Team:Heidelberg/Modeling/miBSdesigner

From 2010.igem.org

(Difference between revisions)
 
(24 intermediate revisions not shown)
Line 1: Line 1:
-
{{:Team:Heidelberg/Template}}
+
{{:Team:Heidelberg/Double}}
{{:Team:Heidelberg/Pagetop|mibsdesigner}}
{{:Team:Heidelberg/Pagetop|mibsdesigner}}
<!--<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">-->
<!--<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">-->
Line 7: Line 7:
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
<style type="text/css">
<style type="text/css">
-
div.wrapper {width: 260px; height: 650px; border-width:3px; margin:auto; border-style:solid; border-color:#11526f;  text-align:center;}
+
.wrapper {width: 260px; text-align:center;}
-
div.wrapper2 {padding:25px; border-width:3px; margin:auto; border-style:solid; border-color:#11526f; height: 650px; text-align:left; }
+
.wrapper2 {margin:auto; height: 700px; text-align:left; }
-
div.title {text-indent:30px;}
+
.title {padding-left:0px; line-height:2; font-weight:bold; font-size:17px;}
-
div.option {text-indent:50px; white-space:pre-wrap;}
+
.option {padding-left:10px; white-space:pre-wrap;}
-
div.optionl {text-indent:50px; white-space:pre-wrap; float:left;}
+
.optionl {padding-left:10px; white-space:pre-wrap; float:left; font-size:15px;}
-
div.optionr {display:inline; white-space:pre-wrap; margin-right: 45px; float:right;}
+
.optionr {display:inline; white-space:pre-wrap; margin-right: 45px; float:right; font-size:15px;}
-
div.suboption {text-indent:80px;}
+
.suboption {padding-left:20px; font-size:15px;}
-
div.clear {clear: both;}
+
.clear {clear: both;}
-
div.reswrap2 {padding:5px; width: 240px; margin:auto; text-align:left; display:none; font-size:12pt;}
+
.reswrap2 {padding:5px; width: 240px; margin:auto; text-align:left; display:none; font-size:12pt;}
-
.variaresult {font-size: 12pt; color: #11526f; font-weight: bold;}
+
.variaresult {font-size: 16px; color: #11526f; font-weight: bold;}
 +
.largetext {font-size: 17px;}
 +
td {vertical-align:top;}
</style>
</style>
</head>
</head>
Line 23: Line 25:
<div class="wrapper2">
<div class="wrapper2">
<center>
<center>
-
<span style="font-size: 17.0px;">Sequence name </span>
+
<div class="t1">
-
<br>
+
Construction of microRNA binding sites </div><br>
 +
<div style="width:350px; text-align:right;"><span class="help"><a href="http://2010.igem.org/Team:Heidelberg/Modeling/trainingset#Input" target="_blank" title="Input help">?</a><span></div>
 +
<div class="largetext" style="width:450px;">
 +
Sequence name<br>
<input type="text" name="name" id="name" size="40" value="hsa-miR122"/><br>
<input type="text" name="name" id="name" size="40" value="hsa-miR122"/><br>
-
<span style="font-size: 17.0px;">microRNA Sequence ( 5' -> 3')</span><br>
+
microRNA Sequence ( 5' -> 3')<br>
<input type="text" name="mir" id="mir" size="40" value="UCAGUUUACUAGUGCCAUUUGU"/><br>
<input type="text" name="mir" id="mir" size="40" value="UCAGUUUACUAGUGCCAUUUGU"/><br>
-
<span style="font-size: 17.0px;">
+
Spacer (inert sequence)<br>
-
Spacer (inert sequence) </span><br>
+
<input type="text" name="spacer" id="spacer" size="40" value="TTATATTTTATGACA"/>
-
<input type="text" name="spacer" id="spacer" size="40" value="TTATATTTTATGACA"/></center>
+
</center><br><br>
-
<br><br>
+
<div class="largetext" style="width:400px;">
<input name="quality" value="perfect" onchange="chMd()" checked="checked" type="radio">
<input name="quality" value="perfect" onchange="chMd()" checked="checked" type="radio">
-
<span style="font-size: 17.0px;">
+
Perfect Binding Site <br>
-
Perfect Binding Site </span>
+
-
<br>
+
<input name="quality" value="bulge" onchange="chMd()" type="radio">
<input name="quality" value="bulge" onchange="chMd()" type="radio">
-
<span style="font-size: 17.0px;">
+
Imperfect Binding Site with 4 nt bulge (9-12)<br>
-
Imperfect Binding Site with 4 nt bulge (9-12) </span>
+
-
<br>
+
<input name="quality" value="personal" onchange="chMd()" type="radio">
<input name="quality" value="personal" onchange="chMd()" type="radio">
-
<span style="font-size: 17.0px;">
+
Personalized Binding Site  
-
Personalized Binding Site </span>
+
</div>
-
<br>
+
<br>
-
<br>
+
<table>
-
<div class="title">
+
<tr height=120px>
-
<span style="font-size: 17.0px; text-decoration: underline;">
+
<td width=290px>
-
Seed sequence (1-8) </span></div>
+
<div class="title">
-
<div class="option"><SELECT name="seed" onchange="chMd1()" disabled="disabled">
+
Seed sequence (1-8) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <span class="help"><a href="http://2010.igem.org/Team:Heidelberg/Modeling/trainingset#Seed_Types" target="_blank" title="Seed sequence help">?</a></span>
-
                <OPTION value="0">
+
</div>
-
<OPTION value="6mer">6mer                (2-7 paired)
+
<div class="option"><SELECT name="seed" onchange="chMd1()" disabled="disabled">
-
<OPTION value="7merA1">7merA1          (1-7 paired)
+
<OPTION value="0">
-
<OPTION value="7merm8">7merm8          (2-8 paired)
+
<OPTION value="6mer">6mer                (2-7 paired)
-
<OPTION value="8mer">8mer                (1-8 paired)
+
<OPTION value="7merA1">7merA1          (1-7 paired)
-
<OPTION value="custom">Custom
+
<OPTION value="7merm8">7merm8          (2-8 paired)
-
</SELECT></div>
+
<OPTION value="8mer">8mer                (1-8 paired)
-
<div class="suboption">
+
<OPTION value="custom">Custom
-
<span style="font-size: 15.0px;"> Customized </span>
+
</SELECT></div>
-
<span style="color: #11526f; font-size: 15.0px; font-weight: bold; ">MISMATCH </span>
+
<div class="suboption">
-
<span style="font-size: 15.0px;">position</span></div>
+
Customized <span style="color:#11526f; font-weight:bold;">MISMATCH</span> position
-
<div class="suboption">
+
<input type="text" id="mis" size="29" disabled="disabled" value="2"/>
