Team:Heidelberg/Parts

From 2010.igem.org

(Difference between revisions)
Line 28: Line 28:
-
alert(document.getElementById("groupparts").getElementsByTagName("tbody")[0].getElementsByTagName("tr")[0].childNodes[0].nodeName);
+
alert(document.getElementById("groupparts").getElementsByTagName("tbody")[0].getElementsByTagName("tr")[0].getElementsByTagName("td").length);
var d = document.getElementById("groupparts");
var d = document.getElementById("groupparts");
Line 38: Line 38:
for (var i=0;i<lastrowelement;i++) {
for (var i=0;i<lastrowelement;i++) {
-
if(dbodytr[0].childNodes[i] == "TD") {
+
if(dbodytr[0].childNodes[i] == 'TD') {
lasttd ++
lasttd ++
}
}
Line 68: Line 68:
<groupparts>iGEM010 Heidelberg</groupparts>  
<groupparts>iGEM010 Heidelberg</groupparts>  
-
 
-
==Primer Table==
 
-
 
-
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
 
-
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone
 
-
|-
 
-
|align="right"| 001 || Casp8FWEcoR1 || ttttgaattcatggacttcagcagaaatc || Caspase8 death gene || Caspase8 ||
 
-
|-
 
-
|align="right"| 002 || CMV_AgeI_fw || ttttaccggtagaatctgcttagggttagg || CMV, shRNA || pcDNA5/FRT-shRNA || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
 
-
|-
 
-
|align="right"| 003 || CMVshRNApA_BglII_rv || taatagatctcagaagccatagagcccacc || CMV, shRNA || pcDNA5/FRT-shRNA || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
 
-
|-
 
-
|align="right"| 004 || EGFPRVFse1 || ttttggccggcccttgtacagctcgtccatg || EGFP || GFP ||
 
-
|-
 
-
|align="right"| 005 || ElenasFirstSyntheticRNA_F || aatatgtctaaactattatttatgccaaccagccaatctagctactgctaggc || part 2 Elenas first synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 006 || ElenasFirstSyntheticRNA_R || aataatagtttagacatatttatgccagccagccagaccagctctgctaagg || part 3 Elenas first synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 007 || ElenasSecondSyntheticRNA_F || gacatgtctaaactattgtcttcggtagcgtcgtagactagctactgctaggc || part 2 Elenas second synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 008 || ElenasSecondSyntheticRNA_R || gacaatagtttagacatgtcttcggtatcgtcgtatcccagctctgctaagg || part 3 Elenas second synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 009 || ElenasThirdSyntheticRNA_F || tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc || part 2 Elenas third synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 010 || ElenasThirdSyntheticRNA_R || tattatagtttagacaaataattcgcgtctggccttcccagctctgctaagg || part 3 Elenas third synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 011 || ElenasFifthSyntheticRNA_F || tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc || part 2 Elenas fifth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 012 || ElenasFifthSyntheticRNA_R || atctatagtttagacaagatgaaacgccgagttaacgccagctctgctaagg || part 3 Elenas fifth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 013 || ElenasSixthSyntheticRNA_F || ttattgtctaaactatataactgccgtaactccaaatctagctactgctaggc || part 2 Elenas sixth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 014 || ElenasSixthSyntheticRNA_R || ttatatagtttagacaataactgccgtcactccaacgccagctctgctaagg || part 3 Elenas sixth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 015 || ElenasSeventhSyntheticRNA_F || atcttgtctaaactatagataactgccatcactccccctagctactgctaggc || part 2 Elenas seventh synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 016 || ElenasSeventhSyntheticRNA_R || atctatagtttagacaagataactgccgtcactccaaccagctctgctaagg || part 3 Elenas seventh synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 017 || ElenasEighthSyntheticRNA_F || tacatgtctaaactattgtagtcggttcatgcagcccctagctactgctaggc || part 2 Elenas eighth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 018 || ElenasEighthSyntheticRNA_R || tacaatagtttagacatgtagtcggtttatgcagcaaccagctctgctaagg || part 3 Elenas eighth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 019 || ElenasNinethSyntheticRNA_F || aaattgtctaaactatatttgatccagagatacagaactagctactgctaggc || part 2 Elenas nineth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 020 || ElenasNinethSyntheticRNA_R || aaatatagtttagacaatttgatccagcgatacagcgccagctctgctaagg || part 3 Elenas nineth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 021 || ElenasTenthSyntheticRNA_F || attatgtctaaactattaatatcggtgaccgtggtacctagctactgctaggc || part 2 Elenas tenth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 022 || ElenasTenthSyntheticRNA_R || attaatagtttagacataatatcggtggccgtggtgtccagctctgctaagg || part 3 Elenas tenth synthetic shRNA || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 023 || FADDFWEcoR1 || ttttgaattcatgggcggtaggcgtgtacg || FADD ||  || 
 
-
|-
 
-
|align="right"| 024 || gE1A-Fse1_rev || tttttccggccggttatggcctggggcctttaca || E1A rescue gene ||  || 
 
-
|-
 
-
|align="right"| 025 || Hcrfor_HindIII_AgeI_TL || gagtcaagcttaccggttggaggtgaagttaacaccttcgtg || part 1 shRNA against everything; cutting site: HindIII, AgeI || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 026 || Hcrrev_ApaI_SalI_TL || ctcgagggcccgtcgacaagcaaacgatgccaagacatttatcg || part 4 shRNA against everything; cutting site: ApaI, SalI || miRsAg || pC-DNA5
 
-
|-
 
-
|align="right"| 027 || HSVluc_norm_BglII_fw || tttttagatcttgcaggagcttcagggagtg || HSV-TK, ''Firefly'' Luciferase || psiCHECK2 || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
 
-
|-
 
-
|align="right"| 028 || HSVluc_norm_BglII_rv || ttttagatctggttccgcgcacatttccc || HSV-TK, ''Firefly'' Luciferase || psiCHECK2 || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
 
-
|-
 
-
|align="right"| 029 || Kif11_PLK1_shRNA-hcrfor:ecoRI || gagtcgaattctggaggtgaagttaacaccttcgtg || part 1 shRNA against everything; cutting site: ecoRI || miRsAg || pTR-UF3
 
-
|-
 
-
|align="right"| 030 || Kif11&PLK1_shRNA_hcrrev:XbaI || ctcgaagatctaagcaaacgatgccaagacatttatcg || part 4 shRNA against everything; cutting site: XbaI || miRsAg || pTR-UF3
 
-
|-
 
-
|align="right"| 031 || Kif11_shRNA_forward || actctgtctaaactatgagtacattaaacaattcctattagctactgctaggc || part 2 shRNA against Kif11 || miRsAg || pTR-UF3
 
