Team:HKUST/Project/Background

From 2010.igem.org

(Difference between revisions)
Line 3: Line 3:
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<title>Team: HKUST</title>
<title>Team: HKUST</title>
-
<script type="text/javascript" src="http://ihome.ust.hk/~lzhu/website/mootools.js"></script>
 
-
<script type="text/javascript" src="http://ihome.ust.hk/~lzhu/website/mooefx.js"></script>
 
<link href="http://ihome.ust.hk/~lzhu/website/style.css" rel="stylesheet" type="text/css" />
<link href="http://ihome.ust.hk/~lzhu/website/style.css" rel="stylesheet" type="text/css" />
Line 15: Line 13:
</div>
</div>
-
<div id="body_content_project">
+
<div id="body_content_material">
<div id="sidebar">
<div id="sidebar">
<ul>
<ul>
Line 38: Line 36:
</div>
</div>
-
<!--background begin-->
 
<div id="module_1">
<div id="module_1">
-
<p class="h1"><b>Background</b></p>
 
-
<p class="h2"><b>
 
-
<a href="#1">1. <em>Staphylococcus aureus</em></a><br />
 
-
<a href="#2">2. Two-Component Signaling System (TCS)</a> <br />
 
-
<a href="#3">3. <em>Staphylococcus aureus</em> virulence regulating mechanism: AgrBDCA</a><br />
 
-
<a href="#4">4. <em>Lactobacillus plantarum</em> WCFS1 quorum sensing system: PlnABCD</a><br />
 
-
<a href="#5">5. RNAIII inhibiting peptide (RIP) of <em>Staphylococcus aureus</em></a><br />
 
