Team:HKUST/Project/Background

From 2010.igem.org

(Difference between revisions)
 
(17 intermediate revisions not shown)
Line 1: Line 1:
 +
{{HKUST_css}}
 +
<html xmlns="http://www.w3.org/1999/xhtml">
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<title>Team: HKUST</title>
<title>Team: HKUST</title>
-
 
-
<link href="http://ihome.ust.hk/~lzhu/website/style.css" rel="stylesheet" type="text/css" />
 
</head>
</head>
<body bgcolor="#FFFFFF">
<body bgcolor="#FFFFFF">
<body>
<body>
-
<div id="header">
+
</html>
-
<img src="http://ihome.ust.hk/~lzhu/website/banner.jpg" width="950px" />
+
{{HKUST_banner}}
-
</div>
+
<html>
 +
<div id="body_content_project">
 +
</html>{{HKUST_sidebar}}
 +
<html>
-
<div id="body_content_material">
 
-
<div id="sidebar">
 
-
<ul>
 
-
        <li><a href="http://2010.igem.org/Team:HKUST">HOME</a></li>
 
-
        <li><a href="http://2010.igem.org/Team:HKUST/Team">Here we are!</a></li>
 
-
       
 
-
        <li class="cat"><h3 class="cat">Project</h3><li>
 
-
       
 
-
        <li ><a href="http://2010.igem.org/Team:HKUST/Project/Abstract">Abstract</a></li>
 
-
<li ><a href="http://2010.igem.org/Team:HKUST/Project/Background">Background</a></li>
 
-
        <li ><a href="http://2010.igem.org/Team:HKUST/Project/Parts and Experiment Design">Experiment Design</a></li>
 
-
        <li ><a href="http://2010.igem.org/Team:HKUST/Project/Results and Discussion">Results and Discussion</a></li>
 
-
        <li ><a href="http://2010.igem.org/Team:HKUST/Project/Materials and Methods">Materials and Methods</a></li>
 
-
   
 
-
<li><a href="http://2010.igem.org/Team:HKUST/Notebook">Lab Notebook</a></h3></li>
 
-
        <li><a href="http://2010.igem.org/Team:HKUST/Human_Practice">Human Pratice</a></li>
 
-
        <li><a href="http://2010.igem.org/Team:HKUST/Summer_fun">Summer Fun</a></li>     
 
-
        <li><a href="http://2010.igem.org/Team:HKUST/Acknowledgement">Acknowledgement</a></li>
 
-
        <li><a href="http://2010.igem.org/Team:HKUST/Safety">Biosafety</a></li>
 
-
 
-
</ul>
 
-
</div>
 
 +
<!--background begin-->
<div id="module_1">
<div id="module_1">
 +
<p class="h1"><b>Background</b></p>
 +
<p class="h2"><b>
 +
<a href="#1">1. <em>Staphylococcus aureus</em></a><br />
 +
<a href="#2">2. Two-Component Signaling System (TCS)</a> <br />
 +
<a href="#3">3. <em>Staphylococcus aureus</em> virulence regulating mechanism: AgrBDCA</a><br />
 +
<a href="#4">4. <em>Lactobacillus plantarum</em> WCFS1 quorum sensing system: PlnABCD</a><br />
 +
<a href="#5">5. RNAIII inhibiting peptide (RIP) of <em>Staphylococcus aureus</em></a><br />
 +
<a href="#6">6. References</a><br />
 +
</b></p>
-
<p class="h2">
 
-
<b><a href="#1">1.Vectors and bacterial strains</a></b><br />
 
-
<b><a href="#2">2.Building of chimeric constructs</a></b><br />
 
-
<b><a href="#3">3.GUS reporter assay</a></b><br />
 
-
<b><a href="#4">4.Protocol list</a></b>
 
-
<b><a href="#5">5.Reference</a></b></p>
 
-
<!--part1-->
+
<p class="h2"><b><a name="1"></a>1. <em>Staphylococcus aureus</em></b></p>
-
<p class="h2"><a name="1"></a><b>1.Vectors and bacterial strains</b></p>
+
-
<p class="content">The bacterial  strains and vectors used in iGEM HKUST 2010 are listed in Table 1 below. <em>E. coli</em> DH10B and DH5α cells are prepared as chemically competent cells and used for transformation. The <em>E. coli</em> cells are plated on antibiotic-containing agar plate and incubated at 37C overnight. <em>L. plantarum</em> WCFS1 used in our project  are grown in MRS medium at 30C <strong>[<a href="#r1">1</a>]</strong>. The  antibiotic concentration we used are listed as follow: ampicillin (150μg/ml for <em>E. coli</em>), kanamycin (50μg/ml for <em>E. coli</em>), chloramphenicol (35μg/ml for <em>E. coli</em>), erythromycin (200μg/ml for <em>E. coli</em>, 10μg/ml for <em>L. plantarum</em>). </p>
+
<p class="content"><em>Staphylococcus aureus</em> is a facultatively anaerobic, gram-positive coccus which forms large round yellow colonies when grown on agar  plate [<a href="#r1">1</a>]. It was reported that approximately 20% of human population are  long-term carriers of at least one <em>S. aureus</em> strain [<a href="#r2">2</a>]. As a versatile and potential dangerous pathogen, <em>S. aureus</em> can cause a wide range of  diseases varying from skin flora infections to invasive infections such as  sepsis syndrome [<a href="#r1">1</a>, <a href="#r3">3</a>]. Many of these diseases are associated with regulation  factors involved in toxin synthesis in <em>S. aureus</em>. These bacterial regulation factors play critical roles in virulence  production; the strains that are defective in producing toxin regulation  factors always show weakened virulence [<a href="#r4">4</a>]. The aforementioned information  suggests a novel therapy, which involves the inhibition of toxin regulation factors,  for diseases caused by <em>S. aureus</em>.</p>
-
<table border="1" cellspacing="0" cellpadding="2px" background="http://ihome.ust.hk/~lzhu/website/bg.jpg">
 
-
  <tr>
 
-
    <td colspan="3" valign="middle"><p align="center"><strong>Table    1. Bacterial Strains and Vectors</strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td colspan="3" valign="middle"><p align="center">&nbsp;</p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center"><strong>Strains</strong></p></td>
 
-
    <td width="346" valign="middle"><p align="center"><strong>Description</strong></p></td>
 
-
    <td width="116" valign="middle"><p align="center"><strong>Source</strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center"><em>E.coli </em>DH10B</p></td>
 
-
    <td width="346" valign="middle"><p align="center">F-&nbsp;endA1 glnV44 thi-1 recA1    relA1 gyrA96 deoR nupG Φ80d<em>lacZ</em>ΔM15 Δ(<em>lacZYA-argF</em>)U169,    hsdR17(rK-&nbsp;mK+),    λ–; used for subcloning </p></td>
 
-
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center"><em>E.coli</em> DH5<em>α</em></p></td>
 
-
    <td width="346" valign="middle"><p align="center">F-&nbsp;endA1 recA1 galE15 galK16    nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,leu)7697 mcrA Δ(mrr-hsdRMS-mcrBC)    λ-; used for subcloning </p></td>
 
-
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center"><em>L. plantarum</em> WCFS1</p></td>
 
-
    <td width="346" valign="middle"><p align="center">Wild type; used    for device characterization</p></td>
 
-
    <td width="116" valign="middle"><p align="center"><strong>[<a href="#r2">2</a>]</strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">Non-virulent <em>S.    aureus</em></p></td>
 
-
    <td width="346" valign="middle"><p align="center">Used for device    characterization</p></td>
 
-
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td colspan="3" valign="middle"><p align="center"><strong>&nbsp;</strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center"><strong>Vectors</strong></p></td>
 
-
    <td width="346" valign="middle"><p align="center"><strong>Description</strong></p></td>
 
-
    <td width="116" valign="middle"><p align="center"><strong>Source</strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">pBluescript KSII (+)</p></td>
 
-
    <td width="346" valign="middle"><p align="center"><em>E. coli</em> cloning vector containing T3 promoter, T7 promoter, lacZ gene with    multiple cloning site inside; Ampr</p></td>
 