-
|-
 
-
|align="right"| 032 || Kif11_shRNA_reverse || actcatagtttagacagagtacattaatcaattccattcagctctgctaagg || part3 shRNA against Kif11 || miRsAg || pTR-UF3
 
-
|-
 
-
|align="right"| 033 || PLK1_shRNA_forward || atgatgtctaaactattcattaagcagatcgttaaccgtagctactgctaggc || part2 shRNA against PLK1|| miRsAg || pTR-UF3
 
-
|-
 
-
|align="right"| 034 || PLK1_shRNA_reverse || atgaatagtttagacatcattaagcagctcgttaatggcagctctgctaagg || part3 shRNA against PLK1|| miRsAg || pTR-UF3
 
-
|-
 
-
|align="right"| 035 || pTR-UF3_Nsp1_for || ctattacgccagctggatgcatcccagctgc || for pTR-UF3 backbone Pst1->Nsi1 mutation || ||
 
-
|-
 
-
|align="right"| 036 || pTR-UF3_Nsp1_rev || gcagctgggatgcatccagctggcgtaatag || for pTR-UF3 backbone Pst1->Nsi1 mutation || ||
 
-
|-
 
-
|align="right"| 037 || pTR-UF3_PstI-NsiI_for || gctattacgccagctggatgcatcccagctgcattaatgaatcgg || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3
 
-
|-
 
-
|align="right"| 038 || pTR-UF3_PstI-NsiI_rev || ccgattcattaatgcagctgggatgcatccagctggcgtaatagc || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3
 
-
|-
 
-
|align="right"| 039 || pTR-UF3_PstI-NsiI_shifted_rev || cattaatgcagctgggatgcatccagctggcgtaatagcgaagag || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3
 
-
|-
 
-
|align="right"| 040 || pTRUF3_seq_fwrv || caactccatcactaggggttcct || sequencing purpose || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]] || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
 
-
|-
 
-
|align="right"| 041 || SCLpsv40_FW || ctcaattagtcagcaaccatagtccc || FWprimer for testing stable integration of shRNA into T-Rex ||  || T-REx cells
 
-
|-
 
-
|align="right"| 042 || SCLpsv40_FW || gcaaagtgccgataaacataacgatct || RVprimer for testing stable integration of shRNA into T-Rex ||  || T-REx cells
 
-
|-
 
-
|align="right"| 043 || Sequencing primer_pTR-UF3 mutated || ctaaatcggaaccctaaagggagcccccg || sequencing of mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3
 
-
|-
 
-
|align="right"| 044 || Sv40lucmcs_AgeI_fw || ttttaccggtgtggaatgtgtgtcagttag || SV40, ''Renilla'' Luciferase, MCS || psiCHECK2 || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
 
-
|-
 
-
|align="right"| 045 || Sv40lucmcs_BglII_rv || tattagatctccgcgtcagacaaaccctaac || SV40, ''Renilla'' Luciferase, MCS || psiCHECK2 || [[Igem2010/Main/Plasmids/pTR-UF3 AAV2 | pTR-UF3]]
 
-
|-
 
-
|align="right"| 046 || tBidGFPRVFse1 || tttttggccggccttacatgtacagctcg || tBid death gene || [[Igem2010/Main/Plasmids/pcherryBidGFP | pcherryBidGFP]]
 
-
|-
 
-
|align="right"| 047 || tBidFWEcoR1 || tttttgaattcaaccgcagcagccactc || tBid death gene || [[Igem2010/Main/Plasmids/pcherryBidGFP | pcherryBidGFP]] 
 
-
|-
 
-
|align="right"| 048 || tBidRVFse1 || tttttccggccgggtccatcccatttctg || tBid death gene || [[Igem2010/Main/Plasmids/pcherryBidGFP | pcherryBidGFP]] 
 
-
|-
 
-
|align="right"| 049 || TetO2FW || ggggacaacttttctatacaaagttgtccctatcagtgatagagatctc || TetO8 || synthesized tetO8 || Gateway entry vector
 
