-UF3
029 Kif11_PLK1_shRNA-hcrfor:ecoRI gagtcgaattctggaggtgaagttaacaccttcgtg part 1 shRNA against everything; cutting site: ecoRI miRsAg pTR-UF3
030 Kif11&PLK1_shRNA_hcrrev:XbaI ctcgaagatctaagcaaacgatgccaagacatttatcg part 4 shRNA against everything; cutting site: XbaI miRsAg pTR-UF3
031 Kif11_shRNA_forward actctgtctaaactatgagtacattaaacaattcctattagctactgctaggc part 2 shRNA against Kif11 miRsAg pTR-UF3
032 Kif11_shRNA_reverse actcatagtttagacagagtacattaatcaattccattcagctctgctaagg part3 shRNA against Kif11 miRsAg pTR-UF3
033 PLK1_shRNA_forward atgatgtctaaactattcattaagcagatcgttaaccgtagctactgctaggc part2 shRNA against PLK1 miRsAg pTR-UF3
034 PLK1_shRNA_reverse atgaatagtttagacatcattaagcagctcgttaatggcagctctgctaagg part3 shRNA against PLK1 miRsAg pTR-UF3
035 pTR-UF3_Nsp1_for ctattacgccagctggatgcatcccagctgc for pTR-UF3 backbone Pst1->Nsi1 mutation
036 pTR-UF3_Nsp1_rev gcagctgggatgcatccagctggcgtaatag for pTR-UF3 backbone Pst1->Nsi1 mutation
037 pTR-UF3_PstI-NsiI_for gctattacgccagctggatgcatcccagctgcattaatgaatcgg mutagenesis of PstI to NsiI pTR-UF3 pTR-UF3
038 pTR-UF3_PstI-NsiI_rev ccgattcattaatgcagctgggatgcatccagctggcgtaatagc mutagenesis of PstI to NsiI pTR-UF3 pTR-UF3
039 pTR-UF3_PstI-NsiI_shifted_rev cattaatgcagctgggatgcatccagctggcgtaatagcgaagag mutagenesis of PstI to NsiI pTR-UF3 pTR-UF3
040 pTRUF3_seq_fwrv caactccatcactaggggttcct sequencing purpose pTR-UF3 pTR-UF3
041 SCLpsv40_FW ctcaattagtcagcaaccatagtccc FWprimer for testing stable integration of shRNA into T-Rex T-REx cells
042 SCLpsv40_FW gcaaagtgccgataaacataacgatct RVprimer for testing stable integration of shRNA into T-Rex T-REx cells
043 Sequencing primer_pTR-UF3 mutated ctaaatcggaaccctaaagggagcccccg sequencing of mutagenesis of PstI to NsiI pTR-UF3 pTR-UF3
044 Sv40lucmcs_AgeI_fw ttttaccggtgtggaatgtgtgtcagttag SV40, Renilla Luciferase, MCS psiCHECK2 pTR-UF3
045 Sv40lucmcs_BglII_rv tattagatctccgcgtcagacaaaccctaac SV40, Renilla Luciferase, MCS psiCHECK2 pTR-UF3
046 tBidGFPRVFse1 tttttggccggccttacatgtacagctcg tBid death gene pcherryBidGFP
047 tBidFWEcoR1 tttttgaattcaaccgcagcagccactc tBid death gene pcherryBidGFP
048 tBidRVFse1 tttttccggccgggtccatcccatttctg tBid death gene pcherryBidGFP
049 TetO2FW ggggacaacttttctatacaaagttgtccctatcagtgatagagatctc TetO8 synthesized tetO8 Gateway entry vector

Standart Kit Cloning Primers

ID Name Sequence (5' to 3') amplified origin for backbone
D001 backbone_AvrII_fw ttttcctaggtagcggcgcattaagcgcgg - - -
D002 backbone_AvrII_rev ttttcctaggcttgttgtagcttaaattttg - - -
D003 backbone_ClaI_fw ttttatcgattagcggcgcattaagcgcgg - - -
D004 backbone_XhoI_rev ttttctcgagcttgttgtagcttaaattttg - - -