-
</b></p>
 
 +
<p class="h2">
 +
<b><a href="#1">1.Vectors and bacterial strains</a></b><br />
 +
<b><a href="#2">2.Building of chimeric constructs</a></b><br />
 +
<b><a href="#3">3.GUS reporter assay</a></b><br />
 +
<b><a href="#4">4.Protocol list</a></b></p>
-
<p class="h2"><b><a name="1">1. <em>Staphylococcus aureus</em></a></b></p>
+
<!--part1-->
 +
<p class="h2"><a name="1"></a><b>1.Vectors and bacterial strains</b></p>
-
<p class="content"><em>Staphylococcus aureus</em> is a facultatively anaerobic, gram-positive coccus which forms large round yellow colonies when grown on agar  plate [<a href="#r1">1</a>]. It was reported that approximately 20% of human population are  long-term carriers of at least one <em>S. aureus</em> strain [<a href="#r2">2</a>]. As a versatile and potential dangerous pathogen, <em>S. aureus</em> can cause a wide range of  diseases varying from skin flora infections to invasive infections such as  sepsis syndrome [<a href="#r1">1</a>, <a href="#r3">3</a>]. Many of these diseases are associated with regulation  factors involved in toxin synthesis in <em>S. aureus</em>. These bacterial regulation factors play critical roles in virulence  production; the strains that are defective in producing toxin regulation  factors always show weakened virulence [<a href="#r4">4</a>]. The aforementioned information  suggests a novel therapy, which involves the inhibition of toxin regulation factors,  for diseases caused by <em>S. aureus</em>.</p>
+
<p class="content">The bacterial  strains and vectors used in iGEM HKUST 2010 are listed in Table 1 below. <em>E. coli</em> DH10B and DH5α cells are prepared as chemically competent cells and used for transformation. The <em>E. coli</em> cells are plated on antibiotic-containing agar plate and incubated at 37C overnight. <em>L. plantarum</em> WCFS1 used in our project  are grown in MRS medium at 30C <strong>[<a href="#r1">1</a>]</strong>. The  antibiotic concentration we used are listed as follow: ampicillin (150μg/ml for <em>E. coli</em>), kanamycin (50μg/ml for <em>E. coli</em>), chloramphenicol (35μg/ml for <em>E. coli</em>), erythromycin (200μg/ml for <em>E. coli</em>, 10μg/ml for <em>L. plantarum</em>). </p>
 +
<table border="1" cellspacing="0" cellpadding="2px" background="http://ihome.ust.hk/~lzhu/website/bg.jpg">
 +
  <tr>
 +
    <td colspan="3" valign="middle"><p align="center"><strong>Table    1. Bacterial Strains and Vectors</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td colspan="3" valign="middle"><p align="center">&nbsp;</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center"><strong>Strains</strong></p></td>
 +
    <td width="346" valign="middle"><p align="center"><strong>Description</strong></p></td>
 +
    <td width="116" valign="middle"><p align="center"><strong>Source</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center"><em>E.coli </em>DH10B</p></td>
 +
    <td width="346" valign="middle"><p align="center">F-&nbsp;endA1 glnV44 thi-1 recA1    relA1 gyrA96 deoR nupG Φ80d<em>lacZ</em>ΔM15 Δ(<em>lacZYA-argF</em>)U169,    hsdR17(rK-&nbsp;mK+),    λ–; used for subcloning </p></td>
 +
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center"><em>E.coli</em> DH5<em>α</em></p></td>
 +
    <td width="346" valign="middle"><p align="center">F-&nbsp;endA1 recA1 galE15 galK16    nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,leu)7697 mcrA Δ(mrr-hsdRMS-mcrBC)    λ-; used for subcloning </p></td>
 +
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center"><em>L. plantarum</em> WCFS1</p></td>
 +
    <td width="346" valign="middle"><p align="center">Wild type; used    for device characterization</p></td>
 +
    <td width="116" valign="middle"><p align="center"><strong>[<a href="#r2">2</a>]</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">Non-virulent <em>S.    aureus</em></p></td>
 +
    <td width="346" valign="middle"><p align="center">Used for device    characterization</p></td>
 +
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td colspan="3" valign="middle"><p align="center"><strong>&nbsp;</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center"><strong>Vectors</strong></p></td>
 +
    <td width="346" valign="middle"><p align="center"><strong>Description</strong></p></td>
 +
    <td width="116" valign="middle"><p align="center"><strong>Source</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">pBluescript KSII (+)</p></td>
 +
    <td width="346" valign="middle"><p align="center"><em>E. coli</em> cloning vector containing T3 promoter, T7 promoter, lacZ gene with    multiple cloning site inside; Ampr</p></td>
 +
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">pBluescript SKII (+)</p></td>
 +
    <td width="346" valign="middle"><p align="center"><em>E. coli</em> cloning vector containing T3 promoter, T7 promoter, lacZ gene with    multiple cloning site inside. Multiple cloning site inverted; Ampr</p></td>
 +
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">pMG36e</p></td>
 +
    <td width="346" valign="middle"><p align="center">Shuttle vector    contain P32 constitutive promoter; Emr</p></td>
 +
    <td width="116" valign="middle"><p align="center">Yrbio Company </p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">PBI121</p></td>
 +
    <td width="346" valign="middle"><p align="center">Containing gusA    reporter gene; Kmr</p></td>
 +
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">PMH4</p></td>
 +
    <td width="346" valign="middle"><p align="center">Containing    mCherry fluorescent gene; Ampr</p></td>
 +
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">pRN9232</p></td>
 +
    <td width="346" valign="middle"><p align="center">Containing    agrC-I; Ampr</p></td>
 +
    <td width="116" valign="middle"><p align="center"><strong>[<a href="#r3">3</a>]</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">pRN9233</p></td>
 +
    <td width="346" valign="middle"><p align="center">Containing    agrC-IV; Ampr</p></td>
 +
    <td width="116" valign="middle"><p align="center"><strong>[<a href="#r3">3</a>]</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">pRN6683</p></td>
 +
    <td width="346" valign="middle"><p align="center">P3-blaZ fusion,    for device characterization; Methr</p></td>
 +
    <td width="116" valign="middle"><p align="center"><strong>[<a href="#r4">4</a>]</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">BBa_I746101</p></td>
 +
    <td width="346" valign="middle"><p align="center">Containing    agrC-1; Kmr</p></td>
 +
    <td width="116" valign="middle"><p align="center">iGEM 2010    BioBrick distribution<strong></strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="122" valign="middle"><p align="center">BBa_J04450</p></td>
 +
    <td width="346" valign="middle"><p align="center">Containing RFP    reporter gene; Ampr</p></td>
 +
    <td width="116" valign="middle"><p align="center">iGEM 2010    BioBrick distribution<strong></strong></p></td>
 +
  </tr>
 +
</table>
-
<p class="h2"><b><a name="2">2. Localization Test of Chimeric AIP Receptor</a></p>
+
<p class="h2"><b><a name="2"></a>Building of chimeric constructs</b></p>
-
<p class="content">In many bacterial species, Two-Component Signaling System (TCS) plays a prominent role in quorum sensing. A classical TCS consists of a transmembrane receptor, which is a histidine protein kinase (HPK), and a cytoplasmic response regulator (RR) [<a href="#r5">5</a>]. When bound by autoinducing peptides (AIP), the transmembrane receptor HPK passes a phosphate group to the downstream cytoplasmic response regulator RR. The cytoplasmic response regulator will then up-regulates or down-regulates various virulence and bacteriocin productions under specific situations [<a href="#r6">6</a>]. Figure 1 below illustrates the components and transduction pathways of a typical two-component signaling system:
+
<p class="h2"><b>1) Construction of chimeric sensor agrC-plnB in pBluescript and pMG36e</b></p>
-
<br />
+
-
<br/>
+
-
<div id="figure"><img align="middle" src="http://ihome.ust.hk/~lzhu/website/figures/background/fig-1.jpg" width="700" /></div>
+
-
</p>
+
-
<p class="h2"><b><a name="3">3. <em>Staphylococcus aureus</em> virulence regulating mechanism: AgrBDCA</a></b></p>
+
<p class="content">By PCR amplification  of Biobrick BBa_I746101, the trans-membrane signal sensing domain agrC with 8 base  pair-overhang of the cytoplasmic HPK domain of plnB was obtained. The cytoplasmic HPK domain of plnB with an overhang  of agrC was also obtained by PCR amplification from extracted <em>L. plantarum</em> WCFS1 genomic DNA. Next,  fusion PCR of two gene fragments was conducted and the desired fusion gene  agrC-plnB obtained. After SacI and KpnI double digestion, aforementioned  agrC-plnB fusion gene was ligated into pBluescript KSII (+). The cloning vector  was transformed into <em>E. coli</em> DH10B.  In subsequent steps, the construct agrC-plnB was taken out from pBluescript KSII  (+) by SacI and KpnI double digestion, and ligated into <em>E. coli</em> – <em>Lactobacillus</em> shuttle  vector pMG36e. The parts were confirmed by DNA sequencing.</p>
 +
<p class="h2"><b>2) Construction  of agrC-mCherry and agrC-plnB-mCherry in pBluescript and pMG36e</b></p>
-
<p class="content">A chromosomal locus <em>agr</em> system in <em>S. aureus</em> consists of two transcription units RNA II and RNA III; they are responsible for self-regulation and effect response respectively [<a href="#r7">7</a>, <a href="#r8">8</a>]. RNA II, driven by P2 promoter, is a polycistronic mRNA  containing four open reading frames: <em>agrB</em>, <em>agrD</em>, <em>agrC</em> and <em>agrA</em>, and are responsible for <em>agr</em> quorum sensing in <em>S. aureus</em> [<a href="#r9">9</a>]. AgrB is an integral membrane protein; AgrD is a pro-peptide secreted  with the aid of AgrB, yielding an octapeptide pheromone autoinducing peptide (AIP); AgrC and AgrA compose a bacterial two-component signal transduction system, in which AgrC, a membrane associated protein, serves as a receptor and AgrA acts as a DNA-binding response regulator[<a name="10">10</a>,<a href="#r11">11</a>, <a href="#r12">12</a>]. Once the transmembrane receptor domain of AgrC is bound by AIP, its cytoplasmic HPK domain will pass a phosphate group  downwards to AgrA, the response regulator. AgrA functions as a transcription  factor and activates the two promoters P2 and P3 [<a href="#r13">13</a>, <a href="#r11">14</a>]. RNA III, driven by P3 promoter, acts as  a regulatory factor to activate numerous toxin production genes and encode for  β-hemolysin [<a href="#r11">15</a>].<strong> </strong>Figure  2 below shows the pathways involved in <em>S.  aureus</em> AgrBDCA system:
+
<p class="content">After SacI and KpnI double digestion, agrC-mCherry and agrC-plnB-mCherry fusion gene were ligated into pBluescript KSII (+). The cloning vector was transformed into <em>E. coli</em> DH10B. In subsequent steps, the  constructs agrC-mCherry and agrC-plnB-mCherry were taken out from pBluescript KSII (+) by SacI and KpnI double digestion, and ligated into <em>E. coli</em> – <em>Lactobacillus</em> shuttle vector pMG36e. The parts were confirmed by  DNA sequencing.</p>
-
<br />
+
-
 
+
-
  <br/>
+
-
<div id="figure"><img align="middle" src="http://ihome.ust.hk/~lzhu/website/figures/background/fig-2.jpg" width="700" />
+
-
</div>
+
-
</p>
+
-
<p class="content">It  has been reported that there are altogether 4 types of <em>agr</em> loci; each type of <em>agr</em> locus encodes AgrC and corresponding AIP slightly different from others. AgrC is only activated by AIP belonging to the same group and is usually inhibited  by AIP from other groups [<a href="#r16">16</a>]. Different groups of AgrC and their corresponding  AIPs are highly involved in various human diseases or infections. For example,  food poisoning caused by staphylococcal enterotoxins is usually associated with <em>agr</em> group I and <em>agr</em> group II <em>S. aureus</em>;  toxic shock syndrome toxin 1 (TSST-1), which results in high fever, low blood  pressure and malaise of human, is produced by <em>agr</em> group III <em>S. aureus</em> [<a href="#r17">17</a>].</p>
+
<p class="h2"><b>3)Construction of plnA promoter – gusA reporter unit in pBluescript</b></p>
-
<p class="content">The synthesis of  RNAIII is regulated by two <em>Staphylococcal </em>quorum sensing systems SQS 1 and SQS 2. SQS 1 consists of a 277-amino-acid  RNAIII-activating protein (RAP) and a 167-amino-acid target of  RNAIII-activating protein (TRAP) which is membrane associated [<a href="#r15">15</a>]; SQS 2  consists of molecules encoded by <em>agr</em> system [<a href="#r18">18</a>]. As <em>S. aureus</em> multiplies,  RAP is secreted. Once RAP reaches a threshold concentration, it will induce the  histidine phosphorylation of TRAP, which leads to the activation of <em>agr</em> system and therefore induces the  production of RNAII during the mid-exponential growth phase [<a href="#r15">15</a>]. After the  activation of <em>agr</em> system, phosphorylation  of AgrC is induced by secreted AIP, followed by the production of RNAIII [<a href="#r18">18</a>].
+
-
<br />
+
-
 