-
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">pBluescript SKII (+)</p></td>
 
-
    <td width="346" valign="middle"><p align="center"><em>E. coli</em> cloning vector containing T3 promoter, T7 promoter, lacZ gene with    multiple cloning site inside. Multiple cloning site inverted; Ampr</p></td>
 
-
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">pMG36e</p></td>
 
-
    <td width="346" valign="middle"><p align="center">Shuttle vector    contain P32 constitutive promoter; Emr</p></td>
 
-
    <td width="116" valign="middle"><p align="center">Yrbio Company </p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">PBI121</p></td>
 
-
    <td width="346" valign="middle"><p align="center">Containing gusA    reporter gene; Kmr</p></td>
 
-
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">PMH4</p></td>
 
-
    <td width="346" valign="middle"><p align="center">Containing    mCherry fluorescent gene; Ampr</p></td>
 
-
    <td width="116" valign="middle"><p align="center">HKUST stock</p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">pRN9232</p></td>
 
-
    <td width="346" valign="middle"><p align="center">Containing    agrC-I; Ampr</p></td>
 
-
    <td width="116" valign="middle"><p align="center"><strong>[<a href="#r3">3</a>]</strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">pRN9233</p></td>
 
-
    <td width="346" valign="middle"><p align="center">Containing    agrC-IV; Ampr</p></td>
 
-
    <td width="116" valign="middle"><p align="center"><strong>[<a href="#r3">3</a>]</strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">pRN6683</p></td>
 
-
    <td width="346" valign="middle"><p align="center">P3-blaZ fusion,    for device characterization; Methr</p></td>
 
-
    <td width="116" valign="middle"><p align="center"><strong>[<a href="#r4">4</a>]</strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">BBa_I746101</p></td>
 
-
    <td width="346" valign="middle"><p align="center">Containing    agrC-1; Kmr</p></td>
 
-
    <td width="116" valign="middle"><p align="center">iGEM 2010    BioBrick distribution<strong></strong></p></td>
 
-
  </tr>
 
-
  <tr>
 
-
    <td width="122" valign="middle"><p align="center">BBa_J04450</p></td>
 
-
    <td width="346" valign="middle"><p align="center">Containing RFP    reporter gene; Ampr</p></td>
 
-
    <td width="116" valign="middle"><p align="center">iGEM 2010    BioBrick distribution<strong></strong></p></td>
 
-
  </tr>
 
-
</table>
 
-
<p class="h2"><b><a name="2"></a>2.Building of chimeric constructs</b></p>
+
<p class="h2"><b><a name="2"></a>2. Two-Component Signaling System (TCS)</b></p>
-
<p class="h2"><b>1) Construction of chimeric sensor agrC-plnB in pBluescript and pMG36e</b></p>
+
<p class="content">In many bacterial species, Two-Component Signaling System (TCS) plays a prominent role in quorum sensing. A classical TCS consists of a transmembrane receptor, which is a histidine protein kinase (HPK), and a cytoplasmic response regulator (RR) [<a href="#r5">5</a>]. When bound by autoinducing peptides (AIP), the transmembrane receptor HPK passes a phosphate group to the downstream cytoplasmic response regulator RR. The cytoplasmic response regulator will then up-regulates or down-regulates various virulence and bacteriocin productions under specific situations [<a href="#r6">6</a>]. Figure 1 below illustrates the components and transduction pathways of a typical two-component signaling system:
 +
<br />
 +
<br/>
 +
<div id="figure"><img align="middle" src="http://2010.igem.org/wiki/images/c/c6/HKUST_BG_Fig-1.png" width="700" /></div>
 +
</p>
-
<p class="content">By PCR amplification  of Biobrick BBa_I746101, the trans-membrane signal sensing domain agrC with 8 base  pair-overhang of the cytoplasmic HPK domain of plnB was obtained. The cytoplasmic HPK domain of plnB with an overhang  of agrC was also obtained by PCR amplification from extracted <em>L. plantarum</em> WCFS1 genomic DNA. Next,  fusion PCR of two gene fragments was conducted and the desired fusion gene  agrC-plnB obtained. After SacI and KpnI double digestion, aforementioned  agrC-plnB fusion gene was ligated into pBluescript KSII (+). The cloning vector  was transformed into <em>E. coli</em> DH10B. In subsequent steps, the construct agrC-plnB was taken out from pBluescript KSII  (+) by SacI and KpnI double digestion, and ligated into <em>E. coli</em> – <em>Lactobacillus</em> shuttle  vector pMG36e. The parts were confirmed by DNA sequencing.</p>
+
<p class="h2"><b><a name="3"></a>3. <em>Staphylococcus aureus</em> virulence regulating mechanism: AgrBDCA</b></p>
-
<p class="h2"><b>2) Construction  of agrC-mCherry and agrC-plnB-mCherry in pBluescript and pMG36e</b></p>
+
-
<p class="content">After SacI and KpnI double digestion, agrC-mCherry and agrC-plnB-mCherry fusion gene were ligated into pBluescript KSII (+). The cloning vector was transformed into <em>E. coli</em> DH10B. In subsequent steps, the  constructs agrC-mCherry and agrC-plnB-mCherry were taken out from pBluescript KSII (+) by SacI and KpnI double digestion, and ligated into <em>E. coli</em> <em>Lactobacillus</em> shuttle vector pMG36e. The parts were confirmed by  DNA sequencing.</p>
+
<p class="content">A chromosomal locus <em>agr</em> system in <em>S. aureus</em> consists of two transcription units RNA II and RNA III; they are responsible for self-regulation and effect response respectively [<a href="#r7">7</a>, <a href="#r8">8</a>]. RNA II, driven by P2 promoter, is a polycistronic mRNA  containing four open reading frames: <em>agrB</em>, <em>agrD</em>, <em>agrC</em> and <em>agrA</em>, and are responsible for <em>agr</em> quorum sensing in <em>S. aureus</em> [<a href="#r9">9</a>]. AgrB is an integral membrane protein; AgrD is a pro-peptide secreted  with the aid of AgrB, yielding an octapeptide pheromone autoinducing peptide (AIP); AgrC and AgrA compose a bacterial two-component signal transduction system, in which AgrC, a membrane associated protein, serves as a receptor and AgrA acts as a DNA-binding response regulator[<a href="#r10">10</a>,<a href="#r11">11</a>, <a href="#r12">12</a>]. Once the transmembrane receptor domain of AgrC is bound by AIP, its cytoplasmic HPK domain will pass a phosphate group  downwards to AgrA, the response regulator. AgrA functions as a transcription  factor and activates the two promoters P2 and P3 [<a href="#r13">13</a>, <a href="#r14">14</a>]. RNA III, driven by P3 promoter, acts as  a regulatory factor to activate numerous toxin production genes and encode for  β-hemolysin [<a href="#r15">15</a>].<strong> </strong>Figure  2 below shows the pathways involved in <em>S.  aureus</em> AgrBDCA system:
 +
<br />
 +
 