D005 BBB_Oligo_XhoI ccggActgcagcggccgcgcgctagcacactagtgcggccgcgaattCa - - -
D006 BBB_Oligo_XmaI tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt - - -
D007 BBB_Oligo_XmaI tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt - - -
D008 BBB_suffix_reverse aaaactgcagcggccgcgc - - -
D009 BGH_pA_BamHI_rc_fw ttttgaattcgcggccgcactagtggatccccatagagcccaccgcatccc - - -
D010 BGH_pA_fw ttttgaattcgcggccgcactagttttaaacccgctgatcagcc - - -
D011 BGH_pA_rev ttttctgcagcggccgcgctagcccatagagcccaccgcatccc - - -
D012 BGH_pA_rc_rev ttttctgcagcggccgcgctagctttaaacccgctgatcagcc - - -
D013 biCMV_BBB_fw ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg - - -
D014 biCMV_BBB_fw ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg - - -
D015 biCMV_BBB_rev ttttctgcagcggccgcgcgctagcacagcggatctgacggttcac - - -
D016 biCMV_rc_BBB_fw ttttgaattcgcggccgcactagtagcggatctgacggttcac - - -
D017 biCMV_rc_BBB_rev ttttctgcagcggccgcgctagcgcgatctgacggttcac - - -
D018 CMV_BBB_BamHI_fw gaattcgcggccgcactagtggatcccgatgtacgggccagatatacg - - -
D019 CMV_BBB_fw ttttgaattcgcggccgcactagtcgatgtacgggccagatatacg - - -
D020 CMV_BBB_rev ttttctgcagcggccgcgcgctagcacatttcgataagccagtaagc - - -
D021 CMV_Teto2_BBB_fw tttt gaattcgcggccgcactagtgttgacattgattattgtctag - - -
D022 CMV_TetO2_BBB_rev tttt ctgcagcggccgcgcgctagcaccggaggctggatcggtc - - -
D023 CMV_rc_BBB_fw ttttgaattcgcggccgcactagtatttcgataagccagtaagc - - -
D024 CMV_rc_BBB_rev ttttctgcagcggccgcgctagccgatgtacgggccagatatacg - - -
D025 FRT_rev ctgcagcggccgcgctagcccaaggaagttcctatactttc - - -
D026 FRT_rev gaattcgcggccgcactagtttctcgccacgttcgccggc - - -
D027 hRluc_ter_BBB_fw ttttgaattcgcggccgcactagtatggcttccaaggtgtacgac - - -
D028 hRluc_ter_BBB_rev ttttctgcagcggccgcgctagcttactgctcgttcttcagcacgc - - -
D029 hsa-mir-122_BBB(perf) ttttgaattcgcggccgcactagtcaaacaccattgtcacactccagctagcgcggccgctgcagtttt - - -
D030 hsa-mir-122_BBB(rand9-12) ttttgaattcgcggccgcactagtcaaacaccatnnnnacactccagctagcgcggccgctgcagtttt - - -
D031 hsa-mir-122_BBB(rand9-22) ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnacactccagctagcgcggccgctgcagtttt - - -
D032 hsa-mir-122_Sgf_Not(perf) ttttgcgatcgccaaacaccattgtcacactccagcggccgctatgtcacaact - - -
D033 hsa-mir-122_Sgf_Not(rand9-12) ttttgcgatcgccaaacaccatnnnnacactccagcggccgctatgtcacaact - - -
D034 hsa-mir-122_Sgf_Not(rand9-22) ttttgcgatcgcnnnnnnnnnnnnnnacactccagcggccgctatgtcacaact - - -
D035 hsa-mir-375_BBB(perf) ttttgaattcgcggccgcactagttcacgcgagccgaacgaacaaagctagcgcggccgctgcagtttt - - -
D036 hsa-mir-375_BBB(rand9-12) ttttgaattcgcggccgcactagttcacgcgagcnnnncgaacaaagctagcgcggccgctgcagtttt - - -
D037 hsa-mir-375_BBB(rand9-22) ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgaacaaagctagcgcggccgctgcagtttt - - -