-
|}
 
-
 
-
 
-
 
-
==Standart Kit Cloning Primers==
 
-
 
-
 
-
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
 
-
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone
 
-
|-
 
-
|align="right"| D001 || backbone_AvrII_fw || ttttcctaggtagcggcgcattaagcgcgg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D002 || backbone_AvrII_rev || ttttcctaggcttgttgtagcttaaattttg  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D003 || backbone_ClaI_fw || ttttatcgattagcggcgcattaagcgcgg  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D004 ||  backbone_XhoI_rev || ttttctcgagcttgttgtagcttaaattttg  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D005 || BBB_Oligo_XhoI || ccggActgcagcggccgcgcgctagcacactagtgcggccgcgaattCa  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D006 || BBB_Oligo_XmaI || tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D007 || BBB_Oligo_XmaI || tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D008 || BBB_suffix_reverse || aaaactgcagcggccgcgc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D009 || BGH_pA_BamHI_rc_fw || ttttgaattcgcggccgcactagtggatccccatagagcccaccgcatccc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D010 || BGH_pA_fw || ttttgaattcgcggccgcactagttttaaacccgctgatcagcc  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D011 || BGH_pA_rev || ttttctgcagcggccgcgctagcccatagagcccaccgcatccc  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D012 || BGH_pA_rc_rev || ttttctgcagcggccgcgctagctttaaacccgctgatcagcc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D013 || biCMV_BBB_fw || ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D014 || biCMV_BBB_fw || ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D015 || biCMV_BBB_rev || ttttctgcagcggccgcgcgctagcacagcggatctgacggttcac || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D016 || biCMV_rc_BBB_fw || ttttgaattcgcggccgcactagtagcggatctgacggttcac || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D017 || biCMV_rc_BBB_rev || ttttctgcagcggccgcgctagcgcgatctgacggttcac || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D018 || CMV_BBB_BamHI_fw || gaattcgcggccgcactagtggatcccgatgtacgggccagatatacg  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D019 || CMV_BBB_fw || ttttgaattcgcggccgcactagtcgatgtacgggccagatatacg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D020 || CMV_BBB_rev || ttttctgcagcggccgcgcgctagcacatttcgataagccagtaagc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D021 || CMV_Teto2_BBB_fw || tttt gaattcgcggccgcactagtgttgacattgattattgtctag || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D022 || CMV_TetO2_BBB_rev || tttt ctgcagcggccgcgcgctagcaccggaggctggatcggtc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D023 || CMV_rc_BBB_fw || ttttgaattcgcggccgcactagtatttcgataagccagtaagc  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D024 || CMV_rc_BBB_rev || ttttctgcagcggccgcgctagccgatgtacgggccagatatacg  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D025 || FRT_rev || ctgcagcggccgcgctagcccaaggaagttcctatactttc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D026 || FRT_rev || gaattcgcggccgcactagtttctcgccacgttcgccggc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D027 || hRluc_ter_BBB_fw || ttttgaattcgcggccgcactagtatggcttccaaggtgtacgac || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D028 || hRluc_ter_BBB_rev || ttttctgcagcggccgcgctagcttactgctcgttcttcagcacgc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D029 || hsa-mir-122_BBB(perf) || ttttgaattcgcggccgcactagtcaaacaccattgtcacactccagctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D030 || hsa-mir-122_BBB(rand9-12) || ttttgaattcgcggccgcactagtcaaacaccatnnnnacactccagctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D031 || hsa-mir-122_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnacactccagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D032 || hsa-mir-122_Sgf_Not(perf) || ttttgcgatcgccaaacaccattgtcacactccagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D033 || hsa-mir-122_Sgf_Not(rand9-12) || ttttgcgatcgccaaacaccatnnnnacactccagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D034 || hsa-mir-122_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnnnacactccagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D035 || hsa-mir-375_BBB(perf) || ttttgaattcgcggccgcactagttcacgcgagccgaacgaacaaagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D036 || hsa-mir-375_BBB(rand9-12) || ttttgaattcgcggccgcactagttcacgcgagcnnnncgaacaaagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D037 || hsa-mir-375_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgaacaaagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D038 || hsa-mir-375_Sgf_Not(perf) || ttttgcgatcgctcacgcgagccgaacgaacaaagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D039 || hsa-mir-375_Sgf_Not(rand9-12) || ttttgcgatcgctcacgcgagcnnnncgaacaaagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D040 || hsa-mir-375_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnnncgaacaaagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D041 || hsa-mir-376a_BBB(perf) || ttttgaattcgcggccgcactagtacgtggattttcctctatgatgctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D042 || hsa-mir-376a_BBB(rand9-12) || ttttgaattcgcggccgcactagtacgtggattnnnntctatgatgctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D043 || hsa-mir-376a_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnntctatgatgctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D044 || hsa-mir-376a_Sgf_Not(perf) || ttttgcgatcgcacgtggattttcctctatgatgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D045 || hsa-mir-376a_Sgf_Not(rand9-12) || ttttgcgatcgcacgtggattnnnntctatgatgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D046 || hsa-mir-376a_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnntctatgatgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D047 || igem20100723_01 || tgccacctgacgtctaagaa  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D048 || igem20100723_02 || attaccgcctttgagtgagc  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D049 || Luc2_ter_BamHI_BBB_rev || ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D050 || Luc2_ter_BamHI_BBB_rev || ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D051 || Luc2_ter_BBB_fw || ttttgaattcgcggccgcactagtgccaccatggaagatgcc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D052 || mir122_miMeasure_screen_fev || ccgcgctagctggagtgt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D053 || Oligo_Xba_mut_fw || ctagcctcgagttctgaccgccccgggg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D054 || Oligo_Xba_mut_rev || ctagccccggggcggtcagaactcgagg  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D055 || pSMB_miMeasure_Screen_fw || gcacaagctggagtacaactac || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D056 || pSMB_miMeasure_Screen_rev || ggtttcccgactggaaagcg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D057 || RSV_fw || ttttgaattcgcggccgcactagtcaattctcatgtttgacagc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D058 || RSV_rev || ttttctgcagcggccgcgctagccagcttggaggtgcacacc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D059 || RSV_rc_fw || ttttgaattcgcggccgcactagtcagcttggaggtgcacacc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D060 || RSV_rc_rev || ttttctgcagcggccgcgctagccaattctcatgtttgacagc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D061 || RSV_fw_midcomp || cgaaccactgaataccgcattgcag || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D062 || RSV_rev_midcomp || ctgcaatgcggtattcagtggttcg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D063 || SB-prep-3P || gccgctgcagtccggcaaaaaaacg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D064 || SB-prep-2Ea || atgaattccagaaatcatccttagcg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D065 || second_strand_notI || agttgtgacatagcggccgc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D066 || shRNA-6th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgtcaatagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D067 || shRNA-7th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnntcaatagagctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D068 || shRNA-8th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctgatgtgctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D069 || shRNA-9th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnctagtttagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D070 || shRNA-10th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctataatgctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D071 || shRNA-6th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcgcaacctcactgccgtcaatagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D072 || shRNA-7th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcaacctcactgccgtcaatagagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D073 || shRNA-8th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcaacgacgtatttggctgatgtgctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D074 || shRNA-9th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcgcgacatagcgacctagtttagctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D075 || shRNA-10th-bs(perf)_BBB || ttttgaattcgcggccgcactagtctgtggtgccggtggctataatgctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D076 || shRNA-6th-bs(rand9-12)_BBB || gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D077 || shRNA-7th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcaacctcactnnnntcaatagagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D078 || shRNA-8th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcaacgacgtannnngctgatgtgctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D079 || shRNA-9th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcgcgacatagnnnnctagtttagctagcgcggccgctgcagtttt || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D080 || shRNA-10th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtctgtggtgccnnnngctataatgctagcgcggccgctgcagtttt  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D081 || shRNA-6th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnncgtcaatagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D082 || shRNA-7th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnntcaatagagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D083 || shRNA-8th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnngctgatgtgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D084 || shRNA-9th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnnctagtttagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D085 || shRNA-10th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnngctataatgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D086 || shRNA-6th-bs(perf)_SgfI_NotI || gcgatcgccgcaacctcactgccgtcaatagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D087 || shRNA-7th-bs(perf)_SgfI_NotI || gcgatcgccaacctcactgccgtcaatagagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D088 || shRNA-8th-bs(perf)_SgfI_NotI || gcgatcgccaacgacgtatttggctgatgtgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D089 || shRNA-9th-bs(perf)_SgfI_NotI || gcgatcgccgcgacatagcgacctagtttagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D090 || shRNA-10th-bs(perf)_SgfI_NotI || gcgatcgcctgtggtgccggtggctataatgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D091 || shRNA-6th-bs(rand9-12)_SgfI_NotI || gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D092 || shRNA-7th-bs(rand9-12)_SgfI_NotI || gcgatcgccaacctcactnnnntcaatagagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D093 || shRNA-8th-bs(rand9-12)_SgfI_NotI || gcgatcgccaacgacgtannnngctgatgtgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D094 || shRNA-9th-bs(rand9-12)_SgfI_NotI || gcgatcgccgcgacatagnnnnctagtttagcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D095 || shRNA-10th-bs(rand9-12)_SgfI_NotI || gcgatcgcctgtggtgccnnnngctataatgcggccgctatgtcacaact || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D096 || shRNA_AflII_BBB_fw || ttttctgcagcggccgcgcgctagccttaagtggaggtgaagttaacaccttcgtg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D097 || shRNA_HindIII_BBB_rev || ttttgaattcgcggccgcactagtaagcttaagcaaacgatgccaagacatttatcg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D098 || SV40_BamHI_BBB_fw || ctgcagcggccgcgctagcggatccaagctttttgcaaaagcctagg  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D099 || SV40_BBB_rev || ttttctgcagcggccgcgctagcaagctttttgcaaaagcctaggc  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D100 || SV40_rc_BBB_fw || ttttgaattcgcggccgcactagtaagctttttgcaaaagcc || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D101 || SV40_rc_BBB_rev || ttttctgcagcggccgcgctagcgcgcagcaccatggcctg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D102 || SV40_term_fw || ttttgaattcgcggccgcactagtcagacatgataagatacattg || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D103 || SV40_Xho_Xma_BBB_fw || gaattcgcggccgcactagtctcgagtttctcccggggcgcagcaccatggcctg  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D104 || TetRepressor (from pcDNA6)fw || ttttgaattcgcggccgcactagtgccaccatgtctagattagataaaag  || -|| - | - || - | -
 