+
-
<br/>
+
-
<div id="figure"><img align="middle" src="http://ihome.ust.hk/~lzhu/website/figures/background/fig-3.jpg" width="550" />
+
-
</div>
+
-
</p>
+
-
<p class="content">The characteristics of <em>S. aureus</em> AgrBDCA system <strong>aforementioned</strong> make it possible to build an engineered AIP sensor on the membrane of a non-pathogenic bacterial species. The engineered AIP sensor, localized on the non-virulent bacteria, could therefore detect the presence of AIP molecules released by <em>S. aureus</em>. Upon receiving this signal, the non-virulent bacteria could be automatically induced to synthesize AIP’s competitor, RNAIII inhibiting peptide (RIP), and hence, repress the activation  of AgrC and toxin production in <em>S. aureus</em>.</p>
+
<p class="content">The 124-base-pair nucleotide of plnA promoter was obtained by annealing a 79-base-pair forward primer and a 73-base-pair reverse primer. The reporter gene gusA was amplified from PBI121 by PCR. The  gusA gene was then digested and ligated into pBluescript KSII (+). The cloning  vector was transformed into <em>E. coli</em> DH10B. However, we tried several times but still failed to ligate the 124 bp plnA promoter into pBluescript KSII (+).</p>
-
<p class="h2"><b>4. <em>Lactobacillus plantarum</em> WCFS1 quorum sensing system: PlnABCD</b></p>
+
<p class="h2"><b>4)Construction of &ldquo;hybrid signal peptide-flag tag-DD13-RIP&rdquo;</b></p>
-
<p class="content">Several <em>agr</em>-like quorum sensing systems in <em>Lactobacillus  plantarum </em>WCFS1 have been identified, among which the PlnABCD system is the  best studied [<a href="#r5">5</a>]. The PlnABCD system, similar to the AgrBDCA system, is a self-regulating  system in <em>L. plantarum </em>WCFS1. The  transmembrane receptor HPK PlnB, together with two response regulators PlnC and  PlnD, constitutes a two-component signaling system (TCS) in <em>L. plantarum </em>WCFS1. PlnA, the inducing  peptide (IP) of <em>L. plantarum </em>WCFS1,  activates PlnB and thereby phosphoylates PlnC or PlnD. PlnC and PlnD are  upregulator and downreuglater of plnA promoter respectively, and therefore,  would activate/suppress the transcription initiation of plnABCD. The  transcription of plnABCD is usually associated with <em>Lactobacillus plantarum </em>WCFS1 bacteriocin production [<a href="#r19">19</a>]. Figure 3  below shows the pathways involved in <em>Lactobacillus  plantarum </em>WCFS1 PlnABCD system:
+
-
<br />
+
-
 