D038 hsa-mir-375_Sgf_Not(perf) ttttgcgatcgctcacgcgagccgaacgaacaaagcggccgctatgtcacaact - - -
D039 hsa-mir-375_Sgf_Not(rand9-12) ttttgcgatcgctcacgcgagcnnnncgaacaaagcggccgctatgtcacaact - - -
D040 hsa-mir-375_Sgf_Not(rand9-22) ttttgcgatcgcnnnnnnnnnnnnnncgaacaaagcggccgctatgtcacaact - - -
D041 hsa-mir-376a_BBB(perf) ttttgaattcgcggccgcactagtacgtggattttcctctatgatgctagcgcggccgctgcagtttt - - -
D042 hsa-mir-376a_BBB(rand9-12) ttttgaattcgcggccgcactagtacgtggattnnnntctatgatgctagcgcggccgctgcagtttt - - -
D043 hsa-mir-376a_BBB(rand9-22) ttttgaattcgcggccgcactagtnnnnnnnnnnnnntctatgatgctagcgcggccgctgcagtttt - - -
D044 hsa-mir-376a_Sgf_Not(perf) ttttgcgatcgcacgtggattttcctctatgatgcggccgctatgtcacaact - - -
D045 hsa-mir-376a_Sgf_Not(rand9-12) ttttgcgatcgcacgtggattnnnntctatgatgcggccgctatgtcacaact - - -
D046 hsa-mir-376a_Sgf_Not(rand9-22) ttttgcgatcgcnnnnnnnnnnnnntctatgatgcggccgctatgtcacaact - - -
D047 igem20100723_01 tgccacctgacgtctaagaa - - -
D048 igem20100723_02 attaccgcctttgagtgagc - - -
D049 Luc2_ter_BamHI_BBB_rev ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac - - -
D050 Luc2_ter_BamHI_BBB_rev ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac - - -
D051 Luc2_ter_BBB_fw ttttgaattcgcggccgcactagtgccaccatggaagatgcc - - -
D052 mir122_miMeasure_screen_fev ccgcgctagctggagtgt - - -
D053 Oligo_Xba_mut_fw ctagcctcgagttctgaccgccccgggg - - -
D054 Oligo_Xba_mut_rev ctagccccggggcggtcagaactcgagg - - -
D055 pSMB_miMeasure_Screen_fw gcacaagctggagtacaactac - - -
D056 pSMB_miMeasure_Screen_rev ggtttcccgactggaaagcg - - -
D057 RSV_fw ttttgaattcgcggccgcactagtcaattctcatgtttgacagc - - -
D058 RSV_rev ttttctgcagcggccgcgctagccagcttggaggtgcacacc - - -
D059 RSV_rc_fw ttttgaattcgcggccgcactagtcagcttggaggtgcacacc - - -
D060 RSV_rc_rev ttttctgcagcggccgcgctagccaattctcatgtttgacagc - - -
D061 RSV_fw_midcomp cgaaccactgaataccgcattgcag - - -
D062 RSV_rev_midcomp ctgcaatgcggtattcagtggttcg - - -
D063 SB-prep-3P gccgctgcagtccggcaaaaaaacg - - -
D064 SB-prep-2Ea atgaattccagaaatcatccttagcg - - -
D065 second_strand_notI agttgtgacatagcggccgc - - -
D066 shRNA-6th-bs(custom)_BBB ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgtcaatagctagcgcggccgctgcagtttt - - -
D067 shRNA-7th-bs(custom)_BBB ttttgaattcgcggccgcactagtnnnnnnnnnnnnnntcaatagagctagcgcggccgctgcagtttt - - -
D068 shRNA-8th-bs(custom)_BBB ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctgatgtgctagcgcggccgctgcagtttt - - -
D069 shRNA-9th-bs(custom)_BBB ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnctagtttagctagcgcggccgctgcagtttt - - -
D070 shRNA-10th-bs(custom)_BBB ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctataatgctagcgcggccgctgcagtttt - - -