 +
  <br/>
 +
<div id="figure"><img align="middle" src="http://2010.igem.org/wiki/images/e/e0/HKUST_BG_Fig-2.png" width="700" />
 +
</div>
 +
</p>
-
<p class="h2"><b>3)Construction of plnA promoter – gusA reporter unit in pBluescript</b></p>
+
<p class="content">It  has been reported that there are altogether 4 types of <em>agr</em> loci; each type of <em>agr</em> locus encodes AgrC and corresponding AIP slightly different from others. AgrC is only activated by AIP belonging to the same group and is usually inhibited  by AIP from other groups [<a href="#r16">16</a>]. Different groups of AgrC and their corresponding  AIPs are highly involved in various human diseases or infections. For example,  food poisoning caused by staphylococcal enterotoxins is usually associated with <em>agr</em> group I and <em>agr</em> group II <em>S. aureus</em>;  toxic shock syndrome toxin 1 (TSST-1), which results in high fever, low blood  pressure and malaise of human, is produced by <em>agr</em> group III <em>S. aureus</em> [<a href="#r17">17</a>].</p>
 +
<p class="content">The synthesis of  RNAIII is regulated by two <em>Staphylococcal </em>quorum sensing systems SQS 1 and SQS 2. SQS 1 consists of a 277-amino-acid  RNAIII-activating protein (RAP) and a 167-amino-acid target of  RNAIII-activating protein (TRAP) which is membrane associated [<a href="#r15">15</a>]; SQS 2  consists of molecules encoded by <em>agr</em> system [<a href="#r18">18</a>]. As <em>S. aureus</em> multiplies,  RAP is secreted. Once RAP reaches a threshold concentration, it will induce the  histidine phosphorylation of TRAP, which leads to the activation of <em>agr</em> system and therefore induces the  production of RNAII during the mid-exponential growth phase [<a href="#r15">15</a>]. After the  activation of <em>agr</em> system, phosphorylation  of AgrC is induced by secreted AIP, followed by the production of RNAIII [<a href="#r18">18</a>].
 +
<br />
 +
 
 +
<br/>
 +
<div id="figure"><img align="middle" src="http://2010.igem.org/wiki/images/f/f2/HKUST_BG_Fig-3.png" width="550" />
 +
</div>
 +
</p>
-
<p class="content">The 124-base-pair nucleotide of plnA promoter was obtained by annealing a 79-base-pair forward primer and a 73-base-pair reverse primer. The reporter gene gusA was amplified from PBI121 by PCR. The  gusA gene was then digested and ligated into pBluescript KSII (+). The cloning  vector was transformed into <em>E. coli</em> DH10B. However, we tried several times but still failed to ligate the 124 bp plnA promoter into pBluescript KSII (+).</p>
+
<p class="content">The characteristics of <em>S. aureus</em> AgrBDCA system make it possible to build an engineered AIP sensor on the membrane of a non-pathogenic bacterial species. The engineered AIP sensor, localized on the non-virulent bacteria, could therefore detect the presence of AIP molecules released by <em>S. aureus</em>. Upon receiving this signal, the non-virulent bacteria could be automatically induced to synthesize AIP’s competitor, RNAIII inhibiting peptide (RIP), and hence, repress the activation  of AgrC and toxin production in <em>S. aureus</em>.</p>
-
<p class="h2"><b>4)Construction of &ldquo;hybrid signal peptide-flag tag-DD13-RIP&rdquo;</b></p>
+
<p class="h2"><a name="4"></a><b>4. <em>Lactobacillus plantarum</em> WCFS1 quorum sensing system: PlnABCD</b></p>
 +
<p class="content">Several <em>agr</em>-like quorum sensing systems in <em>Lactobacillus  plantarum </em>WCFS1 have been identified, among which the PlnABCD system is the  best studied [<a href="#r5">5</a>]. The PlnABCD system, similar to the AgrBDCA system, is a self-regulating  system in <em>L. plantarum </em>WCFS1. The  transmembrane receptor HPK PlnB, together with two response regulators PlnC and  PlnD, constitutes a two-component signaling system (TCS) in <em>L. plantarum </em>WCFS1. PlnA, the inducing  peptide (IP) of <em>L. plantarum </em>WCFS1,  activates PlnB and thereby phosphoylates PlnC or PlnD. PlnC and PlnD are  upregulator and downreuglater of plnA promoter respectively, and therefore,  would activate/suppress the transcription initiation of plnABCD. The  transcription of plnABCD is usually associated with <em>Lactobacillus plantarum </em>WCFS1 bacteriocin production [<a href="#r19">19</a>]. Figure 3  below shows the pathways involved in <em>Lactobacillus  plantarum </em>WCFS1 PlnABCD system:
 +
<br />
 +
 