+
-
<br/>
+
-
<div id="figure"><img align="middle" src="http://ihome.ust.hk/~lzhu/website/figures/background/fig-4.jpg" width="700" />
+
-
</div>
+
-
<p class="content">Transmembrane  signal sensors of both PlnABCD and AgrBDCA systems, i.e. PlnB (of <em>L. plantarum </em>WCFS1) and AgrC (of<em> S. aureus</em>), belong to a same subgroup of histidine protein kinases – the HPK10 subfamily. PlnB and AgrC  share a highly homologous cytoplasmic HPK domain regarding amino acid sequence,  tertiary structure and biochemical function [<a href="#r14">14</a>, <a href="#r19">19</a>]. However, the sequence of  PlnB and AgrC’s transmembrane domain are distinct from each other, probably due to the ligand binding specificity required by their corresponding signaling molecules. </p>
+
<p class="content">Signal peptide,  flag-tag and DD13-RIP were obtained by annealing single-stranded oligonucleotides.  Each fragment was flanked by restriction enzyme cutting sites for subsequent ligation. Construct &ldquo;signal peptide- flag tag- DD13 –RIP&rdquo; was ligated into pBluescript KSII (+). The cloning vector was transformed into <em>E. coli</em> DH10B plasmid amplification. The parts were confirmed by DNA sequencing.</p>
-
<p class="content">Based on the  homology between AgrBDCA and PlnABCD at the cytoplasmic HPK domain, we decided  to construct a chimeric AIP sensor in<em> Lactobacillus</em>.  Such a fusion receptor would link the transmembrane signal sensing domain of AgrCand the cytoplasmic HPK domain of PlnB. By localizing such a fusion protein on <em>Lactobacillus </em>plasma membrane, it is hoped that <em>Lactobacillus </em>can successfully detect the presence of autoinducing peptides (AIPs) produced by <em>S. aureus</em>. Upon the detection of AIP molecules, the chimeric protein kinase will transduce the  signal to <em>L. plantarum </em>WCFS1intrinsic downstream pathways.</p>
+
-
<p class="h2"><b><a name="5">5. RNAIII inhibiting peptide (RIP) of <em>Staphylococcus aureus</em></a></b></p>
+
<table border="1" cellspacing="0" cellpadding="0" background="http://ihome.ust.hk/~lzhu/website/bg.jpg">
 +
  <tr>
 +
    <td colspan="3" valign="middle"><p align="center"><strong>Table    2. Primer List</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" valign="middle"><p align="center"><strong>Construct</strong></p></td>
 +
    <td width="129" valign="middle"><p align="center"><strong>Name</strong></p></td>
 +
    <td width="324" valign="middle"><p><strong>Sequence</strong></p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" rowspan="2" valign="middle"><p align="center">agrC</p>      <p align="center">&nbsp;</p></td>
 +
    <td width="129"><p align="center">agrC  FP</p></td>
 +
    <td width="324" valign="middle"><p>    CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" height="23"><p align="center">agrC  RP</p></td>
 +
    <td width="324" valign="middle"><p>    GACTCGGTACCTCTTTGGATCCTTATTAGTTATTGATG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="324" valign="middle"><p>&nbsp;</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" rowspan="4" valign="middle"><p align="center">agrC-plnB</p></td>
 +
    <td width="129"><p align="center">agrC  FP</p></td>
 +
    <td width="324"><p>    CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129"><p align="center">agrC  RP1</p></td>
 +
    <td width="324"><p>    GTTTCTAACAGGAACTGGCTGATAACGAAAG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129"><p align="center">plnB  FP</p></td>
 +
    <td width="324"><p>    CAGTTCCTGTTAGAAACGATTAGAGTATATGCTTGGC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" height="16"><p align="center">plnB  RP1</p></td>
 +
    <td width="324"><p>    GTCAGGTACCTTATTTATCCTCCGTAACAATTAACG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="324" valign="middle"><p>&nbsp;</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" rowspan="4" valign="middle"><p align="center">agrC-mCherry</p></td>
 +
    <td width="129" valign="bottom"><p align="center">agrC FP</p></td>
 +
    <td width="324" valign="bottom"><p>    CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">agrC RP 2</p></td>
 +
    <td width="324" valign="bottom"><p>    ATTGCGGCGTTATTGATGATTTCGACTTTCTGAATG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">mCherry FP 2</p></td>
 +
    <td width="324" valign="bottom"><p>    ATCAATAACGCCGCAATGGTGAGCAAG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">mCherry RP</p></td>
 +
    <td width="324" valign="bottom"><p    >ATCGTCCCGGGGCTTACTTGTACAGCTCGTCCATG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="324" valign="middle"><p>&nbsp;</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" rowspan="6" valign="middle"><p align="center">agrC-plnB-mCherry</p></td>
 +
    <td width="129" valign="bottom"><p align="center">agrC FP</p></td>
 +
    <td width="324" valign="bottom"><p>    CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">agrC RP 1</p></td>
 +
    <td width="324" valign="bottom"><p>    GTTTCTAACAGGAACTGGCTGATAACGAAAG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">plnB FP</p></td>
 +
    <td width="324" valign="bottom"><p>    CAGTTCCTGTTAGAAACGATTAGAGTATATGCTTGGC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">plnB RP</p></td>
 +
    <td width="324" valign="bottom"><p>    ATTGCGGCTTTATCCTCCGTAACAATTAACGTC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">mCherry FP 1</p></td>
 +
    <td width="324" valign="bottom"><p>    GAGGATAAAGCCGCAATGGTGAGCAAG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">mCherry RP</p></td>
 +
    <td width="324" valign="bottom"><p>    ATCGTCCCGGGGCTTACTTGTACAGCTCGTCCATG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="324" valign="middle"><p>&nbsp;</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" rowspan="4" valign="middle"><p align="center">plnA    promoter-gusA</p></td>
 +
    <td width="129" height="35" valign="middle"><p align="center">plnA promoter synthesis    FP</p></td>
 +
    <td width="324" valign="middle"><p>    GCTGGAATTCTCTAGAATTTCATGGTGATTCACGTTTA<br />
 +
      AATTTAAAAAATG    TACGTTAATAGAAATAATTCCTCCG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="middle"><p align="center">plnA promoter    synthesis RP</p></td>
 +
    <td width="324" valign="middle"><p>    CGTAACATCCCGGGCACCTCGCTTTTAGGATAATGT<br />
 +
      GTTTTTGAAGTACGGAGGAATTATTTCTATTAACG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129"><p align="center">gusA  FP</p></td>
 +
    <td width="324"><p>    GGTGCCCGGGATGTTACGTCCTGTAGAAACCC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" height="30"><p align="center">gusA  RP</p></td>
 +
    <td width="324"><p>    ATACGAATTCGCGGCCGCTTATTGTTTGCCTCCCTGC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
 +
    <td width="324" valign="middle"><p>&nbsp;</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="81" rowspan="10" valign="middle"><p align="center">Signal    peptide-flag tag-DD13 RIP</p></td>
 +
    <td width="129" valign="bottom"><p align="center">F102001</p></td>
 +
    <td width="324" valign="bottom"><p>    CCCGGGAGGAGGCTCGAGATGGACTACAAAGACGAT<br />
 +
      GACGATAAAG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">R102002</p></td>
 +
    <td width="324" valign="bottom"><p>    TCGACTTTATCGTCATCGTCTTTGTAGTCCATCTCGAGC<br />
 +
      CTCCTCCCGGGAGCT</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">F102003</p></td>
 +
    <td width="324" valign="bottom"><p>    TCGACATGGCTCTGTGGAAGACGCTGCTGAAGAAAGT<br />
 +
      TCTGAAGGCTTATTCAC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">R102004</p></td>
 +
    <td width="324" valign="bottom"><p>    CATGGTGAATAAGCCTTCAGAACTTTCTTCAGCAGCGT<br />
 +
      CTTCCACAGAGCCATG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">F102005</p></td>
 +
    <td width="324" valign="bottom"><p>    CATGGACGAATTTTTGAGCGGCCGCGGTAC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">R102006</p></td>
 +
    <td width="324" valign="bottom"><p>    CGCGGCCGCTCAAAAATTCGTC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">F102007</p></td>
 +
    <td width="324" valign="bottom"><p>    CCCGGGGATGGGAGCGACGTTAGATGAAAGAAGTAA<br />
 +
      GGTTTTGGGGACTCTTGTTAGGAC</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">R102008</p></td>
 +
    <td width="324" valign="bottom"><p>    ACAAGAGTCCCCAAAACCTTACTTCTTTCATCTAACGTC<br />
 +
      GCTCCCATCCCCGGGAGCT</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">F102009</p></td>
 +
    <td width="324" valign="bottom"><p>    TGTTTGTCTGTTTAGGGGCAGTGATACCGTTAGTTAGTA<br />
 +
      AGGCTGACGTAG</p></td>
 +
  </tr>
 +
  <tr>
 +
    <td width="129" valign="bottom"><p align="center">R102010</p></td>
 +
    <td width="324" valign="bottom"><p>    TCGACTACGTCAGCCTTACTAACTAACGGTATCACTGCC<br />
 +
      CCTAAACAGACAAACAGTCCTA</p></td>
 +
  </tr>
 +
</table>
 +
<p class="h2"><b>3.GUS reporter assay</b></p>
-
<p class="content">The <em>S. aureus</em> RN833 is a mutant strain of Foggi (now listed as RN831) as it no longer produces α-hemolysin. Instead,  RNAIII inhibiting peptide, an inhibitor of <em>agr</em> system abbreviated as RIP, was discovered and tested in 1993 [20]. Heptapeptide RIP has been proved to be an effective inhibitor to reduce virulence and prevent infections of <em>S. aureus</em> [<a href="#r18">18</a>, <a href="#r21">21</a>]. </p>
+
<p class="content">pMG36e-transformed<em> L. plantarum</em> WCFS1 is cultivated at 30C until its optical density at 600nm (OD600) reaches 0.10-0.20. Cells will then be exposed to autoinducing peptide (AIP) and incubated at 30C for 1-2 hours. GUS substrate para-nitrophenyl-β-D-glucuronic acid will then be added and the reaction mixture incubated at 37C for another 20 minutes. Finally, OD reading at 405nm obtained and GUS activity quantified as OD­­405 / OD600 <strong>[<a href="#r1">1</a>]</strong>. </p>
-
<p class="content">The sequence of RIP was  identified as YSPXTNF, where X can be a Cys, a Trp, or a modified amino acid [<a href="#r18">18</a>]. It is similar to the NH2 terminal sequence of RAP IKKYKPITN  [<a href="#r22">22</a>], the natural ligand of TRAP receptor. Therefore, it is hypothesized that  RAP and RIP bind to the same receptor, TRAP [<a href="#r23">23</a>]. Through competing with RAP on  binding to TRAP and thus interfering with the activation of <em>agr</em> system, RIP inhibits the expression of RNAIII and the toxin genes in <em>S.  aureus</em>. Based on the fact that TRAP is highly conserved among <em>S. aureus</em> strains, RIP is supposed to inhibit  pathogenesis of most <em>S. aureus</em> strains infections [<a href="#r18">18</a>]. </p>
+
-
<p class="content">A synthetic RIP derivative  YKPWTNF was tested for its ability to inhibit RNAIII synthesis <em>in vitro</em> and to prevent infection <em>in vivo </em>[<a href="#r23">23</a>]. The  natural RIP and its synthetic derivatives have higher binding affinity to TRAP than  RAP, and therefore would inhibit the normal pathway of TRAP by induced  by RAP [<a href="#r24">24</a>]. Researches indicated that RIP YKPWTNF can suppress  virulence of any <em>S. aureus</em> strain so  far tested [<a href="#r18">18</a>, <a href="#r23">23</a>].
+
-
<br />
+
-
 