-
|-
 
-
|align="right"| D105 || TetRepressor (from pcDNA6)rew || ttttctgcagcggccgcgctagcttaataagatctaaattcccgcgatccgc  || -|| - | - || - | -
 
-
|}
 
-
 
-
 
-
 
-
==ViroBytes primers==
 
-
 
-
 
-
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
 
-
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified fragment !! direction !! cap gene of AAV
 
-
|-
 
-
|align="right"| R001 || Anchor12367891012 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaacTACCG || anchor  || - ||
 
-
|-
 
-
|align="right"| R002 || Anchor4 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactactg || anchor  || - ||
 
-
|-
 
-
|align="right"| R003 || Anchor5 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactacag || anchor  || - ||
 
-
|-
 
-
|align="right"| R004 || Anchor_comp_all || gttaattaacgaatgctagtcactcagacaagctt || anchor  || - ||
 
-
|-
 
-
|align="right"| R005 || F1_for_cap12678910 || gctacggtctcaatggctgccgatggttatcttccag || 1  || forward || 1,2,6,7,8,9,10
 
-
|-
 
-
|align="right"| R006 || F1_for_cap5 || gctacggtctcaatggctgccgatggttatcttccag || 1  || forward || 5
 
-
|-
 
-
|align="right"| R007 || F1_rev_cap2 || gctacggtctcgctcctgaaactcggcgtcggcgtgg || 1  || reverse || 2
 
-
|-
 
-
|align="right"| R008 || F1_rev_cap5 || gctacggtctctctcctgaaactcggcgtccgcgtgg || 1  || reverse || 5
 
-
|-
 
-
|align="right"| R009 || F1_rev_cap9 || gctacggtctcgctcctggaactcggcgtcggcgtgg || 1  || reverse || 9
 
-
|-
 
-
|align="right"| R010 || F1_rev_cap168 || gctacggtctcgctcctgaaactcggcgtcggcgtgg || 1  || reverse || 1,6,8
 
-
|-
 
-
|align="right"| R011 || F2_for_cap2 || gctacggtctctggagcgccttaaagaagatacgtcttttggggg || 2  || forward || 2
 
-
|-
 
-
|align="right"| R012 || F2_for_cap5 || gctacggtctctggagaagctcgccgacgacacatccttcggggg || 2  || forward || 5
 
-
|-
 
-
|align="right"| R013 || F2_for_cap9 || gctacggtctctggagcggctcaaagaagatacgtcttttggggg || 2  || forward || 9
 
-
|-
 
-
|align="right"| R014 || F2_for_cap168 || gctacggtctctggagcgtctgcaagaagatacgtcttttggggg || 2  || forward || 1,6,8
 
-
|-
 
-
|align="right"| R015 || F2_rev_cap2 || gctacggtctcgtgtcgcccatccatgtggaatcgcaatgc || 2  || reverse || 2
 
-
|-
 
-
|align="right"| R016 || F2_rev_cap5 || gctacggtctcgtgtcccccatccacgtggaatcgcaatgc || 2  || reverse || 5
 
-
|-
 
-
|align="right"| R017 || F2_rev_cap9 || gctacggtctcgtgtcccccagccattgggaatcgcaatgc || 2  || reverse || 9
 
-
|-
 
-
|align="right"| R018 || F2_rev_cap168 || gctacggtctcgtgtcgcccagccatgtggaatcgcaatgc || 2  || reverse || 1,6,8
 
-
|-
 
-
|align="right"| R019 || F3_for_cap5 || gctacggtctccgacagagtcatcaccaccagcacccg || 3  || forward || 5
 
-
|-
 
-
|align="right"| R020 || F3_for_cap9 || gctacggtctccgacagagtcatcaccaccagcacccg || 3  || forward || 9
 
-
|-
 
-
|align="right"| R021 || F3_for_cap1268 || gctacggtctccgacagagtcatcaccaccagcacccg || 3  || forward || 1,2,6,8
 
-
|-
 
-
|align="right"| R022 || F3_rev_cap1 || gctacggtctcaggttattagcgatggttgtgacgccatcattcgtc || 3  || reverse || 1
 
-
|-
 
-
|align="right"| R023 || F3_rev_cap2 || gctacggtctcaggttattggcaatcgtcgtcgtaccgtcattctgc || 3  || reverse || 2
 
-
|-
 
-
|align="right"| R024 || F3_rev_cap5 || gctacggtctcaggttgttggcgatggtggtggtggagtcctgcac || 3  || reverse || 5
 
-
|-
 
-
|align="right"| R025 || F3_rev_cap6 || gctacggtctcaggttattagcgatggtcgtgacgccatcattcgtc || 3  || reverse || 6
 
-
|-
 
-
|align="right"| R026 || F3_rev_cap8 || gctacggtctcaggttattggcgatggtcttggtgccttcattctgc || 3  || reverse || 8
 
-
|-
 
-
|align="right"| R027 || F3_rev_cap9 || gctacggtctcaggttattggcgatggtcttgactccattgttgtcc || 3  || reverse || 9
 
-
|-
 
-
|align="right"| R028 || F4_for_cap2 || gctacggtctctaaccttaccagcacggttcaggtgtttactgactc || 4  || forward || 2
 
-
|-
 
-
|align="right"| R029 || F4_for_cap5 || gctacggtctccaacctcacctccaccgtccaagtgtttacggacga || 4  || forward || 5
 
-
|-
 
-
|align="right"| R030 || F4_for_cap8 || gctacggtctctaacctcaccagcaccatccaggtgtttacggactc || 4  || forward || 8
 
