Team:Harvard/F6

From 2010.igem.org

(Difference between revisions)
(New page: ATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCAAACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTATGATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTATACTAGAGCAACTAGCGGCATGGT...)
 
Line 1: Line 1:
-
ATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCAAACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTATGATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTATACTAGAGCAACTAGCGGCATGGTTAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTTTAGTTGAACTAGATGGCGACGTGAACGGTCATAAGTTCAGTGTCTCCGGCGAAGGTGAGGGTGATGCAACGTACGGTAAGTTAACTTTGAAGTTAATATGTACAACCGGCAAGCTGCCTGTTCCCTGGCCTACCCTGGTGACAACGTTAGGTTATGGGTTGATGTGCTTTGCTAGATACCCAGATCACATGAAAAGGCATGACTTCTTTAAATCTGCAATGCCAGAAGGTTACGTCCAAGAACGTACTATTTTCTTTAAAGATGACGGTAATTATAAAACTAGGGCTGAAGTTAAATTCGAAGGTGACACACTTGTAAATCGAATAGAGTTAAAGGGGATTGATTTCAAAGAGGATGGTAATATTCTAGGCCATAAACTTGAATATAACTATAATTCACACAACGTTTACATTACCGCCGACAAGCAGAAGAATGGAATCAAAGCCAATTTTAAGATTAGACACAATATTGAGGATGGTGGAGTACAGCTTGCTGATCATTACCAACAAAATACCCCGATCGGTGATGGACCAGTTTTGCTACCCGATAACCATTATCTGTCCTATCAAAGCAAATTGTCAAAAGATCCTAACGAAAAAAGAGACCACATGGTACTCTTGGAATTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAAGGTTCTGGTACCGCAACTAGAGCAACTAGCGGCATGGTTAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTTTAGTTGAACTAGATGGCGACGTGAACGGTCATAAGTTCAGTGTCTCCGGCGAAGGTGAGGGTGATGCAACGTACGGTAAGTTAACTTTGAAGTTAATATGTACAACCGGCAAGCTGCCTGTTCCCTGGCCTACCCTGGTGACAACGTTAGGTTATGGGTTGATGTGCTTTGCTAGATACCCAGATCACATGAAAAGGCATGACTTCTTTAAATCTGCAATGCCAGAAGGTTACGTCCAAGAACGTACTATTTTCTTTAAAGATGACGGTAATTATAAAACTAGGGCTGAAGTTAAATTCGAAGGTGACACACTTGTAAATCGAATAGAGTTAAAGGGGATTGATTTCAAAGAGGATGGTAATATTCTAGGCCATAAACTTGAATATAACTATAATTCACACAACGTTTACATTACCGCCGACAAGCAGAAGAATGGAATCAAAGCCAATTTTAAGATTAGACACAATATTGAGGATGGTGGAGTACAGCTTGCTGATCATTACCAACAAAATACCCCGATCGGTGATGGACCAGTTTTGCTACCCGATAACCATTATCTGTCCTATCAAAGCAAATTGTCAAAAGATCCTAACGAAAAAAGAGACCACATGGTACTCTTGGAATTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAAGGTTCTGGTACCGCA
+
{{Harvard_flavor}}
 +
 