D071 shRNA-6th-bs(perf)_BBB ttttgaattcgcggccgcactagtcgcaacctcactgccgtcaatagctagcgcggccgctgcagtttt - - -
D072 shRNA-7th-bs(perf)_BBB ttttgaattcgcggccgcactagtcaacctcactgccgtcaatagagctagcgcggccgctgcagtttt - - -
D073 shRNA-8th-bs(perf)_BBB ttttgaattcgcggccgcactagtcaacgacgtatttggctgatgtgctagcgcggccgctgcagtttt - - -
D074 shRNA-9th-bs(perf)_BBB ttttgaattcgcggccgcactagtcgcgacatagcgacctagtttagctagcgcggccgctgcagtttt - - -
D075 shRNA-10th-bs(perf)_BBB ttttgaattcgcggccgcactagtctgtggtgccggtggctataatgctagcgcggccgctgcagtttt - - -
D076 shRNA-6th-bs(rand9-12)_BBB gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact - - -
D077 shRNA-7th-bs(rand9-12)_BBB ttttgaattcgcggccgcactagtcaacctcactnnnntcaatagagctagcgcggccgctgcagtttt - - -
D078 shRNA-8th-bs(rand9-12)_BBB ttttgaattcgcggccgcactagtcaacgacgtannnngctgatgtgctagcgcggccgctgcagtttt - - -
D079 shRNA-9th-bs(rand9-12)_BBB ttttgaattcgcggccgcactagtcgcgacatagnnnnctagtttagctagcgcggccgctgcagtttt - - -
D080 shRNA-10th-bs(rand9-12)_BBB ttttgaattcgcggccgcactagtctgtggtgccnnnngctataatgctagcgcggccgctgcagtttt - - -
D081 shRNA-6th-bs(custom)_SgfI_NotI gcgatcgcnnnnnnnnnnnnnncgtcaatagcggccgctatgtcacaact - - -
D082 shRNA-7th-bs(custom)_SgfI_NotI gcgatcgcnnnnnnnnnnnnnntcaatagagcggccgctatgtcacaact - - -
D083 shRNA-8th-bs(custom)_SgfI_NotI gcgatcgcnnnnnnnnnnnnnngctgatgtgcggccgctatgtcacaact - - -
D084 shRNA-9th-bs(custom)_SgfI_NotI gcgatcgcnnnnnnnnnnnnnnctagtttagcggccgctatgtcacaact - - -
D085 shRNA-10th-bs(custom)_SgfI_NotI gcgatcgcnnnnnnnnnnnnnngctataatgcggccgctatgtcacaact - - -
D086 shRNA-6th-bs(perf)_SgfI_NotI gcgatcgccgcaacctcactgccgtcaatagcggccgctatgtcacaact - - -
D087 shRNA-7th-bs(perf)_SgfI_NotI gcgatcgccaacctcactgccgtcaatagagcggccgctatgtcacaact - - -
D088 shRNA-8th-bs(perf)_SgfI_NotI gcgatcgccaacgacgtatttggctgatgtgcggccgctatgtcacaact - - -
D089 shRNA-9th-bs(perf)_SgfI_NotI gcgatcgccgcgacatagcgacctagtttagcggccgctatgtcacaact - - -
D090 shRNA-10th-bs(perf)_SgfI_NotI gcgatcgcctgtggtgccggtggctataatgcggccgctatgtcacaact - - -
D091 shRNA-6th-bs(rand9-12)_SgfI_NotI gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact - - -
D092 shRNA-7th-bs(rand9-12)_SgfI_NotI gcgatcgccaacctcactnnnntcaatagagcggccgctatgtcacaact - - -
D093 shRNA-8th-bs(rand9-12)_SgfI_NotI gcgatcgccaacgacgtannnngctgatgtgcggccgctatgtcacaact - - -
D094 shRNA-9th-bs(rand9-12)_SgfI_NotI gcgatcgccgcgacatagnnnnctagtttagcggccgctatgtcacaact - - -
D095 shRNA-10th-bs(rand9-12)_SgfI_NotI gcgatcgcctgtggtgccnnnngctataatgcggccgctatgtcacaact - - -
D096 shRNA_AflII_BBB_fw ttttctgcagcggccgcgcgctagccttaagtggaggtgaagttaacaccttcgtg - - -
D097 shRNA_HindIII_BBB_rev ttttgaattcgcggccgcactagtaagcttaagcaaacgatgccaagacatttatcg - - -
