Revision history of "Team:Harvard/pENTCUP2 BB R"

From 2010.igem.org

Diff selection: mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.

Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
  • (cur | prev) 07:59, 25 October 2010 Mtheilmann (Talk | contribs) (265 bytes) (New page: {{Harvard_flavor}} <html> <div id="maincontent"> <div id="abstract"> <h1>pENTCUP2_BB_R Sequence</h1> AAGGCTGCAGCGGCCGCTACTAGTTCCGGTGGGTTTTGAGGT <br/><br/> <a href="https://2010.igem.org...)
Retrieved from "http://2010.igem.org/Team:Harvard/pENTCUP2_BB_R"