

(Difference between revisions)
(28 intermediate revisions not shown)
Line 1: Line 1:
<!--<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "">-->
<!--<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "">-->
Line 7: Line 7:
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
<style type="text/css">
<style type="text/css">
div.wrapper {width: 260px; height: 600px; border-width:3px; margin:auto; border-style:solid; border-color:#11526f;  text-align:center;}
.wrapper {width: 260px; text-align:center;}
div.wrapper2 {padding:25px; border-width:3px; margin:auto; border-style:solid; border-color:#11526f; height: 650px; text-align:left; }
.wrapper2 {margin:auto; height: 700px; text-align:left; }
div.title {text-indent:30px;}
.title {padding-left:0px; line-height:2; font-weight:bold; font-size:17px;}
div.option {text-indent:50px; white-space:pre-wrap;}
.option {padding-left:10px; white-space:pre-wrap;}
div.optionl {text-indent:50px; white-space:pre-wrap; float:left;}
.optionl {padding-left:10px; white-space:pre-wrap; float:left; font-size:15px;}
div.optionr {display:inline; white-space:pre-wrap; margin-right: 45px; float:right;}
.optionr {display:inline; white-space:pre-wrap; margin-right: 45px; float:right; font-size:15px;}
div.suboption {text-indent:80px;}
.suboption {padding-left:20px; font-size:15px;}
div.clear {clear: both;}
.clear {clear: both;}
div.reswrap2 {width: 270px; margin:auto; text-align:left; display:none; font-size:12pt;}
.reswrap2 {padding:5px; width: 240px; margin:auto; text-align:left; display:none; font-size:12pt;}
.variaresult {font-size: 12pt; color: #11526f; font-weight: bold;}
.variaresult {font-size: 16px; color: #11526f; font-weight: bold;}
.largetext {font-size: 17px;}
td {vertical-align:top;}
Line 23: Line 25:
<div class="wrapper2">
<div class="wrapper2">
<span style="font-size: 17.0px;">Sequence name </span>
<div class="t1">
Construction of microRNA binding sites </div><br>
<div style="width:350px; text-align:right;"><span class="help"><a href="" target="_blank" title="Input help">?</a><span></div>
<div class="largetext" style="width:450px;">
Sequence name<br>
<input type="text" name="name" id="name" size="40" value="hsa-miR122"/><br>
<input type="text" name="name" id="name" size="40" value="hsa-miR122"/><br>
<span style="font-size: 17.0px;">microRNA Sequence ( 5' -> 3')</span><br>
microRNA Sequence ( 5' -> 3')<br>
<input type="text" name="mir" id="mir" size="40" value="UCAGUUUACUAGUGCCAUUUGU"/><br>
<input type="text" name="mir" id="mir" size="40" value="UCAGUUUACUAGUGCCAUUUGU"/><br>
<span style="font-size: 17.0px;">
Spacer (inert sequence)<br>
Spacer (inert sequence) </span><br>
<input type="text" name="spacer" id="spacer" size="40" value="TTATATTTTATGACA"/>
<input type="text" name="spacer" id="spacer" size="40" value="TTATATTTTATGACA"/></center>
<div class="largetext" style="width:400px;">
<input name="quality" value="perfect" onchange="chMd()" checked="checked" type="radio">
<input name="quality" value="perfect" onchange="chMd()" checked="checked" type="radio">
<span style="font-size: 17.0px;">
Perfect Binding Site <br>
Perfect Binding Site </span>
<input name="quality" value="bulge" onchange="chMd()" type="radio">
<input name="quality" value="bulge" onchange="chMd()" type="radio">
<span style="font-size: 17.0px;">
Imperfect Binding Site with 4 nt bulge (9-12)<br>
Imperfect Binding Site with 4 nt bulge (9-12) </span>
<input name="quality" value="personal" onchange="chMd()" type="radio">
<input name="quality" value="personal" onchange="chMd()" type="radio">
<span style="font-size: 17.0px;">
Personalized Binding Site  
Personalized Binding Site </span>
<div class="title">
<tr height=120px>
<span style="font-size: 17.0px; text-decoration: underline;">
<td width=290px>
Seed sequence (1-8) </span></div>
<div class="title">
<div class="option"><SELECT name="seed" onchange="chMd1()" disabled="disabled">
Seed sequence (1-8) &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <span class="help"><a href="" target="_blank" title="Seed sequence help">?</a></span>