-
<input type="text" id="mis" size="30" disabled="disabled" value="2"/>
+
</div>
-
</div>
+
</td>
-
<br>
+
<td>
-
<div class="title">
+
<div class="title">
-
<span style="font-size: 17.0px; text-decoration: underline;">
+
Supplementary region &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <span class="help"><a href="http://2010.igem.org/Team:Heidelberg/Modeling/trainingset#Supplementary_Region" title="Supplementary region help" target="_blank">?</a></span></div>
-
Supplementary region </span></div>
+
<div class="option"><SELECT name="comp" onchange="chMd2()" disabled="disabled">
-
<div class="option"><SELECT name="comp" onchange="chMd2()" disabled="disabled">
+
<OPTION value="0">
-
                <OPTION value="0">
+
<OPTION value="3">3                  (14-16 paired)
-
<OPTION value="3">3                  (14-16 paired)
+
<OPTION value="4">4                  (13-16 paired)
-
<OPTION value="4">4                  (13-16 paired)
+
<OPTION value="5">5                  (13-17 paired)
-
<OPTION value="5">5                  (13-17 paired)
+
<OPTION value="6">6                  (13-18 paired)
-
<OPTION value="6">6                  (13-18 paired)
+
<OPTION value="7">7                  (13-19 paired)
-
<OPTION value="7">7                  (13-19 paired)
+
<OPTION value="8">8                  (13-20 paired)
-
<OPTION value="8">8                  (13-20 paired)
+
<OPTION value="total">Total            (13-22 paired)
-
<OPTION value="total">Total            (13-22 paired)
+
<OPTION value="custom">Custom  
-
<OPTION value="custom">Custom  
+
</SELECT></div>
-
</SELECT></div>
+
<div class="suboption">
-
<div class="suboption">
+
Customized <span style="color: #11526f; font-weight:bold;">MATCH</span> positions
-
<span style="font-size: 15.0px;"> Customized </span>
+
<input type="text" id="match" size="29" disabled="disabled" value="10, 15, 16, 17, 18, 19, 20"/>
-
<span style="color: #11526f; font-size: 15.0px; font-weight: bold; ">MATCH </span>
+
</div>
-
<span style="font-size: 15.0px;">positions (input numbers from 9 to 22)</span></div>
+
</td>
-
<div class="suboption">
+
</tr>
-
<input type="text" id="match" size="30" disabled="disabled" value="10, 15, 16, 17, 18, 19, 20"/></div>
+
<tr>
-
<br>
+
<td>
-
<br>
+
<div class="title">
-
<div class="title">
+
Modify AU content &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <span class="help"><a href="http://2010.igem.org/Team:Heidelberg/Modeling/trainingset#AU_Content" target="_blank" title="AU help">?</a></span></div>
-
<span style="font-size: 17.0px; text-decoration: underline;">
+
<table style="line-height:2; font-size:12px;">
-
Modify AU content </span>
+
<tr>
-
</div>
+
<td width=130px>
-
<div class="optionl"><input name="AU" value="-1" type="checkbox"><span style="font-size: 15.0px;">A in position -1</span></div>
+
<input name="AU" value="-1" type="checkbox">A in position -1<br>
-
<div class="optionr"><input name="AU" value="0" type="checkbox"><span style="font-size: 15.0px;">A in position </span></div>
+
<input name="AU" value="1" disabled="disabled" type="checkbox">A in position 1<br>
-
<div class="clear">
+
<input name="AU" value="9" disabled="disabled" type="checkbox">A in position 9<br>
-
<div class="optionl"><input name="AU" value="1" disabled="disabled" type="checkbox"><span style="font-size: 15.0px;">A in position 1</span></div>
+
</td>
-
<div class="optionr"><input name="AU" value="8" disabled="disabled" type="checkbox"><span style="font-size: 15.0px;">A in position </span></div></div>
+
<td>
-
<div class="clear">
+
<input name="AU" value="0" type="checkbox">A in position 0<br>
-
<div class="optionl"><input name="AU" value="9" disabled="disabled" type="checkbox"><span style="font-size: 15.0px;">A in position 9</span></div>
+
<input name="AU" value="8" disabled="disabled" type="checkbox">A in position 8<br>
-
<div class="optionr"><input name="AU" value="10" disabled="disabled" type="checkbox"><span style="font-size: 15.0px;">A in position 10</span></div></div><br>
+
<input name="AU" value="10" disabled="disabled" type="checkbox">A in position 10<br>
-
<br>
+
</td>
-
<div class="title"><span style="font-size: 17.0px; text-decoration: underline;">Sticky ends for integration in plasmid: </span></div>
+
</tr>
-
<div class="option">   <SELECT id="stickyends" name="stickyends" onchange="chMd3()">
+
</table>
 +
</td>
 +
<td>
 +
<div class="title">Sticky ends for integration into plasmid &nbsp; <span class="help"><a href="http://2010.igem.org/Team:Heidelberg/Modeling/trainingset#Sticky_Ends target="_blank" title="ends help"">?</a></span></div></div>
 +
<div class="option"><SELECT id="stickyends" name="stickyends" onchange="chMd3()">
<OPTION SELECTED value="none">None
<OPTION SELECTED value="none">None
<OPTION value="BBB">Biobricks Standard RFC-12
<OPTION value="BBB">Biobricks Standard RFC-12
Line 106: Line 111:
<OPTION value="custom">Custom sequence
<OPTION value="custom">Custom sequence
</SELECT></div>
</SELECT></div>
-
<div class="option"><span style="font-size: 15.0px;">     Customized:    5'</span><input type="text" id="end5" size="15" disabled="disabled"/>         <span style="font-size: 15.0px;">3'</span><input type="text" id="end3" size="15" disabled="disabled"/>
+
<div class="suboption">Customized:<br>
 +
5'&nbsp;&nbsp;<input type="text" id="end5" size="15" disabled="disabled"/><br>
 +
3'&nbsp;&nbsp;<input type="text" id="end3" size="15" disabled="disabled"/>
</div>
</div>
 +
</td>
 +
</tr>
 +
</table>
 +
<br>
<center>
<center>
-
<input value="      Get your Binding Site!      " type="button" onclick="SBS(seqIn)">
+
<input value="      Generate your Binding Site!      " type="button" onclick="SBS(seqIn)">
-
</center>
+
</center>
-
<br>
+
</div>
</div>
</form>
</form>
-
<br>
 