D098 SV40_BamHI_BBB_fw ctgcagcggccgcgctagcggatccaagctttttgcaaaagcctagg - - -
D099 SV40_BBB_rev ttttctgcagcggccgcgctagcaagctttttgcaaaagcctaggc - - -
D100 SV40_rc_BBB_fw ttttgaattcgcggccgcactagtaagctttttgcaaaagcc - - -
D101 SV40_rc_BBB_rev ttttctgcagcggccgcgctagcgcgcagcaccatggcctg - - -
D102 SV40_term_fw ttttgaattcgcggccgcactagtcagacatgataagatacattg - - -
D103 SV40_Xho_Xma_BBB_fw gaattcgcggccgcactagtctcgagtttctcccggggcgcagcaccatggcctg - - -
D104 TetRepressor (from pcDNA6)fw ttttgaattcgcggccgcactagtgccaccatgtctagattagataaaag - - -
D105 TetRepressor (from pcDNA6)rew ttttctgcagcggccgcgctagcttaataagatctaaattcccgcgatccgc - - -

ViroBytes primers

ID Name Sequence (5' to 3') amplified fragment direction cap gene of AAV
R001 Anchor12367891012 tctctctctctctctaagcttgtctgagtgactagcattcgttaattaacTACCG anchor -
R002 Anchor4 tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactactg anchor -
R003 Anchor5 tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactacag anchor -
R004 Anchor_comp_all gttaattaacgaatgctagtcactcagacaagctt anchor -
R005 F1_for_cap12678910 gctacggtctcaatggctgccgatggttatcttccag 1 forward 1,2,6,7,8,9,10
R006 F1_for_cap5 gctacggtctcaatggctgccgatggttatcttccag 1 forward 5
R007 F1_rev_cap2 gctacggtctcgctcctgaaactcggcgtcggcgtgg 1 reverse 2
R008 F1_rev_cap5 gctacggtctctctcctgaaactcggcgtccgcgtgg 1 reverse 5
R009 F1_rev_cap9 gctacggtctcgctcctggaactcggcgtcggcgtgg 1 reverse 9
R010 F1_rev_cap168 gctacggtctcgctcctgaaactcggcgtcggcgtgg 1 reverse 1,6,8
R011 F2_for_cap2 gctacggtctctggagcgccttaaagaagatacgtcttttggggg 2 forward 2
R012 F2_for_cap5 gctacggtctctggagaagctcgccgacgacacatccttcggggg 2 forward 5
R013 F2_for_cap9 gctacggtctctggagcggctcaaagaagatacgtcttttggggg 2 forward 9
R014 F2_for_cap168 gctacggtctctggagcgtctgcaagaagatacgtcttttggggg 2 forward 1,6,8
R015 F2_rev_cap2 gctacggtctcgtgtcgcccatccatgtggaatcgcaatgc 2 reverse 2
R016 F2_rev_cap5 gctacggtctcgtgtcccccatccacgtggaatcgcaatgc 2 reverse 5
R017 F2_rev_cap9 gctacggtctcgtgtcccccagccattgggaatcgcaatgc 2 reverse 9
R018 F2_rev_cap168 gctacggtctcgtgtcgcccagccatgtggaatcgcaatgc 2 reverse 1,6,8
R019 F3_for_cap5 gctacggtctccgacagagtcatcaccaccagcacccg 3 forward 5
R020 F3_for_cap9 gctacggtctccgacagagtcatcaccaccagcacccg 3 forward 9
R021 F3_for_cap1268 gctacggtctccgacagagtcatcaccaccagcacccg 3 forward 1,2,6,8
R022 F3_rev_cap1 gctacggtctcaggttattagcgatggttgtgacgccatcattcgtc 3 reverse 1
R023 F3_rev_cap2 gctacggtctcaggttattggcaatcgtcgtcgtaccgtcattctgc 3 reverse 2
R024 F3_rev_cap5 gctacggtctcaggttgttggcgatggtggtggtggagtcctgcac 3 reverse 5
R025 F3_rev_cap6 gctacggtctcaggttattagcgatggtcgtgacgccatcattcgtc 3 reverse 6
R026 F3_rev_cap8 gctacggtctcaggttattggcgatggtcttggtgccttcattctgc 3 reverse 8