 +
<br/>
 +
<div id="figure"><img align="middle" src="http://2010.igem.org/wiki/images/a/a5/HKUST_BG_Fig-4.png" width="700" />
 +
</div>
-
<p class="content">Signal peptideflag-tag and DD13-RIP were obtained by annealing single-stranded oligonucleotidesEach fragment was flanked by restriction enzyme cutting sites for subsequent ligation. Construct &ldquo;signal peptide- flag tag- DD13 –RIP&rdquo; was ligated into pBluescript KSII (+). The cloning vector was transformed into <em>E. coli</em> DH10B plasmid amplification. The parts were confirmed by DNA sequencing.</p>
+
<p class="content">Transmembrane  signal sensors of both PlnABCD and AgrBDCA systems, i.e. PlnB (of <em>L. plantarum </em>WCFS1) and AgrC (of<em> S. aureus</em>), belong to a same subgroup of histidine protein kinases – the HPK10 subfamily. PlnB and AgrC  share a highly homologous cytoplasmic HPK domain regarding amino acid sequence,  tertiary structure and biochemical function [<a href="#r14">14</a>, <a href="#r19">19</a>]. However, the sequence of  PlnB and AgrC’s transmembrane domain are distinct from each other, probably due to the ligand binding specificity required by their corresponding signaling molecules. </p>
 +
<p class="content">Based on the  homology between AgrBDCA and PlnABCD at the cytoplasmic HPK domain, we decided  to construct a chimeric AIP sensor in<em> Lactobacillus</em>.  Such a fusion receptor would link the transmembrane signal sensing domain of AgrCand the cytoplasmic HPK domain of PlnB. By localizing such a fusion protein on <em>Lactobacillus </em>plasma membrane, it is hoped that <em>Lactobacillus </em>can successfully detect the presence of autoinducing peptides (AIPs) produced by <em>S. aureus</em>. Upon the detection of AIP molecules, the chimeric protein kinase will transduce the  signal to <em>L. plantarum </em>WCFS1intrinsic downstream pathways.</p>
-
<table border="1" cellspacing="0" cellpadding="0" background="http://ihome.ust.hk/~lzhu/website/bg.jpg">
+
<p class="h2"><b><a name="5"></a>5. RNAIII inhibiting peptide (RIP) of <em>Staphylococcus aureus</em></b></p>
-
  <tr>
+
-
    <td colspan="3" valign="middle"><p align="center"><strong>Table    2. Primer List</strong></p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" valign="middle"><p align="center"><strong>Construct</strong></p></td>
+
-
    <td width="129" valign="middle"><p align="center"><strong>Name</strong></p></td>
+
-
    <td width="324" valign="middle"><p><strong>Sequence</strong></p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" rowspan="2" valign="middle"><p align="center">agrC</p>      <p align="center">&nbsp;</p></td>
+
-
    <td width="129"><p align="center">agrC  FP</p></td>
+
-
    <td width="324" valign="middle"><p>    CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" height="23"><p align="center">agrC  RP</p></td>
+
-
    <td width="324" valign="middle"><p>    GACTCGGTACCTCTTTGGATCCTTATTAGTTATTGATG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="324" valign="middle"><p>&nbsp;</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" rowspan="4" valign="middle"><p align="center">agrC-plnB</p></td>
+
-
    <td width="129"><p align="center">agrC  FP</p></td>
+
-
    <td width="324"><p>    CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129"><p align="center">agrC  RP1</p></td>
+
-
    <td width="324"><p>    GTTTCTAACAGGAACTGGCTGATAACGAAAG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129"><p align="center">plnB  FP</p></td>
+
-
    <td width="324"><p>    CAGTTCCTGTTAGAAACGATTAGAGTATATGCTTGGC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" height="16"><p align="center">plnB  RP1</p></td>
+
-
    <td width="324"><p>    GTCAGGTACCTTATTTATCCTCCGTAACAATTAACG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="324" valign="middle"><p>&nbsp;</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" rowspan="4" valign="middle"><p align="center">agrC-mCherry</p></td>
+
-
    <td width="129" valign="bottom"><p align="center">agrC FP</p></td>
+
-
    <td width="324" valign="bottom"><p>    CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">agrC RP 2</p></td>
+
-
    <td width="324" valign="bottom"><p>    ATTGCGGCGTTATTGATGATTTCGACTTTCTGAATG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">mCherry FP 2</p></td>
+
-
    <td width="324" valign="bottom"><p>    ATCAATAACGCCGCAATGGTGAGCAAG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">mCherry RP</p></td>
+
-
    <td width="324" valign="bottom"><p    >ATCGTCCCGGGGCTTACTTGTACAGCTCGTCCATG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="324" valign="middle"><p>&nbsp;</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" rowspan="6" valign="middle"><p align="center">agrC-plnB-mCherry</p></td>
+
-
    <td width="129" valign="bottom"><p align="center">agrC FP</p></td>
+
-
    <td width="324" valign="bottom"><p>    CAGCTAGAGCTCAAAGAGGAGAAATACTAGATGATTCTG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">agrC RP 1</p></td>
+
-
    <td width="324" valign="bottom"><p>    GTTTCTAACAGGAACTGGCTGATAACGAAAG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">plnB FP</p></td>
+
-
    <td width="324" valign="bottom"><p>    CAGTTCCTGTTAGAAACGATTAGAGTATATGCTTGGC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">plnB RP</p></td>
+
-
    <td width="324" valign="bottom"><p>    ATTGCGGCTTTATCCTCCGTAACAATTAACGTC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">mCherry FP 1</p></td>
+
-
    <td width="324" valign="bottom"><p>    GAGGATAAAGCCGCAATGGTGAGCAAG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">mCherry RP</p></td>
+
-
    <td width="324" valign="bottom"><p>    ATCGTCCCGGGGCTTACTTGTACAGCTCGTCCATG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="324" valign="middle"><p>&nbsp;</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" rowspan="4" valign="middle"><p align="center">plnA    promoter-gusA</p></td>
+
-
    <td width="129" height="35" valign="middle"><p align="center">plnA promoter synthesis    FP</p></td>
+
-
    <td width="324" valign="middle"><p>    GCTGGAATTCTCTAGAATTTCATGGTGATTCACGTTTA<br />
+
-
      AATTTAAAAAATG    TACGTTAATAGAAATAATTCCTCCG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="middle"><p align="center">plnA promoter    synthesis RP</p></td>
+
-
    <td width="324" valign="middle"><p>    CGTAACATCCCGGGCACCTCGCTTTTAGGATAATGT<br />
+
-
      GTTTTTGAAGTACGGAGGAATTATTTCTATTAACG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129"><p align="center">gusA  FP</p></td>
+
-
    <td width="324"><p>    GGTGCCCGGGATGTTACGTCCTGTAGAAACCC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" height="30"><p align="center">gusA  RP</p></td>
+
-
    <td width="324"><p>    ATACGAATTCGCGGCCGCTTATTGTTTGCCTCCCTGC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="129" valign="middle"><p align="center">&nbsp;</p></td>
+
-
    <td width="324" valign="middle"><p>&nbsp;</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="81" rowspan="10" valign="middle"><p align="center">Signal    peptide-flag tag-DD13 RIP</p></td>
+
-
    <td width="129" valign="bottom"><p align="center">F102001</p></td>
+
-
    <td width="324" valign="bottom"><p>    CCCGGGAGGAGGCTCGAGATGGACTACAAAGACGAT<br />
+
-
      GACGATAAAG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">R102002</p></td>
+
-
    <td width="324" valign="bottom"><p>    TCGACTTTATCGTCATCGTCTTTGTAGTCCATCTCGAGC<br />
+
-
      CTCCTCCCGGGAGCT</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">F102003</p></td>
+
-
    <td width="324" valign="bottom"><p>    TCGACATGGCTCTGTGGAAGACGCTGCTGAAGAAAGT<br />
+
-
      TCTGAAGGCTTATTCAC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">R102004</p></td>
+
-
    <td width="324" valign="bottom"><p>    CATGGTGAATAAGCCTTCAGAACTTTCTTCAGCAGCGT<br />
+
-
      CTTCCACAGAGCCATG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">F102005</p></td>
+
-
    <td width="324" valign="bottom"><p>    CATGGACGAATTTTTGAGCGGCCGCGGTAC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">R102006</p></td>
+
-
    <td width="324" valign="bottom"><p>    CGCGGCCGCTCAAAAATTCGTC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">F102007</p></td>
+
-
    <td width="324" valign="bottom"><p>    CCCGGGGATGGGAGCGACGTTAGATGAAAGAAGTAA<br />
+
-
      GGTTTTGGGGACTCTTGTTAGGAC</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">R102008</p></td>
+
-
    <td width="324" valign="bottom"><p>    ACAAGAGTCCCCAAAACCTTACTTCTTTCATCTAACGTC<br />
+
-
      GCTCCCATCCCCGGGAGCT</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">F102009</p></td>
+
-
    <td width="324" valign="bottom"><p>    TGTTTGTCTGTTTAGGGGCAGTGATACCGTTAGTTAGTA<br />
+
-
      AGGCTGACGTAG</p></td>
+
-
  </tr>
+
-
  <tr>
+
-
    <td width="129" valign="bottom"><p align="center">R102010</p></td>
+
-
    <td width="324" valign="bottom"><p>    TCGACTACGTCAGCCTTACTAACTAACGGTATCACTGCC<br />
+
-
      CCTAAACAGACAAACAGTCCTA</p></td>
+
-
  </tr>
+
-
</table>
+
-
<p class="h2"><b>3.GUS reporter assay</b></p>
+
-
<p class="content">pMG36e-transformed<em> L. plantarum</em> WCFS1 is cultivated at 30C until its optical density at 600nm (OD600) reaches 0.10-0.20. Cells will then be exposed to autoinducing peptide (AIP) and incubated at 30C for 1-2 hours. GUS substrate para-nitrophenyl-β-D-glucuronic acid will then be added and the reaction mixture incubated at 37C for another 20 minutes. Finally, OD reading at 405nm obtained and GUS activity quantified as OD­­405 / OD600 <strong>[<a href="#r1">1</a>]</strong>. </p>
+
<p class="content">The <em>S. aureus</em> RN833 is a mutant strain of Foggi (now listed as RN831) as it no longer produces α-hemolysin. Instead,  RNAIII inhibiting peptide, an inhibitor of <em>agr</em> system abbreviated as RIP, was discovered and tested in 1993 [20]. Heptapeptide RIP has been proved to be an effective inhibitor to reduce virulence and prevent infections of <em>S. aureus</em> [<a href="#r18">18</a>, <a href="#r21">21</a>]. </p>
 +
<p class="content">The sequence of RIP was  identified as YSPXTNF, where X can be a Cys, a Trp, or a modified amino acid [<a href="#r18">18</a>]. It is similar to the NH2 terminal sequence of RAP IKKYKPITN  [<a href="#r22">22</a>], the natural ligand of TRAP receptor. Therefore, it is hypothesized that  RAP and RIP bind to the same receptor, TRAP [<a href="#r23">23</a>]. Through competing with RAP on  binding to TRAP and thus interfering with the activation of <em>agr</em> system, RIP inhibits the expression of RNAIII and the toxin genes in <em>S.  aureus</em>. Based on the fact that TRAP is highly conserved among <em>S. aureus</em> strains, RIP is supposed to inhibit  pathogenesis of most <em>S. aureus</em> strains infections [<a href="#r18">18</a>]. </p>
 +
<p class="content">A synthetic RIP derivative  YKPWTNF was tested for its ability to inhibit RNAIII synthesis <em>in vitro</em> and to prevent infection <em>in vivo </em>[<a href="#r23">23</a>]. The  natural RIP and its synthetic derivatives have higher binding affinity to TRAP than  RAP, and therefore would inhibit the normal pathway of TRAP by induced  by RAP [<a href="#r24">24</a>]. Researches indicated that RIP YKPWTNF can suppress  virulence of any <em>S. aureus</em> strain so  far tested [<a href="#r18">18</a>, <a href="#r23">23</a>].
 +
<br />
 +
 