+
-
  <br/>
+
-
<div id="figure"><img align="middle" src="http://ihome.ust.hk/~lzhu/website/figures/background/fig-5.jpg" width="700" /></div>
+
-
</p>
+
-
<p class="content">A 13-residue  dermaseptin derivative DD13, identified as ALWKTLLKKVLKA, is believed to have  the ability to kill bacteria via membrane disruption. The synthetic hybrid construct  DD13-RIP derivative ALWKTLLKKVLKAYSPWTNF-CONH2 has been tested for  the ability to suppress quorum sensing of <em>S.  aureus</em> <em>in vitro</em> and shows  synergistic effect comparing with single synthetic RIP derivative YKPWTNF-CONH2  [<a href="#r25">25</a>]. Hence, by functionally expressing the hybrid peptide DD13-RIP  derivative, <em>S. aureus</em> infections may  be inhibited through restraining quorum sensing systems. However, since the  hybrid construct is made on a DNA level, after transcription and translation, the  synthetic RIP will be in the form of ALWKTLLKKVLKAYSPWTNF-COOH other than the  synthetic one ALWKTLLKKVLKAYSPWTNF-CONH2, which may lead to an  altered efficiency.</p>
+
<p class="h2"><b>Protocol list</b></p>
-
<!--background end-->
+
-
<!--reference-->
+
-
<p class="h1"><b>References for Background</b></p>
+
<p class="content">Heat-shock competent cell preparation  heat-shock transformation<br />
 +
  <a href="http://www.promega.com/guides/subcloning_guide/_row/transforming_bacteria_row.pdf">http://www.promega.com/guides/subcloning_guide/_row/transforming_bacteria_row.pdf</a><br />
 +
  Electro-competent cell preparation and  electro-transformation<br />
 +
  <a href="http://www.its.caltech.edu/~bjorker/Protocols/Prep_of_electocomp_cells.pdf">http://www.its.caltech.edu/~bjorker/Protocols/Prep_of_electocomp_cells.pdf</a><br />
 +
  Mini-prep<br />
 +
  FavorPrep™&nbsp;Plasmid  DNA Extraction Mini Kit<br />
 +
  Midi-prep<br />
 +
  <a href="http://www.google.com.hk/url?url=http://www.favorgen.com/products_for_res_nae_faPDE_Midi.htm&amp;rct=j&amp;sa=X&amp;ei=BMeyTPfIDoKmcOaY9IUH&amp;ved=0CBwQzgQoADAA&amp;q=favorgen+favor+prep+plasmid+dna+extraction&amp;usg=AFQjCNG4IsyGXbvPbZHmIYbK9PYiWNlkUg">&nbsp;FavorPrep™&nbsp;Plasmid DNA  Extraction Midi/Maxi</a> Kit<br />
 +
  Genomic DNA extraction from L.plantarum<br />
 +
  <a href="http://www.springerlink.com/content/j2g06724067924p4/#section=86476&amp;page=1">http://www.springerlink.com/content/j2g06724067924p4/#section=86476&amp;page=1</a><br />
 +
  PCR<br />
 +
  <a href="http://openwetware.org/wiki/PCR">http://openwetware.org/wiki/PCR</a><br />
 +
  Fusion PCR<br />
 +
  <a href="http://www.fgsc.net/Aspergillus/Oakley_PCR_protocol.pdf">http://www.fgsc.net/Aspergillus/Oakley_PCR_protocol.pdf</a><br />
 +
  Colony PCR<br />
 +
  <a href="http://openwetware.org/wiki/Endy:Colony_PCR">http://openwetware.org/wiki/Endy:Colony_PCR</a><br />
 +
  Restriction digest<br />
 +
  <a href="http://openwetware.org/wiki/Silver:_Restriction_Digest">http://openwetware.org/wiki/Silver:_Restriction_Digest</a><br />
 +
  Ethanol precipitation<br />
 +
  <a href="http://openwetware.org/wiki/Ethanol_precipitation_of_nucleic_acids">http://openwetware.org/wiki/Ethanol_precipitation_of_nucleic_acids</a><br />
 +
  Kit purification<br />
 +
  FavorPrep™&nbsp;GEL/PCR  Purification Mini Kit<br />
 +
  Gel purification<br />
 +
  FavorPrep™&nbsp;GEL/PCR  Purification Mini Kit<br />
 +
  Vector dephosphorylation<br />
 +
  <a href="http://www.neb.com/nebecomm/products_intl/protocol76.asp">http://www.neb.com/nebecomm/products_intl/protocol76.asp</a><br />
 +
  Ligation <br />
 +
  <a href="http://openwetware.org/wiki/DNA_Ligation">http://openwetware.org/wiki/DNA_Ligation</a><br />
 +
  Agarose gel electrophoresis<br />
 +
  <a href="http://www.methodbook.net/dna/agarogel.html">http://www.methodbook.net/dna/agarogel.html</a><br />
 +
  DNA PAGE (Polyacrylamide gel  electrophoresis)<br />
 +
  <a href="http://microbiology.ucdavis.edu/heyer/protocols/dna%20page.pdf">http://microbiology.ucdavis.edu/heyer/protocols/dna%20page.pdf</a><br />
 +
  GUS assay<br />
 +
  <strong>[<a href="#r1">1</a>]</strong><br />
 +
  Flag-tag assay and western blot<br />
 +
  <a href="http://www.biomol.de/details/AD/protocol-GPCR-WB.pdf" target="_blank">http://www.biomol.de/details/AD/protocol-GPCR-WB.pdf</a></p>
 +
 
 +
<p class="h2"><b>References:</b></p>
<ol class="reference">
<ol class="reference">
-
  <li><a name="r1"></a>Ryan, K.J., Ray, C.G., &amp; Ahmad, N. (2004). Sherris  medical microbiology. McGraw-Hill. </li>
+
<li><p><a name="r1"></a>[1] Johnsborg, O., Diep, D. B. &amp; Nes,  N. F. (2003). Structural analysis of the peptide pheromone receptor plnB, a  histidine protein kinase from <em>Lactobacillus  plantarum</em><em>. Journal of Bacteriology, </em><em>185</em>&nbsp;(23),  6913–6920.</p></li>
-
  <br />
+
 