-
|-
 
-
|align="right"| R031 || F4_for_cap9 || gctacggtctctaaccttaccagcacggtccaggtcttcacggactc || 4  || forward || 9
 
-
|-
 
-
|align="right"| R032 || F4_for_cap16 || gctacggtctctaaccttaccagcacggttcaagtcttctcggactc || 4  || forward || 1,6
 
-
|-
 
-
|align="right"| R033 || F4_reverse_cap1 || gctacggtctcagctgctgtggaaaggcacttcctcaaaggtg || 4  || reverse || 1
 
-
|-
 
-
|align="right"| R034 || F4_reverse_cap2 || gctacggtctcagctgctgtggaaaggaacgtcctcaaaagtg || 4  || reverse || 2
 
-
|-
 
-
|align="right"| R035 || F4_reverse_cap5 || gctacggtctcagctggagtggaagggcacctcctcaaagttg || 4  || reverse || 5
 
-
|-
 
-
|align="right"| R036 || F4_reverse_cap9 || gctacggtctcagctgctatggaaaggtacgttctcaaactcg || 4  || reverse || 9
 
-
|-
 
-
|align="right"| R037 || F4_reverse_cap68 || gctacggtctcagctgctgtggaaaggcacgtcctcgaaggtg || 4  || reverse || 6,8
 
-
|-
 
-
|align="right"| R038 || F5_for_cap2 || gctacggtctcgcagctacgctcacagccagagtctggaccgtc || 5  || forward || 2
 
-
|-
 
-
|align="right"| R039 || F5_for_cap5 || gctacggtctcccagcttcgctcccagtcagaacctgttcaagc || 5  || forward || 5
 
-
|-
 
-
|align="right"| R040 || F5_for_cap8 || gctacggtctcgcagctacgcccacagccagagcttggaccggc || 5  || forward || 8
 
-
|-
 
-
|align="right"| R041 || F5_for_cap9 || gctacggtctcgcagctacgctcacagccaaagcctggaccgac || 5  || forward || 9
 
-
|-
 
-
|align="right"| R042 || F5_for_cap16 || gctacggtctcgcagctacgcgcacagccagagcctggaccggc || 5  || forward || 1,6
 
-
|-
 
-
|align="right"| R043 || F5_rev_cap2 || gctacggtctccagttcctagactggtcccgaatgtcactcg || 5  || reverse || 2
 
-
|-
 
-
|align="right"| R044 || F5_rev_cap5 || gctacggtctccagtttttgtaggtgttggcgtatctcccgg || 5  || reverse || 5
 
-
|-
 
-
|align="right"| R045 || F5_rev_cap8 || gctacggtctccagttctttgcctgattggccattgtattag || 5  || reverse || 8
 
-
|-
 
-
|align="right"| R046 || F5_rev_cap9 || gctacggtctctagtttcttccctggacagccatgttgctgg || 5  || reverse || 9
 
-
|-
 
-
|align="right"| R047 || F5_rev_cap16 || gctacggtctccagtttttgggctgaacagacatgccagctg || 5  || reverse || 1,6
 
-
|-
 
-
|align="right"| R048 || F6_for_cap2 || gctacggtctcgaactggcttcctggaccctgttaccgccagc || 6 || forward || 2
 
-
|-
 
-
|align="right"| R049 || F6_for_cap5|| gctacggtctcaaactggttcccggggcccatgggccgaaccc || 6 || forward || 5
 
-
|-
 
-
|align="right"| R050 || F6_for_cap8 || gctacggtctcgaactggctgccaggaccctgttaccgccaac || 6 || forward || 8
 
-
|-
 
-
|align="right"| R051 || F6_for_cap9 || gctacggtctcaaactacatacctggacccagctaccgacaac || 6 || forward || 9
 
-
|-
 
-
|align="right"| R052 || F6_for_cap16 || gctacggtctcaaactggctacctggaccctgttatcggcagc || 6 || forward || 1,6
 
-
|-
 
-
|align="right"| R053 || F6_rev_cap1 || gctacggtctcgccacagggttagtggctttaatttcctcttcgtctg || 6 || reverse || 1
 
-
|-
 
-
|align="right"| R054 || F6_rev_cap2 || gctacggtctcgccacgggattggttgtcctgatttcctcttcgtctg || 6 || reverse || 2
 
-
|-
 
-
|align="right"| R055 || F6_rev_cap5 || gctacggtctcgccacgcggttcaccggctgcgtctcgctctcgctgg || 6 || reverse || 5
 
-
|-
 
-
|align="right"| R056 || F6_rev_cap6 || gctacggtctcgccacggggttagtggctttgatttcctcttcgtctg || 6 || reverse || 6
 
-
|-
 
-
|align="right"| R057 || F6_rev_cap8 || gctacggtctcgccacagggttagtggttttgatttcttctcgctgg || 6 || reverse || 8
 
-
|-
 
-
|align="right"| R058 || F6_rev_cap9 || gctacggtctcgccaccgggttagtagttttaatttcttcttcgttggttatc || 6 || reverse || 9
 
-
|-
 
-
|align="right"| R059 || F7_for_cap1 || gctacggtctctgtggccaccgaaagatttgggaccgtggcagtcaatttc || 7 || forward || 1
 
-
|-
 
-
|align="right"| R060 || F7_for_cap2 || gctacggtctccgtggctacggagcagtatggttctgtatctaccaacctc || 7 || forward || 2
 
-
|-
 
-
|align="right"| R061 || F7_for_cap5 || gctacggtctccgtggcgtacaacgtcggcgggcagatg || 7 || forward || 5
 
-
|-
 
-
|align="right"| R062 || F7_for_cap6 || gctacggtctccgtggccaccgaaagatttgggactgtggcagtcaatctc || 7 || forward || 6
 
-
|-
 
-
|align="right"| R063 || F7_for_cap8 || gctacggtctctgtggctacagaggaatacggtatcgtggcagataacttg || 7 || forward || 8
 
-
|-
 
-
|align="right"| R064 || F7_for_cap9 || gctacggtctcggtagcaacggagtcctatggacaagtggccacaaaccac || 7 || forward || 9
 
-
|-
 
-
|align="right"| R065 || F7_rev_cap1 || gctacggtctcggtgatgaatgaagcaaactttgtagctgaaaac || 7 || reverse || 1
 
-
|-
 
-
|align="right"| R066 || F7_rev_cap2 || gctacggtctctgtgatgaaggaagcaaactttgccgcactgaag || 7 || reverse || 2
 
-
|-
 
-
|align="right"| R067 || F7_rev_cap5 || gctacggtctcggtgatgaagctgctgacgggcacgtccgagaag || 7 || reverse || 5
 
-
|-
 
-
|align="right"| R068 || F7_rev_cap6 || gctacggtctcggtgatgaatgaagcaaactttgtagccgaaaac || 7 || reverse || 6
 
