Team:Heidelberg/Notebook/miMeasure

From 2010.igem.org

(Difference between revisions)
m
Line 10: Line 10:
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''
|colspan="3"| ||'''1'''||'''2'''||'''3'''||'''4'''
|- style="background:#f2f2f2; color:#78b41e"
|- style="background:#f2f2f2; color:#78b41e"
-
|'''[http://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#05.2F07.2F2010  5]'''|'''6'''||'''7'''||'''8'''||'''9'''||'''10'''||'''11'''
+
|'''[http://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#05.2F07.2F2010  5]'''||'''6'''||'''7'''||'''8'''||'''9'''||'''10'''||'''11'''
|- style="background:#f2f2f2; color:#78b41e"
|- style="background:#f2f2f2; color:#78b41e"
|'''[http://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#12.2F07.2F2010  12]'''||'''13'''||'''14'''||'''15'''||'''16'''||'''17'''||'''18'''
|'''[http://2010.igem.org/Team:Heidelberg/Notebook/miMeasure/July#12.2F07.2F2010  12]'''||'''13'''||'''14'''||'''15'''||'''16'''||'''17'''||'''18'''
Line 93: Line 93:
===Analysis of binding sites against synthetic miRNA miRsAg===
===Analysis of binding sites against synthetic miRNA miRsAg===
-
5000 Hela cells were seeded on day one in each well of the 96 well plate. Transfection of the constructs (M12-M22) with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 5 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.
+
5000 HeLa cells were seeded on day one in each well of the 96 well plate. Transfection of the constructs (M12-M22) with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 5 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.
Condition a: cotransfection with stuffer (salmon sperm DNA)  
Condition a: cotransfection with stuffer (salmon sperm DNA)  
Line 108: Line 108:
-
[[Image:M12-M22_HeLa_daten.jpg|thumb|600px|left|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs (M12-22) including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]
+
[[Image:M12-M22_HeLa_daten.jpg|thumb|600px|left|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of HeLa cells, which were transfected with different miMeasure constructs (M12-22) including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]
====Table1====
====Table1====
Line 144: Line 144:
==== miraPCR: analysis of endogenous miRNA====
==== miraPCR: analysis of endogenous miRNA====
-
Hela and Huh7 cells were transfected with the constructs miM-r12, miM-r22, miM-1.3-7 and miM-3.1-8 (see table2). These constructs contain binding sites against miR-122. Since Huh7 cells express miR-122, the constructs will be affected in the Huh7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the Hela cells.
+
HeLa and HuH7 cells were transfected with the constructs miM-r12, miM-r22, miM-1.3-7 and miM-3.1-8 (see table2). These constructs contain binding sites against miR-122. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells.
-
The transfection is done with lipofectamin. 70ng of total DNA is used and for Hela cells the miRNA to miMeasure construct ratio was 2:1. The cells were imaged one day after trasnfection with the Leica confocal microspe. The result shows the ratio between GFP and BFP normalized to the negative control, where miMeasure constructs without binding sites are transfected. The miMeasure construct with one perfect binding site is also transfected.
+
The transfection is done with lipofectamin. 70ng of total DNA is used and for HeLa cells the miRNA to miMeasure construct ratio was 2:1. The cells were imaged one day after trasnfection with the Leica confocal microspe. The result shows the ratio between GFP and BFP normalized to the negative control, where miMeasure constructs without binding sites are transfected. The miMeasure construct with one perfect binding site is also transfected.

Revision as of 04:01, 27 October 2010

July
MTWTFSS
1234
567891011
12131415161718
19202122232425
26272829301

-


August
MTWTFSS
1
2345678
9101112131415
16171819202122
23242526272829
3031


September
MTWTFSS
12345
6789101112
13141516171819
20212223242526
2728293031

-


October
MTWTFSS
123
45 678910
11131415161718
19202122232425
2627282930

-

Example.jpg

 

miMeasure

Analysis of binding sites against synthetic miRNA miRsAg

5000 HeLa cells were seeded on day one in each well of the 96 well plate. Transfection of the constructs (M12-M22) with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 5 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.

Condition a: cotransfection with stuffer (salmon sperm DNA)

Condition b: cotransfection with synthetic RNA miRsAg

Condition c: cotransfection with empty pcDNA5

Condition d: cotransfection with synthetic shRNA3

A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d.

The cells were used for measurements on day three.


GFP/BFP ratio normalized by the negative control The data are generated by confocal microscopy of HeLa cells, which were transfected with different miMeasure constructs (M12-22) including the negative control (miMeasure construct without binding site). The negative control equals to 1.

Table1

table 1: used binding sites and their features
sequencebinding site featureName/number
ctcagtttactagtgccatttgttcperfect binding site against miRsAgM12
ctcagtttactagacgcatttgttcmiMeasure with randomised nucleotides 10-12M13
ctcagtttactagtaacatttgttcmiMeasure with randomised nucleotides 10-12M14
ctcagtttactagacggatttgttcmiMeasure with randomised nucleotides 9-12M15
ctcagtttactagatgtatttgttcmiMeasure with randomised nucleotides 9-12M16
ctcagtttactagtggcatttgttcmiMeasure with mutated nucleotide 10M17
ctcagtttactagtgacatttgttcmiMeasure with mutated nucleotide 10M18
ctcagtttactagtaccatttgttcmiMeasure with mutated nucleotide 9M20
ctcagttatgtagtgccatttgttcmiMeasure with mutated nucleotide 9M22


miraPCR: analysis of endogenous miRNA

HeLa and HuH7 cells were transfected with the constructs miM-r12, miM-r22, miM-1.3-7 and miM-3.1-8 (see table2). These constructs contain binding sites against miR-122. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells. The transfection is done with lipofectamin. 70ng of total DNA is used and for HeLa cells the miRNA to miMeasure construct ratio was 2:1. The cells were imaged one day after trasnfection with the Leica confocal microspe. The result shows the ratio between GFP and BFP normalized to the negative control, where miMeasure constructs without binding sites are transfected. The miMeasure construct with one perfect binding site is also transfected.



Table2

table 2: raPCR designed binding sites and their features
binding site featureName/number
miMeasure with 3 aligned perfect binding sitesmiM-1.3-7
miMeasure with two imperfect binding sitesmiM-3.1-8
miMeasure with randomised nucleotides 9-12miM-r12
miMeasure with randomised nucleotides 9-22miM-r22