R027 F3_rev_cap9 gctacggtctcaggttattggcgatggtcttgactccattgttgtcc 3 reverse 9
R028 F4_for_cap2 gctacggtctctaaccttaccagcacggttcaggtgtttactgactc 4 forward 2
R029 F4_for_cap5 gctacggtctccaacctcacctccaccgtccaagtgtttacggacga 4 forward 5
R030 F4_for_cap8 gctacggtctctaacctcaccagcaccatccaggtgtttacggactc 4 forward 8
R031 F4_for_cap9 gctacggtctctaaccttaccagcacggtccaggtcttcacggactc 4 forward 9
R032 F4_for_cap16 gctacggtctctaaccttaccagcacggttcaagtcttctcggactc 4 forward 1,6
R033 F4_reverse_cap1 gctacggtctcagctgctgtggaaaggcacttcctcaaaggtg 4 reverse 1
R034 F4_reverse_cap2 gctacggtctcagctgctgtggaaaggaacgtcctcaaaagtg 4 reverse 2
R035 F4_reverse_cap5 gctacggtctcagctggagtggaagggcacctcctcaaagttg 4 reverse 5
R036 F4_reverse_cap9 gctacggtctcagctgctatggaaaggtacgttctcaaactcg 4 reverse 9
R037 F4_reverse_cap68 gctacggtctcagctgctgtggaaaggcacgtcctcgaaggtg 4 reverse 6,8
R038 F5_for_cap2 gctacggtctcgcagctacgctcacagccagagtctggaccgtc 5 forward 2
R039 F5_for_cap5 gctacggtctcccagcttcgctcccagtcagaacctgttcaagc 5 forward 5
R040 F5_for_cap8 gctacggtctcgcagctacgcccacagccagagcttggaccggc 5 forward 8
R041 F5_for_cap9 gctacggtctcgcagctacgctcacagccaaagcctggaccgac 5 forward 9
R042 F5_for_cap16 gctacggtctcgcagctacgcgcacagccagagcctggaccggc 5 forward 1,6
R043 F5_rev_cap2 gctacggtctccagttcctagactggtcccgaatgtcactcg 5 reverse 2
R044 F5_rev_cap5 gctacggtctccagtttttgtaggtgttggcgtatctcccgg 5 reverse 5
R045 F5_rev_cap8 gctacggtctccagttctttgcctgattggccattgtattag 5 reverse 8
R046 F5_rev_cap9 gctacggtctctagtttcttccctggacagccatgttgctgg 5 reverse 9
R047 F5_rev_cap16 gctacggtctccagtttttgggctgaacagacatgccagctg 5 reverse 1,6
R048 F6_for_cap2 gctacggtctcgaactggcttcctggaccctgttaccgccagc 6 forward 2
R049 F6_for_cap5 gctacggtctcaaactggttcccggggcccatgggccgaaccc 6 forward 5
R050 F6_for_cap8 gctacggtctcgaactggctgccaggaccctgttaccgccaac 6 forward 8
R051 F6_for_cap9 gctacggtctcaaactacatacctggacccagctaccgacaac 6 forward 9
R052 F6_for_cap16 gctacggtctcaaactggctacctggaccctgttatcggcagc 6 forward 1,6
R053 F6_rev_cap1 gctacggtctcgccacagggttagtggctttaatttcctcttcgtctg 6 reverse 1
R054 F6_rev_cap2 gctacggtctcgccacgggattggttgtcctgatttcctcttcgtctg 6 reverse 2
R055 F6_rev_cap5 gctacggtctcgccacgcggttcaccggctgcgtctcgctctcgctgg 6 reverse 5
R056 F6_rev_cap6 gctacggtctcgccacggggttagtggctttgatttcctcttcgtctg 6 reverse 6
R057 F6_rev_cap8 gctacggtctcgccacagggttagtggttttgatttcttctcgctgg 6 reverse 8
R058 F6_rev_cap9 gctacggtctcgccaccgggttagtagttttaatttcttcttcgttggttatc 6 reverse 9
R059 F7_for_cap1 gctacggtctctgtggccaccgaaagatttgggaccgtggcagtcaatttc 7 forward 1
R060 F7_for_cap2 gctacggtctccgtggctacggagcagtatggttctgtatctaccaacctc 7 forward 2
R061 F7_for_cap5 gctacggtctccgtggcgtacaacgtcggcgggcagatg 7 forward 5