-
|-
 
-
|align="right"| R069 || F7_rev_cap8 || gctacggtctccgtgatgaaagagttcagctttgactggttgaag || 7 || reverse || 8
 
-
|-
 
-
|align="right"| R070 || F7_rev_cap9 || gctacggtctcggtgatgaaagagttcagcttgtccttgttgaag || 7 || reverse || 9
 
-
|-
 
-
|align="right"| R071 || F8_for_cap1 || gctacggtctcatcacccaatactccacaggacaagtgagtgtgg || 8 || forward || 1
 
-
|-
 
-
|align="right"| R072 || F8_for_cap2 || gctacggtctcatcacacagtactccacgggacaggtcagcgtgg || 8 || forward || 2
 
-
|-
 
-
|align="right"| R073 || F8_for_cap5 || gctacggtctcatcacccagtacagcaccgggcaggtcaccgtgg || 8 || forward || 5
 
-
|-
 
-
|align="right"| R074 || F8_for_cap6 || gctacggtctcatcacccagtattccacaggacaagtgagcgtgg || 8 || forward || 6
 
-
|-
 
-
|align="right"| R075 || F8_for_cap8 || gctacggtctcatcacgcaatacagcaccggacaggtcagcgtgg || 8 || forward || 8
 
-
|-
 
-
|align="right"| R076 || F8_for_cap9 || gctacggtctcatcacccagtattctactggccaagtcagcgtgg || 8 || forward || 9
 
-
|-
 
-
|align="right"| R077 || F8_rev_cap1 || gctacggcgcgccttacaggggacgggtaaggtaacgggtgcc || 8 || reverse || 1
 
-
|-
 
-
|align="right"| R078 || F8_rev_cap2 || gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg || 8 || reverse || 2
 
-
|-
 
-
|align="right"| R079 || F8_rev_cap5 || gctacggcgcgccttaaaggggtcgggtaaggtatcgggttccgatagg || 8 || reverse || 5
 
-
|-
 
-
|align="right"| R080 || F8_rev_cap6 || gctacggcgcgccttacaggggacgggtgaggtaacgggtgcc || 8 || reverse || 6
 
-
|-
 
-
|align="right"| R081 || F8_rev_cap8 || gctacggcgcgccttacagattacgggtgaggtaacgggtgccaatggg || 8 || reverse || 8
 
-
|-
 
-
|align="right"| R082 || F8_rev_cap9 || gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg || 8 || reverse || 9
 
-
|-
 
-
|align="right"| R083 || Virbyte_for || gtctgagtgactagcattcggtctgagtgactagcattcg || - || forward
 
-
|-
 
-
|align="right"| R084 || Virobyte_rev || gctacggcgcgcctta || - || reverse
 
-
|}
 
-
 
-
 
-
 
-
==Primer Table Quick 'n' Dirty==
 
-
 
-
 
-
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
 
-
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone
 
-
|-
 
-
|align="right"| L001 || CMV_AgeI_fw || ttttaccggtagaatctgcttagggttagg || for use with L11 || from pcDNA5+miRNA || to tuning construct-pTR-UF3 KpnI/SalI
 
-
|-
 
-
|align="right"| L002 || CMVshRNApA_KpnI_rv || taatggtacccagaagccatagagcccacc || - || from pcDNA5+miRNA || to tuning construct-pTR-UF3 KpnI/SalI
 
-
|-
 
-
|align="right"| L003 || HSVluc_norm_BglII_fw || tttttagatcttgcaggagcttcagggagtg || for use with L8 || from PsiCheck2 || to pTR-UF3 BglII
 
-
|-
 
-
|align="right"| L004 || HSVluc_norm_BglII_rv || ttttagatctggttccgcgcacatttccc || for use with L7 || from PsiCheck2 || to pTR-UF3 BglII
 
-
|-
 
-
|align="right"| L005 || HSVluc_norm_KpnI_fw || tttttggtagcaggagcttcagggagtg || for use with L16 || from PsiCheck2 || to pTR-UF3 KpnI/SalI
 
-
|-
 
-
|align="right"| L006 || HSVluc_norm_SalI_rv || ttttgtcgacggttccgcgcacatttccc || for use with L15 || from PsiCheck2 || to pTR-UF3 KpnI/SalI
 
-
|-
 
-
|align="right"| L007 || Sv40lucmcs_AgeI_fw || ttttaccggtgtggaatgtgtgtcagttag || for use with L13 || from PsiCheck2 || to tuning construct-pTR-UF3 KpnI/SalI
 
-
|-
 
-
|align="right"| L008 || SV40luc_SalI_rv || tattgtcgacccgcgtcagacaaaccctaac || for use with L1 || from PsiCheck2 || to tuning construct-pTR-UF3 KpnI/SalI
 
-
|-
 
-
|align="right"| L009 || TetO2_StuI_NheI || ttttaggccttccctatcagtgatagagatctccctatcagtgatagagagctagctaac || Tet Repressor|| Oligo || to final tuning construct
 
-
|-
 
-
|align="right"| L010 || TetR_BspEI_fw || tttttccggaggcgaattgatatgtctagattag || for use with L14 || from pcDNA6/TR || pTR-UF3 BspEI/NotI
 
-
|-
 
-
|align="right"| L011 || TetR_SgfI_NotI_rv || ttttgcggccgctggcgatcgctaataagatctgaattcccgggatc || for use with L12 || from pcDNA6/TR || to pTR-UF3 BspEI/NotI
 
-
|}
 
-
 
-
 
-
 
-
==Primer Table raPCR ==
 
-
 
-
 
-
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
 
-
!align="right"| ID !! Name !! Sequence (5' to 3') !! target !! Assembly Site !!
 
-
|-
 
-
|align="right"| ra001 || psicheck2_MCS_min_200_fw || cagcgacgatctgcctaa || sequencing fw || || sequencing Primer for binding-sites in pSiCheck vector
 
-
|-
 
-
|align="right"| ra002 || psicheck2_MCS_plu_200_rv || gtggccaccaagaccaaa || sequencing rv || ||  sequencing Primer for binding-sites in pSiCheck vector
 
-
|-
 
-
|align="right"| ra003 || raPCR_AS13-hsa-mir-122 || cactgaatccaactgcaaacaccattgtcacactccagcatacatggactgc || hsa-mir-122 || 13 bp ||
 
-
|-
 
-
|align="right"| ra004 || raPCR_AS13-has-mir122(ran9-12) || cactgaatccaactgcaaacaccatnnnnacactccagcatacatggactgc || has-mir122 (ran9-12) || 13 bp || randomised nucleotides 9-12
 