<OPTION value="6mer">6mer                (2-7 paired)
<OPTION value="7merA1">7merA1          (1-7 paired)
<div class="option"><SELECT name="seed" onchange="chMd1()" disabled="disabled">
<OPTION value="7merm8">7merm8          (2-8 paired)
<OPTION value="0">
<OPTION value="8mer">8mer                (1-8 paired)
<OPTION value="6mer">6mer                (2-7 paired)
<OPTION value="custom">Custom
<OPTION value="7merA1">7merA1          (1-7 paired)
<OPTION value="7merm8">7merm8          (2-8 paired)
<div class="suboption">
<OPTION value="8mer">8mer                (1-8 paired)
<span style="font-size: 15.0px;"> Customized </span>
<OPTION value="custom">Custom
<span style="color: #11526f; font-size: 15.0px; font-weight: bold; ">MISMATCH </span>
<span style="font-size: 15.0px;">position</span></div>
<div class="suboption">
<div class="suboption">
Customized <span style="color:#11526f; font-weight:bold;">MISMATCH</span> position
<input type="text" id="mis" size="30" disabled="disabled" value="2"/>
<input type="text" id="mis" size="29" disabled="disabled" value="2"/>
<div class="title">
<span style="font-size: 17.0px; text-decoration: underline;">
<div class="title">
Supplementary region </span></div>
Supplementary region &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <span class="help"><a href="" title="Supplementary region help" target="_blank">?</a></span></div>
<div class="option"><SELECT name="comp" onchange="chMd2()" disabled="disabled">
<div class="option"><SELECT name="comp" onchange="chMd2()" disabled="disabled">
<OPTION value="3">3                  (14-16 paired)
<OPTION value="0">
<OPTION value="4">4                  (13-16 paired)
<OPTION value="3">3                  (14-16 paired)
<OPTION value="5">5                  (13-17 paired)
<OPTION value="4">4                  (13-16 paired)
<OPTION value="6">6                  (13-18 paired)
<OPTION value="5">5                  (13-17 paired)
<OPTION value="7">7                  (13-19 paired)
<OPTION value="6">6                  (13-18 paired)
<OPTION value="8">8                  (13-20 paired)
<OPTION value="7">7                  (13-19 paired)
<OPTION value="total">Total            (13-22 paired)
<OPTION value="8">8                  (13-20 paired)
<OPTION value="custom">Custom  
<OPTION value="total">Total            (13-22 paired)
<OPTION value="custom">Custom  
<div class="suboption">
<span style="font-size: 15.0px;"> Customized </span>
<div class="suboption">
<span style="color: #11526f; font-size: 15.0px; font-weight: bold; ">MATCH </span>
Customized <span style="color: #11526f; font-weight:bold;">MATCH</span> positions
<span style="font-size: 15.0px;">positions (input numbers from 9 to 22)</span></div>
<input type="text" id="match" size="29" disabled="disabled" value="10, 15, 16, 17, 18, 19, 20"/>
<div class="suboption">
<input type="text" id="match" size="30" disabled="disabled" value="10, 15, 16, 17, 18, 19, 20"/></div>
<div class="title">
<span style="font-size: 17.0px; text-decoration: underline;">
<div class="title">
Modify AU content </span>
Modify AU content &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <span class="help"><a href="" target="_blank" title="AU help">?</a></span></div>
<table style="line-height:2; font-size:12px;">
<div class="optionl"><input name="AU" value="-1" type="checkbox"><span style="font-size: 15.0px;">A in position -1</span></div>
<div class="optionr"><input name="AU" value="0" type="checkbox"><span style="font-size: 15.0px;">A in position </span></div>
<td width=130px>
<div class="clear">
<input name="AU" value="-1" type="checkbox">A in position -1<br>
<div class="optionl"><input name="AU" value="1" disabled="disabled" type="checkbox"><span style="font-size: 15.0px;">A in position 1</span></div>
<input name="AU" value="1" disabled="disabled" type="checkbox">A in position 1<br>
<div class="optionr"><input name="AU" value="8" disabled="disabled" type="checkbox"><span style="font-size: 15.0px;">A in position </span></div></div>
<input name="AU" value="9" disabled="disabled" type="checkbox">A in position 9<br>