R062 F7_for_cap6 gctacggtctccgtggccaccgaaagatttgggactgtggcagtcaatctc 7 forward 6
R063 F7_for_cap8 gctacggtctctgtggctacagaggaatacggtatcgtggcagataacttg 7 forward 8
R064 F7_for_cap9 gctacggtctcggtagcaacggagtcctatggacaagtggccacaaaccac 7 forward 9
R065 F7_rev_cap1 gctacggtctcggtgatgaatgaagcaaactttgtagctgaaaac 7 reverse 1
R066 F7_rev_cap2 gctacggtctctgtgatgaaggaagcaaactttgccgcactgaag 7 reverse 2
R067 F7_rev_cap5 gctacggtctcggtgatgaagctgctgacgggcacgtccgagaag 7 reverse 5
R068 F7_rev_cap6 gctacggtctcggtgatgaatgaagcaaactttgtagccgaaaac 7 reverse 6
R069 F7_rev_cap8 gctacggtctccgtgatgaaagagttcagctttgactggttgaag 7 reverse 8
R070 F7_rev_cap9 gctacggtctcggtgatgaaagagttcagcttgtccttgttgaag 7 reverse 9
R071 F8_for_cap1 gctacggtctcatcacccaatactccacaggacaagtgagtgtgg 8 forward 1
R072 F8_for_cap2 gctacggtctcatcacacagtactccacgggacaggtcagcgtgg 8 forward 2
R073 F8_for_cap5 gctacggtctcatcacccagtacagcaccgggcaggtcaccgtgg 8 forward 5
R074 F8_for_cap6 gctacggtctcatcacccagtattccacaggacaagtgagcgtgg 8 forward 6
R075 F8_for_cap8 gctacggtctcatcacgcaatacagcaccggacaggtcagcgtgg 8 forward 8
R076 F8_for_cap9 gctacggtctcatcacccagtattctactggccaagtcagcgtgg 8 forward 9
R077 F8_rev_cap1 gctacggcgcgccttacaggggacgggtaaggtaacgggtgcc 8 reverse 1
R078 F8_rev_cap2 gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg 8 reverse 2
R079 F8_rev_cap5 gctacggcgcgccttaaaggggtcgggtaaggtatcgggttccgatagg 8 reverse 5
R080 F8_rev_cap6 gctacggcgcgccttacaggggacgggtgaggtaacgggtgcc 8 reverse 6
R081 F8_rev_cap8 gctacggcgcgccttacagattacgggtgaggtaacgggtgccaatggg 8 reverse 8
R082 F8_rev_cap9 gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg 8 reverse 9
R083 Virbyte_for gtctgagtgactagcattcggtctgagtgactagcattcg - forward
R084 Virobyte_rev gctacggcgcgcctta - reverse

Primer Table Quick 'n' Dirty

ID Name Sequence (5' to 3') amplified origin for backbone
L001 CMV_AgeI_fw ttttaccggtagaatctgcttagggttagg for use with L11 from pcDNA5+miRNA to tuning construct-pTR-UF3 KpnI/SalI
L002 CMVshRNApA_KpnI_rv taatggtacccagaagccatagagcccacc - from pcDNA5+miRNA to tuning construct-pTR-UF3 KpnI/SalI
L003 HSVluc_norm_BglII_fw tttttagatcttgcaggagcttcagggagtg for use with L8 from PsiCheck2 to pTR-UF3 BglII
L004 HSVluc_norm_BglII_rv ttttagatctggttccgcgcacatttccc for use with L7 from PsiCheck2 to pTR-UF3 BglII
L005 HSVluc_norm_KpnI_fw tttttggtagcaggagcttcagggagtg for use with L16 from PsiCheck2 to pTR-UF3 KpnI/SalI
L006 HSVluc_norm_SalI_rv ttttgtcgacggttccgcgcacatttccc for use with L15 from PsiCheck2 to pTR-UF3 KpnI/SalI
L007 Sv40lucmcs_AgeI_fw ttttaccggtgtggaatgtgtgtcagttag for use with L13 from PsiCheck2 to tuning construct-pTR-UF3 KpnI/SalI