-
|-
 
-
|align="right"| ra005 || raPCR_AS13-hsa-mir-320b || cactgaatccaactgttgccctctcaacccagcttttgcatacatggactgc || hsa-mir-320b || 13 bp ||
 
-
|-
 
-
|align="right"| ra006 || raPCR_AS13-has-mir-221 || cactgaatccaactggaaacccagcagacaatgtagctgcatacatggactgc || has-mir-221 || 13 bp ||
 
-
|-
 
-
|align="right"| ra007 || raPCR_AS13-has-mir-221(ran9-12 || cactgaatccaactggaaacccagcannnnatgtagctgcatacatggactgc || has-mir-221 (ran9-12) || 13 bp || randomised nucleotides 9-12
 
-
|-
 
-
|align="right"| ra008 || raPCR_AS13-has-mir-1179 || cactgaatccaactgccaaccaatgaaagaatgcttgcatacatggactgc || has-mir-1179 || 13 bp ||
 
-
|-
 
-
|align="right"| ra009 || raPCR_AS13-has-mir-1179ran9-12 || cactgaatccaactgccaaccaatnnnngaatgcttgcatacatggactgc || has-mir-1179 (ran9-12) || 13 bp || randomised nucleotides 9-12
 
-
|-
 
-
|align="right"| ra010 || raPCR_AS13-has-mir4286 || cactgaatccaactgggtaccaggagtggggtgcatacatggactgc || has-mir4286 || 13 bp ||
 
-
|-
 
-
|align="right"| ra011 || raPCR_AS13-mm-mir-375 || cactgaatccaactgtcacgcgagccgaacgaacaaagcatacatggactgc || mm-mir-375 || 13 bp ||
 
-
|-
 
-
|align="right"| ra012 || raPCR_AS13-mm-mir-375(ran9-12) || cactgaatccaactgtcacgcgagcnnnncgaacaaagcatacatggactgc || mm-mir-375 (ran9-12) || 13 bp || randomised nucleotides 9-12
 
-
|-
 
-
|align="right"| ra013 || raPCR_AS13-mm-mir-376a || cactgaatccaactgacgtggattttcctctacgatgcatacatggactgc || mm-mir-376a || 13 bp ||
 
-
|-
 
-
|align="right"| ra014 || raPCR_AS13-spacer(0) || cagttggattcagtggcagtccatgtatgc  || spacer || 13 bp ||
 
-
|-
 
-
|align="right"| ra015 || raPCR_AS13-spacer(10) || cagttggattcagtggctatttctcgcagtccatgtatgc  || spacer || 13 bp ||
 
-
|-
 
-
|align="right"| ra016 || raPCR_AS13-spacer(20) || cagttggattcagtgatgacaggtagctatttctcgcagtccatgtatgc  || spacer || 13 bp ||
 
-
|-
 
-
|align="right"| ra017 || raPCR_AS13-stop_fw_BBB || ttttgaattcgcggccgcactagtcactgaatccaactg || stop fw || 13 bp ||
 
-
|-
 
-
|align="right"| ra018 || raPCR_AS13-stop_rev_BBB || ttttctgcagcggccgcgctagcgcagtccatgtatgc || stop rev || 13 bp ||
 
-
|-
 
-
|align="right"| ra019 || raPCR_AS13-stop_rev_NotI || ttttgcggccgctggagtgtgacaatggtgtttg || stop rev || 13 bp ||
 
-
|-
 
-
|align="right"| ra020 || raPCR_AS13-stop_fw_XhoI || ttttctcgagcactgaatccaactg || stop fw || 13 bp ||
 
-
|}
 
-
 
-
 
-
 
-
 
-
==maus oligos==
 
-
 
-
 
-
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"
 
-
!align="right"| ID !! Name !! Sequence (5' to 3') !! Synthesis scale
 
-
|-
 
-
|align="right"| mouse1 || CMV_TetR_122bs_SalI_fw ||ttttgtcgaccgttgacattgattattgac || 25N 
 
-
|-
 
-
|align="right"| mouae2 || CMV_TetR_both_MluI_rev || ttttacgcgttaacacacaaaaaaccaacac || 25N 
 
-
|-
 
-
|align="right"| mouse3 || CMV_TetR_control_SalI_fw || ttttgtcgaccgttgacattgattattgac || 25N 
 
-
|-
 
-
|align="right"| mouse4 || CMV_TetO2_EcoRI_fw || ttttgaattcgttgacattgattattgtctag || 25N 
 
-
|-
 
-
|align="right"| mouse5 || Luc2_Ter_PstI_rev || ttttctgcagtaccacatttgtagaggttttac || 25N 
 
-
|-
 
-
|align="right"| mouse6 || haat_bs_p_fw || tcgaggaagcgtttaggcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse7 || haat_bs_p_rev || ggccgctctagagatgttaaacatgcctaaacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse8 || haat_bs_r10_12_aat_fw || tcgaggaagcgtaatggcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse9 || haat_bs_r10_12_aat_rev || ggccgctctagagatgttaaacatgccattacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse10 || haat_bs_r10_12_agc_fw || tcgaggaagcgtagcggcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse11 || haat_bs_r10_12_agc_rev || ggccgctctagagatgttaaacatgccgctacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse12 || haat_bs_m10at_fw || tcgaggaagcgttttggcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse13 || haat_bs_m10at_rev || ggccgctctagagatgttaaacatgccaaaacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse14 || haat_bs_m10ac_fw || tcgaggaagcgtttcggcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse15 || haat_bs_m10ac_rev || ggccgctctagagatgttaaacatgccgaaacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse16 || haat_bs_m11ta_fw || tcgaggaagcgttaaggcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse17 || haat_bs_m11ta_rev || ggccgctctagagatgttaaacatgccttaacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse18 || haat_bs_m11tg_fw || tcgaggaagcgttgaggcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse19 || haat_bs_m11tg_rev || ggccgctctagagatgttaaacatgcctcaacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse20 || haat_bs_r9_12_aatc_fw || tcgaggaagcgtaatcgcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse21 || haat_bs_r9_12_aatc_rev || ggccgctctagagatgttaaacatgcgattacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse22 || haat_bs_r9_12_agcc_fw || tcgaggaagcgtagccgcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse23 || haat_bs_r9_12_agcc_rev || ggccgctctagagatgttaaacatgcggctacgcttcc || 25N 
 
-
|-
 
-
|align="right"| mouse24 || haat_bs_onlyseed_fw || tcgagcttcgcaaatcgcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse25 || haat_bs_onlyseed_rev || ggccgctctagagatgttaaacatgcgatttgcgaagc || 25N 
 
-
|-
 
-
|align="right"| mouse26 || haat_bs_r16-18_fw || tcgaggttccgtttaggcatgtttaacatctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse27 || haat_bs_r16-18_rev || ggccgctctagagatgttaaacatgcctaaacggaacc || 25N 
 