-
 
+
<li><p><a name="r2"></a>[2] Kleerebezem, M., Boekhorst, J., Kranenburg, R.V., Molenaar,  D. &amp; Kuipers, O.P. (2003) Complete genome sequence of <em>Lactobacillus plantarum</em> WCFS1. <em>Proceedings of the National Academy of Sciences</em>, 100(4), 1990-1995.</p></li>
-
  <li><a name="r2"></a>Kluytmans, J., van Belkum, A., &amp; Verbrugh, H. (1997).  Nasal carriage of <em>Staphylococcus aureus</em>: epidemiology, underlying mechanisms, and  associated risks. <em>Clin Microbiol Rev</em>, <em>10</em>(3), 505-520. </li>
+
 
-
  <br />
+
<li><p><a name="r3"></a>[3] Geisinger,  E., George, E.A., Muir, T.W, &amp; Novick, R.P. (2008) Identification of ligand  specificity determinants in agrC, the <em>Staphylococcus aureus</em> quorum-sensing receptor. 283(14), 8930–8938.</p></li>
-
 
+
 
-
  <li><a name="r3"></a>Franklin, D., &amp; Lowy, F.D. (1998). <em>Staphylococcus aureus</em> infections. <em>N Engl J Med</em>,&nbsp;<em>339</em>(27), 520-532. </li>
+
<li><p><a name="r4"></a>[4] Novick, R.P., Projan, S.J., Kornblu, J., Ross, H.F. &amp; Ji, G. (1995) The agr P2 operon: an autocatalytic sensory transduction system  in<em> Staphylococcus aureus</em>. 248(4),&nbsp;446-458.</p></li>
-
  <br />
+
</ol>
-
 
+
 
-
  <li><a name="r4"></a>Kiran, M.D., Adikesavan, N.V., Cirioni, O., Giacometti, A., Silvestri, C., Scalise,  G., Ghiselli, R., Saba, V., Orlando, F., Shoham, M., &amp; Balaban, N. (2008). Discovery of a  quorum-sensing inhibitor of drug-resistant Staphylococcal infections by structure-based  virtual screening. <em>Mol Pharmacol</em>, <em>73</em>(5), 718-726.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r5"></a>Sturme, M.H.J.,  Francke, C., Siezen, R.J., de Vos, W.M., &amp; Kleerebezem, M. (2007). Making sense of  quorum sensing in <em>lactobacilli</em>: a  special focus on <em>lactobacillus plantarum  wcfs1</em>.&nbsp;<em>Microbiology</em>,&nbsp;153,  3939–3947.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r6"></a>Kleerebezem, M.,  Quadri, L. E. N., Kuipers, O. P. &amp; De Vos, W. M.(1997). Quorum sensing  by peptide pheromones and two-componentsignal-transduction systems in  Gram-positive bacteria. <em>Molecular  Microbiology</em>, l24, 895–904.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r7"></a>Morfeldt, E., Janzon, L., Arvidson, S.,  and Lofdahl, S. (1988) Cloning of a chromosomal locus (exp) which regulates the  expression of several exoprotein genes in <em>Staphylococcus  aureus</em>. <em>Mol Gen Genet</em>, 211,  435–440.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r8"></a>Ji, G., Beavis, R.C., and Novick, R.P. (1995) Cell  density control of staphylococcal virulence mediated by an octapeptide  pheromone. <em>Proc Natl Acad Sci USA</em>,  92, 12055–12059.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r9"></a>Novick, R.P., Ross, H.F., Projan, S.J., Kornblum, J., Kreiswirth, B., &amp; Moghazeh, S. (1993). Synthesis of  Staphylococcal virulence factors is controlled by a regulatory RNA  molecule.&nbsp;<em>EMBO J</em>,&nbsp;<em>12</em>(10), 3967-3975.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r10"></a>Koenig, R.L., Ray,  J.L., Maleki, S.J., Smeltzer, M.S.,  Hurlburt, B.K. (2004). <em>Staphylococcus aureus</em> AgrA binding to  the RNAIII-<em>agr</em> regulatory  region.&nbsp;<em>J of Bacteriol</em>, <em>186</em>(22), 7549-7555.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r11"></a>Korem, M., Sheoran ,  A.S., Gov, Y., Tzipori, S., Borovok, I., &amp; Balaban, N. (2003).  Characterization of RAP, a quorum sensing activator of <em>Staphylococcus aureus</em>.&nbsp;<em>FEMS Microbiol Lett</em>, <em>223</em>(2), 167-175.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r12"></a>Balaban, N., Goldkorn, T., Gov, Y., Hirshberg, M., Koyfman, N., Matthews, H.R., Nhan, R.T., Singh, B., Uziel, O. (2001). Regulation of <em>Staphylococcus aureus</em> pathogenesis via  target of RNAIII-activating protein (TRAP).&nbsp;<em>J Biol Chem</em>,&nbsp;<em>276</em>(4), 2658-2667. </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r13"></a>Novick RP,  Projan SJ, Kornblum J, Ross HF, Ji G, et al. 1995. The agr P2 operon: an  autocatalytic sensory transduction system in taphylococcus aureus. <em>Mol. Gen. Genet</em>, 248, 446–58.   </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r14"></a>Novick, R. P. &amp;  Geisinger, E. (2008). Quorum sensing in <em>Staphylococci</em><em>. Annual Review of Genetics, 42,</em><em>&nbsp;</em>541–64.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r15"></a>Gov,  Y., Borovok, I., Korem, M., Singh, V.K., Jayaswal, R.K., Wilkinson, B.J., Rich, S.M., &amp;  Balaban, N. (2004). Quorum  sensing in <em>Staphylococci</em> is regulated  via phosphorylation of three conserved histidine residues.&nbsp;<em>J Biol Chem</em>, <em>279</em>(15), 14665-14672.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r16"></a>Geisinger, E., George, E.A., Muir, T.W., &amp; Novick, R.P.(2008). Identification of ligand  specificity determinants in agrc, the <em>staphylococcus aureus</em> quorum-sensing receptor .&nbsp;<em>The  Journal of Biological Chemistry</em>,&nbsp;283(14), 8930–8938. </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r17"></a>Jarraud, S.,  Mougel, C., Thioulouse, J., &amp; Lina, G. (2002). Relationships between <em>staphylococcus aureus</em> genetic  background, virulence factors, agr groups (alleles), and human disease .&nbsp;<em>Infection and Immunity</em>,&nbsp;70(2),  631–641.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r18"></a>Gov, Y., Bitler, A.,  Dell'Acqua, G., Torres, J.V.,  &amp; Balaban, N. (2001). RNAIII inhibiting peptide (RIP), a global inhibitor of <em>Staphylococcus aureus</em> pathogenesis:  structure and function analysis.&nbsp;<em>Peptides</em>,&nbsp;<em>22</em>(10), 1609-1620.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r19"></a>Johnsborg, O.,  Diep, D. B. &amp; Nes, N. F. (2003). Structural analysis of the peptide  pheromone receptor plnB, a histidine protein kinase from <em>Lactobacillus plantarum</em><em>. Journal of  Bacteriology, 185</em><em>&nbsp;</em>(23),  6913–6920.  </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r20"></a>Balaban, N., &amp;  Novick, R.P. (1995). Autocrine regulation of toxin synthesis by <em>Staphylococcus aureus</em>.&nbsp;<em>Proc Natl Acad Sci U S A</em>,&nbsp;<em>92</em>(5), 1619-1623.    </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r21"></a>Costerton JW, Montanaro L, Arciola CR. (2007). Bacterial  communications in implant infections: a target for an intelligence war.<em> Int J Artif Organs.</em> 30(9):757-63.</li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r22"></a>Novick, R.P., Ross, H.F., Figueiredo, A.M.S., Abramochkin, G., Muir, T., Balaban, N., Singh, B.,  Goldkorn, T., Rasooly, A., Torres, J.V., &amp; Uziel, O. (2000). Activation and  inhibition of the Staphylococcal<em> agr</em> system.&nbsp;<em>Science</em>,&nbsp;<em>287</em>, 391. </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r23"></a>Balaban, N., Collins, L.V., Cullor, J.S., Hume, E.B., Medina-Acosta,  E., Vieira da Motta, O., O'Callaghan, R.,  Rossitto, P.V., Shirtliff, M.E., Serafim da Silveira, L., Tarkowski, A., &amp;  Torres, J.V. (2000). Prevention  of diseases caused by <em>Staphylococcus aureus</em> using the peptide RIP.&nbsp;<em>Peptides</em>,&nbsp;<em>21</em>(9), 1301-1311. </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r24"></a>Balaban, N.,  Goldkorn, T., Nhan, R.T., Dang,  L.B., Scott, S., Ridgley, R.M., Rasooly, A., Wright, S.C., Larrick, J.W., Rasooly, R., &amp; Carlson, J.R. (1998). Autoinducer  of virulence as a target for vaccine and therapy against <em>Staphylococcus aureus</em>. <em>Science</em>,&nbsp;<em>280</em>(5362), 438-440. </li>
+
-
  <br />
+
-
 