L008 SV40luc_SalI_rv tattgtcgacccgcgtcagacaaaccctaac for use with L1 from PsiCheck2 to tuning construct-pTR-UF3 KpnI/SalI
L009 TetO2_StuI_NheI ttttaggccttccctatcagtgatagagatctccctatcagtgatagagagctagctaac Tet Repressor Oligo to final tuning construct
L010 TetR_BspEI_fw tttttccggaggcgaattgatatgtctagattag for use with L14 from pcDNA6/TR pTR-UF3 BspEI/NotI
L011 TetR_SgfI_NotI_rv ttttgcggccgctggcgatcgctaataagatctgaattcccgggatc for use with L12 from pcDNA6/TR to pTR-UF3 BspEI/NotI

Primer Table raPCR

ID Name Sequence (5' to 3') target Assembly Site
ra001 psicheck2_MCS_min_200_fw cagcgacgatctgcctaa sequencing fw sequencing Primer for binding-sites in pSiCheck vector
ra002 psicheck2_MCS_plu_200_rv gtggccaccaagaccaaa sequencing rv sequencing Primer for binding-sites in pSiCheck vector
ra003 raPCR_AS13-hsa-mir-122 cactgaatccaactgcaaacaccattgtcacactccagcatacatggactgc hsa-mir-122 13 bp
ra004 raPCR_AS13-has-mir122(ran9-12) cactgaatccaactgcaaacaccatnnnnacactccagcatacatggactgc has-mir122 (ran9-12) 13 bp randomised nucleotides 9-12
ra005 raPCR_AS13-hsa-mir-320b cactgaatccaactgttgccctctcaacccagcttttgcatacatggactgc hsa-mir-320b 13 bp
ra006 raPCR_AS13-has-mir-221 cactgaatccaactggaaacccagcagacaatgtagctgcatacatggactgc has-mir-221 13 bp
ra007 raPCR_AS13-has-mir-221(ran9-12 cactgaatccaactggaaacccagcannnnatgtagctgcatacatggactgc has-mir-221 (ran9-12) 13 bp randomised nucleotides 9-12
ra008 raPCR_AS13-has-mir-1179 cactgaatccaactgccaaccaatgaaagaatgcttgcatacatggactgc has-mir-1179 13 bp
ra009 raPCR_AS13-has-mir-1179ran9-12 cactgaatccaactgccaaccaatnnnngaatgcttgcatacatggactgc has-mir-1179 (ran9-12) 13 bp randomised nucleotides 9-12
ra010 raPCR_AS13-has-mir4286 cactgaatccaactgggtaccaggagtggggtgcatacatggactgc has-mir4286 13 bp
ra011 raPCR_AS13-mm-mir-375 cactgaatccaactgtcacgcgagccgaacgaacaaagcatacatggactgc mm-mir-375 13 bp
ra012 raPCR_AS13-mm-mir-375(ran9-12) cactgaatccaactgtcacgcgagcnnnncgaacaaagcatacatggactgc mm-mir-375 (ran9-12) 13 bp randomised nucleotides 9-12
ra013 raPCR_AS13-mm-mir-376a cactgaatccaactgacgtggattttcctctacgatgcatacatggactgc mm-mir-376a 13 bp
ra014 raPCR_AS13-spacer(0) cagttggattcagtggcagtccatgtatgc spacer 13 bp
ra015 raPCR_AS13-spacer(10) cagttggattcagtggctatttctcgcagtccatgtatgc spacer 13 bp
ra016 raPCR_AS13-spacer(20) cagttggattcagtgatgacaggtagctatttctcgcagtccatgtatgc spacer 13 bp
ra017 raPCR_AS13-stop_fw_BBB ttttgaattcgcggccgcactagtcactgaatccaactg stop fw 13 bp
ra018 raPCR_AS13-stop_rev_BBB ttttctgcagcggccgcgctagcgcagtccatgtatgc stop rev 13 bp
ra019 raPCR_AS13-stop_rev_NotI ttttgcggccgctggagtgtgacaatggtgtttg stop rev 13 bp
ra020 raPCR_AS13-stop_fw_XhoI ttttctcgagcactgaatccaactg stop fw 13 bp
Nur zum Testen
Nur zum Testen
Nur zum Testen