-
|-
 
-
|align="right"| mouse28 || sAg_bs_p_fw || tcgagctcagtttactagtgccatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse29 || sAg_bs_p_rev || ggccgctctagagaacaaatggcactagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse30 || sAg_bs_r10_12_acg_fw || tcgagctcagtttactagacgcatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse31 || sAg_bs_r10_12_acg_rev || ggccgctctagagaacaaatgcgtctagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse32 || sAg_bs_r10_12_taa_fw || tcgagctcagtttactagtaacatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse33 || sAg_bs_r10_12_taa_rev || ggccgctctagagaacaaatgttactagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse34 || sAg_bs_r9_12_acgg_fw || tcgagctcagtttactagacggatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse35 || sAg_bs_r9_12_acgg_rev || ggccgctctagagaacaaatccgtctagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse36 || sAg_bs_r9_12_atgt_fw || tcgagctcagtttactagatgtatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse37 || sAg_bs_r9_12_atgt_rev || ggccgctctagagaacaaatacatctagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse38 || sAg_bs_m10cg_fw || tcgagctcagtttactagtggcatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse39 || sAg_bs_m10cg_rev || ggccgctctagagaacaaatgccactagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse40 || sAg_bs_m10ca_fw || tcgagctcagtttactagtgacatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse41 || sAg_bs_m10ca_rev || ggccgctctagagaacaaatgtcactagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse42 || sAg_bs_m11gc_fw || tcgagctcagtttactagtcccatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse43 || sAg_bs_m11gc_rev || ggccgctctagagaacaaatgggactagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse44 || sAg_bs_m11ga_fw || tcgagctcagtttactagtaccatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse45 || sAg_bs_m11ga_rev || ggccgctctagagaacaaatggtactagtaaactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse46 || sAg_bs_onlyseed_fw || tcgagctcagtaatgatcacggatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse47 || sAg_bs_onlyseed_rev || ggccgctctagagaacaaatccgtgatcattactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse48 || sAg_bs_r16-18_fw || tcgagctcagttatgtagtgccatttgttctctagagc || 25N 
 
-
|-
 
-
|align="right"| mouse49 || sAg_bs_r16-18_rev || ggccgctctagagaacaaatggcactacataactgagc || 25N 
 
-
|-
 
-
|align="right"| mouse50 || hAAT_cDNA_SalI_Bluescript_fw || ttttgtcgacgaccatgattacgccaagcg || 25N 
 
-
|-
 
-
|align="right"| mouse51 || hAAT_cDNA_SalI_fw || ttttgtcgacgggtaccgggccccccgtcgaggatg || 25N 
 
-
|-
 
-
|align="right"| mouse52 || hAAT_cDNA_XhoI_NotI_NheI_rev || ttttgctagcgcggccgcgtatctcgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse53 || hAAT_cDNA_sAg_bs_p_NheI_rev || ttttgctagcgaacaaatggcactagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse54 || hAAT_cDNA_sAg_bs_r10_12_acg_NheI_rev || ttttgctagcgaacaaatgcgtctagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse55 || hAAT_cDNA_sAg_bs_r10_12_taa_NheI_rev || ttttgctagcgaacaaatgttactagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse56 || hAAT_cDNA_bs_r9_12_acgg_NheI_rev || ttttgctagcgaacaaatccgtctagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse57 || hAAT_cDNA_sAg_bs_r9_12_atgt_NheI_rev || ttttgctagcgaacaaatacatctagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse58 || hAAT_cDNA_sAg_bs_m10cg_NheI_rev || ttttgctagcgaacaaatgccactagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse59 || hAAT_cDNA_sAg_bs_m10ca_NheI_rev || ttttgctagcgaacaaatgtcactagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse60 || hAAT_cDNA_sAg_bs_m11gc_NheI_rev || ttttgctagcgaacaaatgggactagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse61 || hAAT_cDNA_sAg_bs_m11ga_NheI_rev || ttttgctagcgaacaaatggtactagtaaactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse62 || hAAT_cDNA_sAg_bs_onlyseed_NheI_rev || ttttgctagcgaacaaatccgtgatcattactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse63 || hAAT_cDNA_sAg_bs_r16-18_NheI_rev || ttttgctagcgaacaaatggcactacataactgaggctcaacccttctttaatg || 25N 
 
-
|-
 
-
|align="right"| mouse64 || sAg_bs_p_fw_E || aattcctcagtttactagtgccatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse65 || sAg_bs_p_rev_P || ggaacaaatggcactagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse66 || sAg_bs_r10_12_acg_fw_E || aattcctcagtttactagacgcatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse67 || sAg_bs_r10_12_acg_rev_P || ggaacaaatgcgtctagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse68 || sAg_bs_r10_12_taa_fw_E || aattcctcagtttactagtaacatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse69 || sAg_bs_r10_12_taa_rev_P || ggaacaaatgttactagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse70 || sAg_bs_r9_12_acgg_fw_E || aattcctcagtttactagacggatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse71 || sAg_bs_r9_12_acgg_rev_P || ggaacaaatccgtctagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse72 || sAg_bs_r9_12_atgt_fw_E || aattcctcagtttactagatgtatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse73 || sAg_bs_r9_12_atgt_rev_P || ggaacaaatacatctagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse74 || sAg_bs_m10cg_fw_E || aattcctcagtttactagtggcatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse75 || sAg_bs_m10cg_rev_P || ggaacaaatgccactagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse76 || sAg_bs_m10ca_fw_E || aattcctcagtttactagtgacatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse77 || sAg_bs_m10ca_rev_P || ggaacaaatgtcactagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse78 || sAg_bs_m11gc_fw_E || aattcctcagtttactagtcccatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse79 || sAg_bs_m11gc_rev_P || ggaacaaatgggactagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse80 || sAg_bs_m11ga_fw_E || aattcctcagtttactagtaccatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse81 || sAg_bs_m11ga_rev_P || ggaacaaatggtactagtaaactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse82 || sAg_bs_onlyseed_fw_E || aattcctcagtaatgatcacggatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse83 || sAg_bs_onlyseed_rev_P || ggaacaaatccgtgatcattactgagg ||  25N 
 
-
|-
 
-
|align="right"| mouse84 || sAg_bs_r16-18_fw_E || aattcctcagttatgtagtgccatttgttcctgca ||  25N 
 
-
|-
 
-
|align="right"| mouse85 || sAg_bs_r16-18_rev_P || ggaacaaatggcactacataactgagg ||  25N 
 
-
|}
 
-
 
-
 
{{:Team:Heidelberg/Pagemiddle}}
{{:Team:Heidelberg/Pagemiddle}}

Revision as of 15:14, 23 October 2010


Parts

Loading.....