 +
  <br/>
 +
<div id="figure"><img align="middle" src="http://2010.igem.org/wiki/images/7/72/HKUST_BG_Fig-5.png" width="700" /></div>
 +
</p>
-
<p class="h2"><b>4.Protocol list</b></p>
+
<p class="content">A 13-residue  dermaseptin derivative DD13, identified as ALWKTLLKKVLKA, is believed to have  the ability to kill bacteria via membrane disruption. The synthetic hybrid construct  DD13-RIP derivative ALWKTLLKKVLKAYSPWTNF-CONH2 has been tested for  the ability to suppress quorum sensing of <em>S. aureus</em> <em>in vitro</em> and shows  synergistic effect comparing with single synthetic RIP derivative YKPWTNF-CONH2  [<a href="#r25">25</a>]. Hence, by functionally expressing the hybrid peptide DD13-RIP  derivative, <em>S. aureus</em> infections may  be inhibited through restraining quorum sensing systems. However, since the  hybrid construct is made on a DNA level, after transcription and translation, the  synthetic RIP will be in the form of ALWKTLLKKVLKAYSPWTNF-COOH other than the  synthetic one ALWKTLLKKVLKAYSPWTNF-CONH2, which may lead to an  altered efficiency.</p>
 +
<!--background end-->
 +
<!--reference-->
-
<p class="content">Heat-shock competent cell preparation  heat-shock transformation<br />
+
<p class="h1"><a name="6"></a><b>6.References:</b></p>
-
  <a href="http://www.promega.com/guides/subcloning_guide/_row/transforming_bacteria_row.pdf">http://www.promega.com/guides/subcloning_guide/_row/transforming_bacteria_row.pdf</a><br />
+
-
  Electro-competent cell preparation and  electro-transformation<br />
+
-
  <a href="http://www.its.caltech.edu/~bjorker/Protocols/Prep_of_electocomp_cells.pdf">http://www.its.caltech.edu/~bjorker/Protocols/Prep_of_electocomp_cells.pdf</a><br />
+
-
  Mini-prep<br />
+
-
  FavorPrep™&nbsp;Plasmid  DNA Extraction Mini Kit<br />
+
-
  Midi-prep<br />
+
-
  <a href="http://www.google.com.hk/url?url=http://www.favorgen.com/products_for_res_nae_faPDE_Midi.htm&amp;rct=j&amp;sa=X&amp;ei=BMeyTPfIDoKmcOaY9IUH&amp;ved=0CBwQzgQoADAA&amp;q=favorgen+favor+prep+plasmid+dna+extraction&amp;usg=AFQjCNG4IsyGXbvPbZHmIYbK9PYiWNlkUg">&nbsp;FavorPrep™&nbsp;Plasmid DNA  Extraction Midi/Maxi</a> Kit<br />
+
-
  Genomic DNA extraction from L.plantarum<br />
+
-
  <a href="http://www.springerlink.com/content/j2g06724067924p4/#section=86476&amp;page=1">http://www.springerlink.com/content/j2g06724067924p4/#section=86476&amp;page=1</a><br />
+
-
  PCR<br />
+
-
  <a href="http://openwetware.org/wiki/PCR">http://openwetware.org/wiki/PCR</a><br />
+
-
  Fusion PCR<br />
+
-
  <a href="http://www.fgsc.net/Aspergillus/Oakley_PCR_protocol.pdf">http://www.fgsc.net/Aspergillus/Oakley_PCR_protocol.pdf</a><br />
+
-
  Colony PCR<br />
+
-
  <a href="http://openwetware.org/wiki/Endy:Colony_PCR">http://openwetware.org/wiki/Endy:Colony_PCR</a><br />
+
-
  Restriction digest<br />
+
-
  <a href="http://openwetware.org/wiki/Silver:_Restriction_Digest">http://openwetware.org/wiki/Silver:_Restriction_Digest</a><br />
+
-
  Ethanol precipitation<br />
+
-
  <a href="http://openwetware.org/wiki/Ethanol_precipitation_of_nucleic_acids">http://openwetware.org/wiki/Ethanol_precipitation_of_nucleic_acids</a><br />
+
-
  Kit purification<br />
+
-
  FavorPrep™&nbsp;GEL/PCR  Purification Mini Kit<br />
+
-
  Gel purification<br />
+
-
  FavorPrep™&nbsp;GEL/PCR  Purification Mini Kit<br />
+
-
  Vector dephosphorylation<br />
+
-
  <a href="http://www.neb.com/nebecomm/products_intl/protocol76.asp">http://www.neb.com/nebecomm/products_intl/protocol76.asp</a><br />
+
-
  Ligation <br />
+
-
  <a href="http://openwetware.org/wiki/DNA_Ligation">http://openwetware.org/wiki/DNA_Ligation</a><br />
+
-
  Agarose gel electrophoresis<br />
+
-
  <a href="http://www.methodbook.net/dna/agarogel.html">http://www.methodbook.net/dna/agarogel.html</a><br />
+
-
  DNA PAGE (Polyacrylamide gel  electrophoresis)<br />
+
-
  <a href="http://microbiology.ucdavis.edu/heyer/protocols/dna%20page.pdf">http://microbiology.ucdavis.edu/heyer/protocols/dna%20page.pdf</a><br />
+
-
  GUS assay<br />
+
-
  <strong>[<a href="#r1">1</a>]</strong><br />
+
-
  Flag-tag assay and western blot<br />
+
-
  <a href="http://www.biomol.de/details/AD/protocol-GPCR-WB.pdf" target="_blank">http://www.biomol.de/details/AD/protocol-GPCR-WB.pdf</a></p>
+
-
<p class="h2"><a name="5"></a><b>5.References:</b></p>
 
<ol class="reference">
<ol class="reference">
-
<li><p><a name="r1"></a>[1] Johnsborg, O., Diep, D. B. &amp; Nes,  N. F. (2003). Structural analysis of the peptide pheromone receptor plnB, a  histidine protein kinase from <em>Lactobacillus plantarum</em><em>. Journal of Bacteriology, </em><em>185</em>&nbsp;(23),  6913–6920.</p></li>
+
  <li><a name="r1"></a>Ryan, K.J., Ray, C.G., &amp; Ahmad, N. (2004). Sherris  medical microbiology. McGraw-Hill.&nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
-
 
+
  <br />
-
<li><p><a name="r2"></a>[2] Kleerebezem, M., Boekhorst, J., Kranenburg, R.V., MolenaarD. &amp; Kuipers, O.P. (2003) Complete genome sequence of <em>Lactobacillus plantarum</em> WCFS1. <em>Proceedings of the National Academy of Sciences</em>, 100(4), 1990-1995.</p></li>
+
 
-
 
+
  <li><a name="r2"></a>Kluytmans, J., van Belkum, A., &amp; Verbrugh, H. (1997).  Nasal carriage of <em>Staphylococcus aureus</em>: epidemiology, underlying mechanisms, and  associated risks. <em>Clin Microbiol Rev</em>, <em>10</em>(3), 505-520. &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
-
<li><p><a name="r3"></a>[3] Geisinger,  E., George, E.A., Muir, T.W, &amp; Novick, R.P. (2008) Identification of ligand  specificity determinants in agrC, the <em>Staphylococcus aureus</em> quorum-sensing receptor. 283(14), 8930–8938.</p></li>
+
  <br />
-
 
+
 
-
<li><p><a name="r4"></a>[4] Novick, R.P., Projan, S.J., Kornblu, J., Ross, H.F. &amp; Ji, G. (1995) The agr P2 operon: an autocatalytic sensory transduction system  in<em> Staphylococcus aureus</em>. 248(4),&nbsp;446-458.</p></li>
+
  <li><a name="r3"></a>Franklin, D., &amp; Lowy, F.D. (1998). <em>Staphylococcus aureus</em> infections. <em>N Engl J Med</em>,&nbsp;<em>339</em>(27), 520-532. &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
-
</ol>
+
  <br />
-
 