</body>
</body>
-
<script type="text/javascript" src="http://2010.igem.org/wiki/images/2/24/Final_code_miBS_HD2010.txt"> </script>
+
<script type="text/javascript" src="http://2010.igem.org/wiki/images/3/3a/Very_final_code_miBS_HD2010.txt"> </script>
</html>
</html>
{{:Team:Heidelberg/Pagemiddle}}
{{:Team:Heidelberg/Pagemiddle}}
<html>
<html>
-
<div class="wrapper"><br>
+
<div class="wrapper">
-
<span style="font-family: Arial; color: #11526f; font-size: 18.0px; font-weight: bold;">
+
-
Construction of microRNA binding sites </span>
+
-
<br><br>
+
<img style="border-width: 0px;" src="http://2010.igem.org/wiki/images/c/c0/MiBSdesigner.png" width="260" height="147" />
<img style="border-width: 0px;" src="http://2010.igem.org/wiki/images/c/c0/MiBSdesigner.png" width="260" height="147" />
<br><br>
<br><br>
-
<br><br><br>
 
<div class="reswrap2" id="resultdiv">
<div class="reswrap2" id="resultdiv">
<div class="variaresult">Name of primer 1</div>
<div class="variaresult">Name of primer 1</div>

Latest revision as of 13:40, 27 October 2010

BS designer for miRNA
Construction of microRNA binding sites

Sequence name

microRNA Sequence ( 5' -> 3')

Spacer (inert sequence)


Perfect Binding Site
Imperfect Binding Site with 4 nt bulge (9-12)
Personalized Binding Site

Seed sequence (1-8)              ?
Customized MISMATCH position
Supplementary region        ?
Customized MATCH positions
Modify AU content                ?
A in position -1
A in position 1
A in position 9
A in position 0
A in position 8
A in position 10
Sticky ends for integration into plasmid   ?
Customized:
5'  
3'  



Name of primer 1


Sequence of primer 1


Name of primer 2


Sequence of primer 2