+
-
  <li><a name="r25"></a>Balaban, N., Gov, Y., Giacometti, A., Cirioni, O., Ghiselli, R., Mocchegiani, F., Orlando, F., D'Amato, G., Saba, V., Scalise, G., Bernes, S., &amp; Mor, A. (2004). A chimeric peptide  composed of a dermaseptin derivative and an RNAIII-inhibiting peptide prevents  graft-associated infections by antibiotic-resistant <em>Staphylococci</em>.&nbsp;<em>Antimicrob  Agents Chemother</em>,&nbsp;<em>48</em>(7),  2544-2550.  </li>
+
-
 
+
-
  <br />
+
-
  </ol>
+
-
</div>
+
-
<!--reference-->
+
</div>
</div>
</body>
</body>
</html>
</html>

Revision as of 17:31, 16 October 2010

Team: HKUST

1.Vectors and bacterial strains
2.Building of chimeric constructs
3.GUS reporter assay
4.Protocol list

1.Vectors and bacterial strains

The bacterial strains and vectors used in iGEM HKUST 2010 are listed in Table 1 below. E. coli DH10B and DH5α cells are prepared as chemically competent cells and used for transformation. The E. coli cells are plated on antibiotic-containing agar plate and incubated at 37C overnight. L. plantarum WCFS1 used in our project are grown in MRS medium at 30C [1]. The antibiotic concentration we used are listed as follow: ampicillin (150μg/ml for E. coli), kanamycin (50μg/ml for E. coli), chloramphenicol (35μg/ml for E. coli), erythromycin (200μg/ml for E. coli, 10μg/ml for L. plantarum).

Table 1. Bacterial Strains and Vectors

 

Strains

Description

Source

E.coli DH10B

F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK- mK+), λ–; used for subcloning

HKUST stock

E.coli DH5α

F- endA1 recA1 galE15 galK16 nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,leu)7697 mcrA Δ(mrr-hsdRMS-mcrBC) λ-; used for subcloning

HKUST stock

L. plantarum WCFS1

Wild type; used for device characterization

[2]

Non-virulent S. aureus

Used for device characterization

HKUST stock

 

Vectors

Description

Source

pBluescript KSII (+)

E. coli cloning vector containing T3 promoter, T7 promoter, lacZ gene with multiple cloning site inside; Ampr

HKUST stock

pBluescript SKII (+)

E. coli cloning vector containing T3 promoter, T7 promoter, lacZ gene with multiple cloning site inside. Multiple cloning site inverted; Ampr

HKUST stock

pMG36e

Shuttle vector contain P32 constitutive promoter; Emr

Yrbio Company

PBI121

Containing gusA reporter gene; Kmr

HKUST stock

PMH4

Containing mCherry fluorescent gene; Ampr

HKUST stock

pRN9232

Containing agrC-I; Ampr

[3]

pRN9233

Containing agrC-IV; Ampr

[3]

pRN6683

P3-blaZ fusion, for device characterization; Methr

[4]

BBa_I746101

Containing agrC-1; Kmr

iGEM 2010 BioBrick distribution

BBa_J04450

Containing RFP reporter gene; Ampr

iGEM 2010 BioBrick distribution

Building of chimeric constructs

1) Construction of chimeric sensor agrC-plnB in pBluescript and pMG36e

By PCR amplification of Biobrick BBa_I746101, the trans-membrane signal sensing domain agrC with 8 base pair-overhang of the cytoplasmic HPK domain of plnB was obtained. The cytoplasmic HPK domain of plnB with an overhang of agrC was also obtained by PCR amplification from extracted L. plantarum WCFS1 genomic DNA. Next, fusion PCR of two gene fragments was conducted and the desired fusion gene agrC-plnB obtained. After SacI and KpnI double digestion, aforementioned agrC-plnB fusion gene was ligated into pBluescript KSII (+). The cloning vector was transformed into E. coli DH10B. In subsequent steps, the construct agrC-plnB was taken out from pBluescript KSII (+) by SacI and KpnI double digestion, and ligated into E. coli – Lactobacillus shuttle vector pMG36e. The parts were confirmed by DNA sequencing.

2) Construction of agrC-mCherry and agrC-plnB-mCherry in pBluescript and pMG36e

After SacI and KpnI double digestion, agrC-mCherry and agrC-plnB-mCherry fusion gene were ligated into pBluescript KSII (+). The cloning vector was transformed into E. coli DH10B. In subsequent steps, the constructs agrC-mCherry and agrC-plnB-mCherry were taken out from pBluescript KSII (+) by SacI and KpnI double digestion, and ligated into E. coli – Lactobacillus shuttle vector pMG36e. The parts were confirmed by DNA sequencing.

3)Construction of plnA promoter – gusA reporter unit in pBluescript

The 124-base-pair nucleotide of plnA promoter was obtained by annealing a 79-base-pair forward primer and a 73-base-pair reverse primer. The reporter gene gusA was amplified from PBI121 by PCR. The gusA gene was then digested and ligated into pBluescript KSII (+). The cloning vector was transformed into E. coli DH10B. However, we tried several times but still failed to ligate the 124 bp plnA promoter into pBluescript KSII (+).