+
 
 +
  <li><a name="r4"></a>Kiran, M.D., Adikesavan, N.V., Cirioni, O., Giacometti, A., Silvestri, C., Scalise,  G., Ghiselli, R., Saba, V., Orlando, F., Shoham, M., &amp; Balaban, N. (2008). Discovery of a  quorum-sensing inhibitor of drug-resistant Staphylococcal infections by structure-based  virtual screening. <em>Mol Pharmacol</em>, <em>73</em>(5), 718-726.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r5"></a>Sturme, M.H.J., Francke, C., Siezen, R.J., de Vos, W.M., &amp; Kleerebezem, M. (2007). Making sense of  quorum sensing in <em>lactobacilli</em>: a special focus on <em>lactobacillus plantarum wcfs1</em>.&nbsp;<em>Microbiology</em>,&nbsp;153,  3939–3947.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r6"></a>Kleerebezem, M.,  Quadri, L. E. N., Kuipers, O. P. &amp; De Vos, W. M.(1997). Quorum sensing  by peptide pheromones and two-componentsignal-transduction systems in  Gram-positive bacteria. <em>Molecular  Microbiology</em>, l24, 895–904.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r7"></a>Morfeldt, E., Janzon, L., Arvidson, S.,  and Lofdahl, S. (1988) Cloning of a chromosomal locus (exp) which regulates the  expression of several exoprotein genes in <em>Staphylococcus  aureus</em>. <em>Mol Gen Genet</em>, 211,  435–440.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r8"></a>Ji, G., Beavis, R.C., and Novick, R.P. (1995) Cell density control of staphylococcal virulence mediated by an octapeptide  pheromone. <em>Proc Natl Acad Sci USA</em>,  92, 12055–12059.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r9"></a>Novick,  R.P., Ross, H.F., Projan, S.J., Kornblum, J., Kreiswirth, B., &amp; Moghazeh, S. (1993). Synthesis of  Staphylococcal virulence factors is controlled by a regulatory RNA  molecule.&nbsp;<em>EMBO J</em>,&nbsp;<em>12</em>(10), 3967-3975.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r10"></a>Koenig, R.L., Ray, J.L., Maleki, S.J., Smeltzer, M.S.Hurlburt, B.K. (2004). <em>Staphylococcus aureus</em> AgrA binding to  the RNAIII-<em>agr</em> regulatory  region.&nbsp;<em>J of Bacteriol</em>, <em>186</em>(22), 7549-7555.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r11"></a>Korem, M., Sheoran ,  A.S., Gov, Y., Tzipori, S., Borovok, I., &amp; Balaban, N. (2003).  Characterization of RAP, a quorum sensing activator of <em>Staphylococcus aureus</em>.&nbsp;<em>FEMS Microbiol Lett</em>, <em>223</em>(2), 167-175.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r12"></a>Balaban, N., Goldkorn, T., Gov, Y., Hirshberg, M., Koyfman, N., Matthews, H.R., Nhan, R.T., Singh, B., Uziel, O. (2001). Regulation of <em>Staphylococcus aureus</em> pathogenesis via  target of RNAIII-activating protein (TRAP).&nbsp;<em>J Biol Chem</em>,&nbsp;<em>276</em>(4), 2658-2667. &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r13"></a>Novick RP,  Projan SJ, Kornblum J, Ross HF, Ji G, et al. 1995. The agr P2 operon: an  autocatalytic sensory transduction system in taphylococcus aureus. <em>Mol. Gen. Genet</em>, 248, 446–58.   &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r14"></a>Novick, R. P. &amp;  Geisinger, E. (2008). Quorum sensing in <em>Staphylococci</em><em>. Annual Review of Genetics, 42,</em><em>&nbsp;</em>541–64. &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a> </li>
 +
  <br />
 +
 
 +
  <li><a name="r15"></a>GovY., Borovok, I., Korem, M., Singh, V.K., Jayaswal, R.K., Wilkinson, B.J., Rich, S.M., &amp;  Balaban, N. (2004). Quorum  sensing in <em>Staphylococci</em> is regulated  via phosphorylation of three conserved histidine residues.&nbsp;<em>J Biol Chem</em>, <em>279</em>(15), 14665-14672. &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a> </li>
 +
  <br />
 +
 
 +
  <li><a name="r16"></a>Geisinger, E., George, E.A., Muir, T.W., &amp; Novick, R.P.(2008). Identification of ligand  specificity determinants in agrc, the <em>staphylococcus aureus</em> quorum-sensing receptor .&nbsp;<em>The  Journal of Biological Chemistry</em>,&nbsp;283(14), 8930–8938. &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r17"></a>Jarraud, S.,  Mougel, C., Thioulouse, J., &amp; Lina, G. (2002). Relationships between <em>staphylococcus aureus</em> genetic  background, virulence factors, agr groups (alleles), and human disease .&nbsp;<em>Infection and Immunity</em>,&nbsp;70(2),  631–641.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r18"></a>Gov, Y., Bitler, A.,  Dell'Acqua, G., Torres, J.V.,  &amp; Balaban, N. (2001). RNAIII inhibiting peptide (RIP), a global inhibitor of <em>Staphylococcus aureus</em> pathogenesis:  structure and function analysis.&nbsp;<em>Peptides</em>,&nbsp;<em>22</em>(10), 1609-1620.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r19"></a>Johnsborg, O.,  Diep, D. B. &amp; Nes, N. F. (2003). Structural analysis of the peptide  pheromone receptor plnB, a histidine protein kinase from <em>Lactobacillus plantarum</em><em>. Journal of  Bacteriology, 185</em><em>&nbsp;</em>(23),  6913–6920.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r20"></a>Balaban, N., &amp;  Novick, R.P. (1995). Autocrine regulation of toxin synthesis by <em>Staphylococcus aureus</em>.&nbsp;<em>Proc Natl Acad Sci U S A</em>,&nbsp;<em>92</em>(5), 1619-1623.    &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r21"></a>Costerton JW, Montanaro L, Arciola CR. (2007). Bacterial  communications in implant infections: a target for an intelligence war.<em> Int J Artif Organs.</em> 30(9):757-63.&nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r22"></a>Novick, R.P., Ross, H.F., Figueiredo, A.M.S., Abramochkin, G., Muir, T., Balaban, N., Singh, B.,  Goldkorn, T., Rasooly, A., Torres, J.V., &amp; Uziel, O. (2000). Activation and  inhibition of the Staphylococcal<em> agr</em> system.&nbsp;<em>Science</em>,&nbsp;<em>287</em>, 391.&nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a> </li>
 +
  <br />
 +
 
 +
  <li><a name="r23"></a>Balaban, N., Collins, L.V., Cullor, J.S., Hume, E.B., Medina-Acosta,  E., Vieira da Motta, O., O'Callaghan, R.,  Rossitto, P.V., Shirtliff, M.E., Serafim da Silveira, L., Tarkowski, A., &amp;  Torres, J.V. (2000). Prevention  of diseases caused by <em>Staphylococcus aureus</em> using the peptide RIP.&nbsp;<em>Peptides</em>,&nbsp;<em>21</em>(9), 1301-1311.&nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a> </li>
 +
  <br />
 +
 
 +
  <li><a name="r24"></a>Balaban, N.,  Goldkorn, T., Nhan, R.T., Dang,  L.B., Scott, S., Ridgley, R.M., Rasooly, A., Wright, S.C., Larrick, J.W., Rasooly, R., &amp; Carlson, J.R. (1998). Autoinducer  of virulence as a target for vaccine and therapy against <em>Staphylococcus aureus</em>. <em>Science</em>,&nbsp;<em>280</em>(5362), 438-440. &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
  <br />
 +
 
 +
  <li><a name="r25"></a>Balaban, N., Gov, Y., Giacometti, A., Cirioni, O., Ghiselli, R., Mocchegiani, F., Orlando, F., D'Amato, G., Saba, V., Scalise, G., Bernes, S., &amp; Mor, A. (2004). A chimeric peptide  composed of a dermaseptin derivative and an RNAIII-inhibiting peptide prevents  graft-associated infections by antibiotic-resistant <em>Staphylococci</em>.&nbsp;<em>Antimicrob  Agents Chemother</em>,&nbsp;<em>48</em>(7),  2544-2550.  &nbsp;&nbsp;&nbsp;&nbsp;<a href="javascript:history.go(-1)">Back</a></li>
 +
 