 +
 
 +
<html>
 +
 
 +
<div id="maincontent">
 +
<div id="abstract">
 +
<h1>F6 Sequence</h1>
 +
 
 +
ATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCA
 +
AACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTAT
 +
GATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTATACTAGAGCAACTAGC
 +
GGCATGGTTAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTTTAGTTGAACTA
 +
GATGGCGACGTGAACGGTCATAAGTTCAGTGTCTCCGGCGAAGGTGAGGGTGATGCAAC
 +
GTACGGTAAGTTAACTTTGAAGTTAATATGTACAACCGGCAAGCTGCCTGTTCCCTGGCC
 +
TACCCTGGTGACAACGTTAGGTTATGGGTTGATGTGCTTTGCTAGATACCCAGATCACAT
 +
GAAAAGGCATGACTTCTTTAAATCTGCAATGCCAGAAGGTTACGTCCAAGAACGTACTAT
 +
TTTCTTTAAAGATGACGGTAATTATAAAACTAGGGCTGAAGTTAAATTCGAAGGTGACAC
 +
ACTTGTAAATCGAATAGAGTTAAAGGGGATTGATTTCAAAGAGGATGGTAATATTCTAGG
 +
CCATAAACTTGAATATAACTATAATTCACACAACGTTTACATTACCGCCGACAAGCAGAA
 +
GAATGGAATCAAAGCCAATTTTAAGATTAGACACAATATTGAGGATGGTGGAGTACAGCT
 +
TGCTGATCATTACCAACAAAATACCCCGATCGGTGATGGACCAGTTTTGCTACCCGATAA
 +
CCATTATCTGTCCTATCAAAGCAAATTGTCAAAAGATCCTAACGAAAAAAGAGACCACAT
 +
GGTACTCTTGGAATTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAA
 +
AGGTTCTGGTACCGCAACTAGAGCAACTAGCGGCATGGTTAGTAAAGGAGAAGAACTTTT
 +
CACTGGAGTTGTCCCAATTTTAGTTGAACTAGATGGCGACGTGAACGGTCATAAGTTCAG
 +
TGTCTCCGGCGAAGGTGAGGGTGATGCAACGTACGGTAAGTTAACTTTGAAGTTAATATG
 +
TACAACCGGCAAGCTGCCTGTTCCCTGGCCTACCCTGGTGACAACGTTAGGTTATGGGTT
 +
GATGTGCTTTGCTAGATACCCAGATCACATGAAAAGGCATGACTTCTTTAAATCTGCAAT
 +
GCCAGAAGGTTACGTCCAAGAACGTACTATTTTCTTTAAAGATGACGGTAATTATAAAAC
 +
TAGGGCTGAAGTTAAATTCGAAGGTGACACACTTGTAAATCGAATAGAGTTAAAGGGGAT
 +
TGATTTCAAAGAGGATGGTAATATTCTAGGCCATAAACTTGAATATAACTATAATTCACAC
 +
AACGTTTACATTACCGCCGACAAGCAGAAGAATGGAATCAAAGCCAATTTTAAGATTAGA
 +
CACAATATTGAGGATGGTGGAGTACAGCTTGCTGATCATTACCAACAAAATACCCCGATC
 +
GGTGATGGACCAGTTTTGCTACCCGATAACCATTATCTGTCCTATCAAAGCAAATTGTCA
 +
AAAGATCCTAACGAAAAAAGAGACCACATGGTACTCTTGGAATTTGTAACAGCTGCTGGG
 +
ATTACACATGGCATGGATGAACTATACAAAGGTTCTGGTACCGCA
 +
 
 +
<br/><br/>
 +
<a href="http://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a>
 +
 
 +
</div>
 +
</div>
 +
 
 +
 
 +
</html>

Latest revision as of 15:12, 26 October 2010



F6 Sequence

ATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCA AACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTAT GATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTATACTAGAGCAACTAGC GGCATGGTTAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTTTAGTTGAACTA GATGGCGACGTGAACGGTCATAAGTTCAGTGTCTCCGGCGAAGGTGAGGGTGATGCAAC GTACGGTAAGTTAACTTTGAAGTTAATATGTACAACCGGCAAGCTGCCTGTTCCCTGGCC TACCCTGGTGACAACGTTAGGTTATGGGTTGATGTGCTTTGCTAGATACCCAGATCACAT GAAAAGGCATGACTTCTTTAAATCTGCAATGCCAGAAGGTTACGTCCAAGAACGTACTAT TTTCTTTAAAGATGACGGTAATTATAAAACTAGGGCTGAAGTTAAATTCGAAGGTGACAC ACTTGTAAATCGAATAGAGTTAAAGGGGATTGATTTCAAAGAGGATGGTAATATTCTAGG CCATAAACTTGAATATAACTATAATTCACACAACGTTTACATTACCGCCGACAAGCAGAA GAATGGAATCAAAGCCAATTTTAAGATTAGACACAATATTGAGGATGGTGGAGTACAGCT TGCTGATCATTACCAACAAAATACCCCGATCGGTGATGGACCAGTTTTGCTACCCGATAA CCATTATCTGTCCTATCAAAGCAAATTGTCAAAAGATCCTAACGAAAAAAGAGACCACAT GGTACTCTTGGAATTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAA AGGTTCTGGTACCGCAACTAGAGCAACTAGCGGCATGGTTAGTAAAGGAGAAGAACTTTT CACTGGAGTTGTCCCAATTTTAGTTGAACTAGATGGCGACGTGAACGGTCATAAGTTCAG TGTCTCCGGCGAAGGTGAGGGTGATGCAACGTACGGTAAGTTAACTTTGAAGTTAATATG TACAACCGGCAAGCTGCCTGTTCCCTGGCCTACCCTGGTGACAACGTTAGGTTATGGGTT GATGTGCTTTGCTAGATACCCAGATCACATGAAAAGGCATGACTTCTTTAAATCTGCAAT GCCAGAAGGTTACGTCCAAGAACGTACTATTTTCTTTAAAGATGACGGTAATTATAAAAC TAGGGCTGAAGTTAAATTCGAAGGTGACACACTTGTAAATCGAATAGAGTTAAAGGGGAT TGATTTCAAAGAGGATGGTAATATTCTAGGCCATAAACTTGAATATAACTATAATTCACAC AACGTTTACATTACCGCCGACAAGCAGAAGAATGGAATCAAAGCCAATTTTAAGATTAGA CACAATATTGAGGATGGTGGAGTACAGCTTGCTGATCATTACCAACAAAATACCCCGATC GGTGATGGACCAGTTTTGCTACCCGATAACCATTATCTGTCCTATCAAAGCAAATTGTCA AAAGATCCTAACGAAAAAAGAGACCACATGGTACTCTTGGAATTTGTAACAGCTGCTGGG ATTACACATGGCATGGATGAACTATACAAAGGTTCTGGTACCGCA

back to flavor parts