4)Construction of “hybrid signal peptide-flag tag-DD13-RIP”

Signal peptide, flag-tag and DD13-RIP were obtained by annealing single-stranded oligonucleotides. Each fragment was flanked by restriction enzyme cutting sites for subsequent ligation. Construct “signal peptide- flag tag- DD13 –RIP” was ligated into pBluescript KSII (+). The cloning vector was transformed into E. coli DH10B plasmid amplification. The parts were confirmed by DNA sequencing.

Table 2. Primer List

Construct

Name

Sequence

agrC

 

agrC  FP

CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG

agrC  RP

GACTCGGTACCTCTTTGGATCCTTATTAGTTATTGATG

 

 

 

agrC-plnB

agrC  FP

CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG

agrC  RP1

GTTTCTAACAGGAACTGGCTGATAACGAAAG

plnB  FP

CAGTTCCTGTTAGAAACGATTAGAGTATATGCTTGGC

plnB  RP1

GTCAGGTACCTTATTTATCCTCCGTAACAATTAACG

 

 

 

agrC-mCherry

agrC FP

CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG

agrC RP 2

ATTGCGGCGTTATTGATGATTTCGACTTTCTGAATG

mCherry FP 2

ATCAATAACGCCGCAATGGTGAGCAAG

mCherry RP

ATCGTCCCGGGGCTTACTTGTACAGCTCGTCCATG

 

 

 

agrC-plnB-mCherry

agrC FP

CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG

agrC RP 1

GTTTCTAACAGGAACTGGCTGATAACGAAAG

plnB FP

CAGTTCCTGTTAGAAACGATTAGAGTATATGCTTGGC

plnB RP

ATTGCGGCTTTATCCTCCGTAACAATTAACGTC

mCherry FP 1

GAGGATAAAGCCGCAATGGTGAGCAAG

mCherry RP

ATCGTCCCGGGGCTTACTTGTACAGCTCGTCCATG

 

 

 

plnA promoter-gusA

plnA promoter synthesis FP

GCTGGAATTCTCTAGAATTTCATGGTGATTCACGTTTA
AATTTAAAAAATG TACGTTAATAGAAATAATTCCTCCG

plnA promoter synthesis RP

CGTAACATCCCGGGCACCTCGCTTTTAGGATAATGT
GTTTTTGAAGTACGGAGGAATTATTTCTATTAACG

gusA  FP

GGTGCCCGGGATGTTACGTCCTGTAGAAACCC

gusA  RP

ATACGAATTCGCGGCCGCTTATTGTTTGCCTCCCTGC

 

 

 

Signal peptide-flag tag-DD13 RIP

F102001

CCCGGGAGGAGGCTCGAGATGGACTACAAAGACGAT
GACGATAAAG

R102002

TCGACTTTATCGTCATCGTCTTTGTAGTCCATCTCGAGC
CTCCTCCCGGGAGCT

F102003

TCGACATGGCTCTGTGGAAGACGCTGCTGAAGAAAGT
TCTGAAGGCTTATTCAC

R102004

CATGGTGAATAAGCCTTCAGAACTTTCTTCAGCAGCGT
CTTCCACAGAGCCATG

F102005

CATGGACGAATTTTTGAGCGGCCGCGGTAC

R102006

CGCGGCCGCTCAAAAATTCGTC

F102007

CCCGGGGATGGGAGCGACGTTAGATGAAAGAAGTAA
GGTTTTGGGGACTCTTGTTAGGAC

R102008

ACAAGAGTCCCCAAAACCTTACTTCTTTCATCTAACGTC
GCTCCCATCCCCGGGAGCT

F102009

TGTTTGTCTGTTTAGGGGCAGTGATACCGTTAGTTAGTA
AGGCTGACGTAG

R102010

TCGACTACGTCAGCCTTACTAACTAACGGTATCACTGCC
CCTAAACAGACAAACAGTCCTA

3.GUS reporter assay

pMG36e-transformed L. plantarum WCFS1 is cultivated at 30C until its optical density at 600nm (OD600) reaches 0.10-0.20. Cells will then be exposed to autoinducing peptide (AIP) and incubated at 30C for 1-2 hours. GUS substrate para-nitrophenyl-β-D-glucuronic acid will then be added and the reaction mixture incubated at 37C for another 20 minutes. Finally, OD reading at 405nm obtained and GUS activity quantified as OD­­405 / OD600 [1].

Protocol list

Heat-shock competent cell preparation heat-shock transformation
http://www.promega.com/guides/subcloning_guide/_row/transforming_bacteria_row.pdf
Electro-competent cell preparation and electro-transformation
http://www.its.caltech.edu/~bjorker/Protocols/Prep_of_electocomp_cells.pdf
Mini-prep
FavorPrep™ Plasmid DNA Extraction Mini Kit
Midi-prep
 FavorPrep™ Plasmid DNA Extraction Midi/Maxi Kit
Genomic DNA extraction from L.plantarum
http://www.springerlink.com/content/j2g06724067924p4/#section=86476&page=1
PCR
http://openwetware.org/wiki/PCR
Fusion PCR
http://www.fgsc.net/Aspergillus/Oakley_PCR_protocol.pdf
Colony PCR
http://openwetware.org/wiki/Endy:Colony_PCR
Restriction digest
http://openwetware.org/wiki/Silver:_Restriction_Digest
Ethanol precipitation
http://openwetware.org/wiki/Ethanol_precipitation_of_nucleic_acids
Kit purification
FavorPrep™ GEL/PCR Purification Mini Kit
Gel purification
FavorPrep™ GEL/PCR Purification Mini Kit
Vector dephosphorylation
http://www.neb.com/nebecomm/products_intl/protocol76.asp
Ligation
http://openwetware.org/wiki/DNA_Ligation
Agarose gel electrophoresis
http://www.methodbook.net/dna/agarogel.html
DNA PAGE (Polyacrylamide gel electrophoresis)
http://microbiology.ucdavis.edu/heyer/protocols/dna%20page.pdf
GUS assay
[1]
Flag-tag assay and western blot
http://www.biomol.de/details/AD/protocol-GPCR-WB.pdf

References:

  1. [1] Johnsborg, O., Diep, D. B. & Nes, N. F. (2003). Structural analysis of the peptide pheromone receptor plnB, a histidine protein kinase from Lactobacillus plantarum. Journal of Bacteriology, 185 (23), 6913–6920.

  2. [2] Kleerebezem, M., Boekhorst, J., Kranenburg, R.V., Molenaar, D. & Kuipers, O.P. (2003) Complete genome sequence of Lactobacillus plantarum WCFS1. Proceedings of the National Academy of Sciences, 100(4), 1990-1995.

  3. [3] Geisinger, E., George, E.A., Muir, T.W, & Novick, R.P. (2008) Identification of ligand specificity determinants in agrC, the Staphylococcus aureus quorum-sensing receptor. 283(14), 8930–8938.

  4. [4] Novick, R.P., Projan, S.J., Kornblu, J., Ross, H.F. & Ji, G. (1995) The agr P2 operon: an autocatalytic sensory transduction system in Staphylococcus aureus. 248(4), 446-458.

Retrieved from "http://2010.igem.org/Team:HKUST/Project/Background"