

(Difference between revisions)
(New page: {{Harvard_vector}} <html> <div id="maincontent"> <div id="abstract"> <h1>VP25 Sequence</h1> <br /><br /> <a href="">back to parts and pri...)
Line 8: Line 8:
<h1>VP25 Sequence</h1>
<h1>VP25 Sequence</h1>
<br /><br />
gcgatcgctgaagttcctat<br /><br />
<a href="">back to parts and primers</a>
<a href="">back to parts and primers</a>

Latest revision as of 22:08, 24 October 2010