 +
  <br />
 +
  </ol>
 +
</div>
 +
<!--reference-->
</div>
</div>
</body>
</body>
</html>
</html>

Latest revision as of 14:41, 24 October 2010

Team: HKUST

Background

1. Staphylococcus aureus
2. Two-Component Signaling System (TCS)
3. Staphylococcus aureus virulence regulating mechanism: AgrBDCA
4. Lactobacillus plantarum WCFS1 quorum sensing system: PlnABCD
5. RNAIII inhibiting peptide (RIP) of Staphylococcus aureus
6. References

1. Staphylococcus aureus

Staphylococcus aureus is a facultatively anaerobic, gram-positive coccus which forms large round yellow colonies when grown on agar plate [1]. It was reported that approximately 20% of human population are long-term carriers of at least one S. aureus strain [2]. As a versatile and potential dangerous pathogen, S. aureus can cause a wide range of diseases varying from skin flora infections to invasive infections such as sepsis syndrome [1, 3]. Many of these diseases are associated with regulation factors involved in toxin synthesis in S. aureus. These bacterial regulation factors play critical roles in virulence production; the strains that are defective in producing toxin regulation factors always show weakened virulence [4]. The aforementioned information suggests a novel therapy, which involves the inhibition of toxin regulation factors, for diseases caused by S. aureus.

2. Two-Component Signaling System (TCS)

In many bacterial species, Two-Component Signaling System (TCS) plays a prominent role in quorum sensing. A classical TCS consists of a transmembrane receptor, which is a histidine protein kinase (HPK), and a cytoplasmic response regulator (RR) [5]. When bound by autoinducing peptides (AIP), the transmembrane receptor HPK passes a phosphate group to the downstream cytoplasmic response regulator RR. The cytoplasmic response regulator will then up-regulates or down-regulates various virulence and bacteriocin productions under specific situations [6]. Figure 1 below illustrates the components and transduction pathways of a typical two-component signaling system:

3. Staphylococcus aureus virulence regulating mechanism: AgrBDCA

A chromosomal locus agr system in S. aureus consists of two transcription units RNA II and RNA III; they are responsible for self-regulation and effect response respectively [7, 8]. RNA II, driven by P2 promoter, is a polycistronic mRNA containing four open reading frames: agrB, agrD, agrC and agrA, and are responsible for agr quorum sensing in S. aureus [9]. AgrB is an integral membrane protein; AgrD is a pro-peptide secreted with the aid of AgrB, yielding an octapeptide pheromone autoinducing peptide (AIP); AgrC and AgrA compose a bacterial two-component signal transduction system, in which AgrC, a membrane associated protein, serves as a receptor and AgrA acts as a DNA-binding response regulator[10,11, 12]. Once the transmembrane receptor domain of AgrC is bound by AIP, its cytoplasmic HPK domain will pass a phosphate group downwards to AgrA, the response regulator. AgrA functions as a transcription factor and activates the two promoters P2 and P3 [13, 14]. RNA III, driven by P3 promoter, acts as a regulatory factor to activate numerous toxin production genes and encode for β-hemolysin [15]. Figure 2 below shows the pathways involved in S. aureus AgrBDCA system:

It has been reported that there are altogether 4 types of agr loci; each type of agr locus encodes AgrC and corresponding AIP slightly different from others. AgrC is only activated by AIP belonging to the same group and is usually inhibited by AIP from other groups [16]. Different groups of AgrC and their corresponding AIPs are highly involved in various human diseases or infections. For example, food poisoning caused by staphylococcal enterotoxins is usually associated with agr group I and agr group II S. aureus; toxic shock syndrome toxin 1 (TSST-1), which results in high fever, low blood pressure and malaise of human, is produced by agr group III S. aureus [17].

The synthesis of RNAIII is regulated by two Staphylococcal quorum sensing systems SQS 1 and SQS 2. SQS 1 consists of a 277-amino-acid RNAIII-activating protein (RAP) and a 167-amino-acid target of RNAIII-activating protein (TRAP) which is membrane associated [15]; SQS 2 consists of molecules encoded by agr system [18]. As S. aureus multiplies, RAP is secreted. Once RAP reaches a threshold concentration, it will induce the histidine phosphorylation of TRAP, which leads to the activation of agr system and therefore induces the production of RNAII during the mid-exponential growth phase [15]. After the activation of agr system, phosphorylation of AgrC is induced by secreted AIP, followed by the production of RNAIII [18].

The characteristics of S. aureus AgrBDCA system make it possible to build an engineered AIP sensor on the membrane of a non-pathogenic bacterial species. The engineered AIP sensor, localized on the non-virulent bacteria, could therefore detect the presence of AIP molecules released by S. aureus. Upon receiving this signal, the non-virulent bacteria could be automatically induced to synthesize AIP’s competitor, RNAIII inhibiting peptide (RIP), and hence, repress the activation of AgrC and toxin production in S. aureus.

4. Lactobacillus plantarum WCFS1 quorum sensing system: PlnABCD

Several agr-like quorum sensing systems in Lactobacillus plantarum WCFS1 have been identified, among which the PlnABCD system is the best studied [5]. The PlnABCD system, similar to the AgrBDCA system, is a self-regulating system in L. plantarum WCFS1. The transmembrane receptor HPK PlnB, together with two response regulators PlnC and PlnD, constitutes a two-component signaling system (TCS) in L. plantarum WCFS1. PlnA, the inducing peptide (IP) of L. plantarum WCFS1, activates PlnB and thereby phosphoylates PlnC or PlnD. PlnC and PlnD are upregulator and downreuglater of plnA promoter respectively, and therefore, would activate/suppress the transcription initiation of plnABCD. The transcription of plnABCD is usually associated with Lactobacillus plantarum WCFS1 bacteriocin production [19]. Figure 3 below shows the pathways involved in Lactobacillus plantarum WCFS1 PlnABCD system:

Transmembrane signal sensors of both PlnABCD and AgrBDCA systems, i.e. PlnB (of L. plantarum WCFS1) and AgrC (of S. aureus), belong to a same subgroup of histidine protein kinases – the HPK10 subfamily. PlnB and AgrC share a highly homologous cytoplasmic HPK domain regarding amino acid sequence, tertiary structure and biochemical function [14, 19]. However, the sequence of PlnB and AgrC’s transmembrane domain are distinct from each other, probably due to the ligand binding specificity required by their corresponding signaling molecules.

Based on the homology between AgrBDCA and PlnABCD at the cytoplasmic HPK domain, we decided to construct a chimeric AIP sensor in Lactobacillus. Such a fusion receptor would link the transmembrane signal sensing domain of AgrCand the cytoplasmic HPK domain of PlnB. By localizing such a fusion protein on Lactobacillus plasma membrane, it is hoped that Lactobacillus can successfully detect the presence of autoinducing peptides (AIPs) produced by S. aureus. Upon the detection of AIP molecules, the chimeric protein kinase will transduce the signal to L. plantarum WCFS1intrinsic downstream pathways.

5. RNAIII inhibiting peptide (RIP) of Staphylococcus aureus

The S. aureus RN833 is a mutant strain of Foggi (now listed as RN831) as it no longer produces α-hemolysin. Instead, RNAIII inhibiting peptide, an inhibitor of agr system abbreviated as RIP, was discovered and tested in 1993 [20]. Heptapeptide RIP has been proved to be an effective inhibitor to reduce virulence and prevent infections of S. aureus [18, 21].

The sequence of RIP was identified as YSPXTNF, where X can be a Cys, a Trp, or a modified amino acid [18]. It is similar to the NH2 terminal sequence of RAP IKKYKPITN [22], the natural ligand of TRAP receptor. Therefore, it is hypothesized that RAP and RIP bind to the same receptor, TRAP [23]. Through competing with RAP on binding to TRAP and thus interfering with the activation of agr system, RIP inhibits the expression of RNAIII and the toxin genes in S. aureus. Based on the fact that TRAP is highly conserved among S. aureus strains, RIP is supposed to inhibit pathogenesis of most S. aureus strains infections [18].