<div class="clear">
<div class="optionl"><input name="AU" value="9" disabled="disabled" type="checkbox"><span style="font-size: 15.0px;">A in position 9</span></div>
<div class="optionr"><input name="AU" value="10" disabled="disabled" type="checkbox"><span style="font-size: 15.0px;">A in position 10</span></div></div><br>
<input name="AU" value="0" type="checkbox">A in position 0<br>
<input name="AU" value="8" disabled="disabled" type="checkbox">A in position 8<br>
<div class="title"><span style="font-size: 17.0px; text-decoration: underline;">Sticky ends for integration in plasmid: </span></div>
<input name="AU" value="10" disabled="disabled" type="checkbox">A in position 10<br>
<div class="option">   <SELECT id="stickyends" name="stickyends" onchange="chMd3()">
<div class="title">Sticky ends for integration into plasmid &nbsp; <span class="help"><a href=" target="_blank" title="ends help"">?</a></span></div></div>
<div class="option"><SELECT id="stickyends" name="stickyends" onchange="chMd3()">
<OPTION SELECTED value="none">None
<OPTION SELECTED value="none">None
<OPTION value="BBB">Biobricks Standard RFC-12
<OPTION value="BBB">Biobricks Standard RFC-12
Line 104: Line 111:
<OPTION value="custom">Custom sequence
<OPTION value="custom">Custom sequence
<div class="option"><span style="font-size: 15.0px;">     Customized:    5'</span><input type="text" id="end5" size="15" disabled="disabled"/>         <span style="font-size: 15.0px;">3'</span><input type="text" id="end3" size="15" disabled="disabled"/>
<div class="suboption">Customized:<br>
5'&nbsp;&nbsp;<input type="text" id="end5" size="15" disabled="disabled"/><br>
3'&nbsp;&nbsp;<input type="text" id="end3" size="15" disabled="disabled"/>
<input value="      Get your Binding Site!      " type="button" onclick="SBS(seqIn)">
<input value="      Generate your Binding Site!      " type="button" onclick="SBS(seqIn)">
<script type="text/javascript" src=""> </script>
<script type="text/javascript" src=""> </script>
<div class="wrapper"><br>
<div class="wrapper">
<span style="font-family: Arial; color: #11526f; font-size: 18.0px; font-weight: bold;">
Construction of microRNA binding sites </span>
<img style="border-width: 0px;" src="" width="260" height="147" />
<img style="border-width: 0px;" src="" width="260" height="147" />
<div class="reswrap2" id="resultdiv">
<div class="reswrap2" id="resultdiv">
<div class="variaresult">Name of primer 1</div>
<div class="variaresult">Name of primer 1</div>
<textarea name="NamA" cols=30 rows=1 id="NamA" wrap=SOFT></textarea><br><br>
<textarea name="NamA" cols=25 rows=1 id="NamA" wrap=SOFT></textarea><br><br>
<div class="variaresult">Sequence of primer 1</div>
<div class="variaresult">Sequence of primer 1</div>
<textarea name="seqA" cols=30 rows=3 id="seqA" wrap=SOFT></textarea><br><br>
<textarea name="seqA" cols=25 rows=3 id="seqA" wrap=SOFT></textarea><br><br>
<div class="variaresult">Name of primer 2</div>
<div class="variaresult">Name of primer 2</div>
<textarea name="NamB" cols=30 rows=1 id="NamB" wrap=SOFT></textarea><br><br>
<textarea name="NamB" cols=25 rows=1 id="NamB" wrap=SOFT></textarea><br><br>
<div class="variaresult">Sequence of primer 2</div>
<div class="variaresult">Sequence of primer 2</div>
<textarea name="seqB" cols=30 rows=3 id="seqB" wrap=SOFT></textarea><br>
<textarea name="seqB" cols=25 rows=3 id="seqB" wrap=SOFT></textarea><br>

Latest revision as of 13:40, 27 October 2010

BS designer for miRNA
Construction of microRNA binding sites

Sequence name

microRNA Sequence ( 5' -> 3')

Spacer (inert sequence)

Perfect Binding Site
Imperfect Binding Site with 4 nt bulge (9-12)
Personalized Binding Site

Seed sequence (1-8)              ?
Customized MISMATCH position
Supplementary region        ?
Customized MATCH positions
Modify AU content                ?
A in position -1
A in position 1
A in position 9
A in position 0
A in position 8
A in position 10
Sticky ends for integration into plasmid   ?

Name of primer 1

Sequence of primer 1

Name of primer 2

Sequence of primer 2