A synthetic RIP derivative YKPWTNF was tested for its ability to inhibit RNAIII synthesis in vitro and to prevent infection in vivo [23]. The natural RIP and its synthetic derivatives have higher binding affinity to TRAP than RAP, and therefore would inhibit the normal pathway of TRAP by induced by RAP [24]. Researches indicated that RIP YKPWTNF can suppress virulence of any S. aureus strain so far tested [18, 23].

A 13-residue dermaseptin derivative DD13, identified as ALWKTLLKKVLKA, is believed to have the ability to kill bacteria via membrane disruption. The synthetic hybrid construct DD13-RIP derivative ALWKTLLKKVLKAYSPWTNF-CONH2 has been tested for the ability to suppress quorum sensing of S. aureus in vitro and shows synergistic effect comparing with single synthetic RIP derivative YKPWTNF-CONH2 [25]. Hence, by functionally expressing the hybrid peptide DD13-RIP derivative, S. aureus infections may be inhibited through restraining quorum sensing systems. However, since the hybrid construct is made on a DNA level, after transcription and translation, the synthetic RIP will be in the form of ALWKTLLKKVLKAYSPWTNF-COOH other than the synthetic one ALWKTLLKKVLKAYSPWTNF-CONH2, which may lead to an altered efficiency.

6.References:

  1. Ryan, K.J., Ray, C.G., & Ahmad, N. (2004). Sherris medical microbiology. McGraw-Hill.    Back

  2. Kluytmans, J., van Belkum, A., & Verbrugh, H. (1997). Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks. Clin Microbiol Rev, 10(3), 505-520.     Back

  3. Franklin, D., & Lowy, F.D. (1998). Staphylococcus aureus infections. N Engl J Med339(27), 520-532.     Back

  4. Kiran, M.D., Adikesavan, N.V., Cirioni, O., Giacometti, A., Silvestri, C., Scalise, G., Ghiselli, R., Saba, V., Orlando, F., Shoham, M., & Balaban, N. (2008). Discovery of a quorum-sensing inhibitor of drug-resistant Staphylococcal infections by structure-based virtual screening. Mol Pharmacol, 73(5), 718-726.      Back

  5. Sturme, M.H.J., Francke, C., Siezen, R.J., de Vos, W.M., & Kleerebezem, M. (2007). Making sense of quorum sensing in lactobacilli: a special focus on lactobacillus plantarum wcfs1Microbiology, 153, 3939–3947.      Back

  6. Kleerebezem, M., Quadri, L. E. N., Kuipers, O. P. & De Vos, W. M.(1997). Quorum sensing by peptide pheromones and two-componentsignal-transduction systems in Gram-positive bacteria. Molecular Microbiology, l24, 895–904.      Back

  7. Morfeldt, E., Janzon, L., Arvidson, S., and Lofdahl, S. (1988) Cloning of a chromosomal locus (exp) which regulates the expression of several exoprotein genes in Staphylococcus aureus. Mol Gen Genet, 211, 435–440.      Back

  8. Ji, G., Beavis, R.C., and Novick, R.P. (1995) Cell density control of staphylococcal virulence mediated by an octapeptide pheromone. Proc Natl Acad Sci USA, 92, 12055–12059.      Back

  9. Novick, R.P., Ross, H.F., Projan, S.J., Kornblum, J., Kreiswirth, B., & Moghazeh, S. (1993). Synthesis of Staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J12(10), 3967-3975.      Back

  10. Koenig, R.L., Ray, J.L., Maleki, S.J., Smeltzer, M.S., Hurlburt, B.K. (2004). Staphylococcus aureus AgrA binding to the RNAIII-agr regulatory region. J of Bacteriol, 186(22), 7549-7555.      Back

  11. Korem, M., Sheoran , A.S., Gov, Y., Tzipori, S., Borovok, I., & Balaban, N. (2003). Characterization of RAP, a quorum sensing activator of Staphylococcus aureusFEMS Microbiol Lett, 223(2), 167-175.      Back

  12. Balaban, N., Goldkorn, T., Gov, Y., Hirshberg, M., Koyfman, N., Matthews, H.R., Nhan, R.T., Singh, B., Uziel, O. (2001). Regulation of Staphylococcus aureus pathogenesis via target of RNAIII-activating protein (TRAP). J Biol Chem276(4), 2658-2667.     Back

  13. Novick RP, Projan SJ, Kornblum J, Ross HF, Ji G, et al. 1995. The agr P2 operon: an autocatalytic sensory transduction system in taphylococcus aureus. Mol. Gen. Genet, 248, 446–58.       Back

  14. Novick, R. P. & Geisinger, E. (2008). Quorum sensing in Staphylococci. Annual Review of Genetics, 42, 541–64.     Back 

  15. Gov, Y., Borovok, I., Korem, M., Singh, V.K., Jayaswal, R.K., Wilkinson, B.J., Rich, S.M., & Balaban, N. (2004). Quorum sensing in Staphylococci is regulated via phosphorylation of three conserved histidine residues. J Biol Chem, 279(15), 14665-14672.     Back 

  16. Geisinger, E., George, E.A., Muir, T.W., & Novick, R.P.(2008). Identification of ligand specificity determinants in agrc, the staphylococcus aureus quorum-sensing receptor . The Journal of Biological Chemistry, 283(14), 8930–8938.     Back

  17. Jarraud, S., Mougel, C., Thioulouse, J., & Lina, G. (2002). Relationships between staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease . Infection and Immunity, 70(2), 631–641.      Back

  18. Gov, Y., Bitler, A., Dell'Acqua, G., Torres, J.V., & Balaban, N. (2001). RNAIII inhibiting peptide (RIP), a global inhibitor of Staphylococcus aureus pathogenesis: structure and function analysis. Peptides22(10), 1609-1620.      Back

  19. Johnsborg, O., Diep, D. B. & Nes, N. F. (2003). Structural analysis of the peptide pheromone receptor plnB, a histidine protein kinase from Lactobacillus plantarum. Journal of Bacteriology, 185 (23), 6913–6920.      Back

  20. Balaban, N., & Novick, R.P. (1995). Autocrine regulation of toxin synthesis by Staphylococcus aureusProc Natl Acad Sci U S A92(5), 1619-1623.        Back

  21. Costerton JW, Montanaro L, Arciola CR. (2007). Bacterial communications in implant infections: a target for an intelligence war. Int J Artif Organs. 30(9):757-63.    Back

  22. Novick, R.P., Ross, H.F., Figueiredo, A.M.S., Abramochkin, G., Muir, T., Balaban, N., Singh, B., Goldkorn, T., Rasooly, A., Torres, J.V., & Uziel, O. (2000). Activation and inhibition of the Staphylococcal agr system. Science287, 391.    Back 

  23. Balaban, N., Collins, L.V., Cullor, J.S., Hume, E.B., Medina-Acosta, E., Vieira da Motta, O., O'Callaghan, R., Rossitto, P.V., Shirtliff, M.E., Serafim da Silveira, L., Tarkowski, A., & Torres, J.V. (2000). Prevention of diseases caused by Staphylococcus aureus using the peptide RIP. Peptides21(9), 1301-1311.    Back 

  24. Balaban, N., Goldkorn, T., Nhan, R.T., Dang, L.B., Scott, S., Ridgley, R.M., Rasooly, A., Wright, S.C., Larrick, J.W., Rasooly, R., & Carlson, J.R. (1998). Autoinducer of virulence as a target for vaccine and therapy against Staphylococcus aureus. Science280(5362), 438-440.     Back

  25. Balaban, N., Gov, Y., Giacometti, A., Cirioni, O., Ghiselli, R., Mocchegiani, F., Orlando, F., D'Amato, G., Saba, V., Scalise, G., Bernes, S., & Mor, A. (2004). A chimeric peptide composed of a dermaseptin derivative and an RNAIII-inhibiting peptide prevents graft-associated infections by antibiotic-resistant StaphylococciAntimicrob Agents Chemother48(7), 2544-2550.      Back