Team:Freiburg Bioware/testpage

From 2010.igem.org

(Difference between revisions)
Line 122: Line 122:
<div class="box_right">
<div class="box_right">
</html>
</html>
-
==== 18. Labortag 01.06.2010: Modifying MCS of pAAV_MCS vector====
+
==September==
-
<br>
+
===107. labday 01.09.2010===
-
Investigators: Anissa, Adrian, Bea, Chris W., Hanna, Patrick, Volker, Sven <br>
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Loop insertion BioBricks: Sequencing results</b></p>====
 +
<b>Investigator: Achim, Anna <br /></b>
 +
<p style="font-size:13px; color:#66bbff;">Comment: Sequencing results of Loop insertion BioBricks from 31.08.10; the following clones were sent for sequencing: </p>
 +
<br />
 +
*2: 453 BAP: No Insert
 +
[[File:Freiburg10 453 bap.JPG|400px]]
 +
*3:453 His: Insert okay
 +
[[File:Freiburg10 453 his.JPG|400px]]
 +
*5: 453 RGD: Mutation in 453 upstream region
 +
[[File:Freiburg10 453 rgd.JPG|400px]]
 +
*7: 587 BAP: Mutation in Bap insert
 +
[[File:Freiburg10 587 bap.JPG|400px]]
 +
*9:587 His: Insert okay
 +
[[File:Freiburg10 587 his.JPG|400px]]
 +
*11:587 KO BAP : Insert okay
 +
[[File:Freiburg10 587 KO bap.JPG|400px]]
 +
*13:587 KO empty : Insert okay
 +
[[File:Freiburg10 587 KO empty.JPG|400px]]
 +
*16: 587 KO his: Mutation in 587 KO
 +
[[File:Freiburg10 587 ko his.JPG|400px]]
 +
*17: 587 KO rgd: No insert
 +
[[File:Freiburg10 587 KO rgd.JPG|400px]]
 +
*19 :587 RGD: Insert okay
 +
[[File:Freiburg10 587 rgd.JPG|400px]]
 +
*25: 587 Z34C: Mutation in downstream 587 region
 +
[[File:Freiburg10 587 z34c.JPG|400px]]
-
'''Oligos received from Sigma-Aldrich''' <br>
+
<b>Mini-Preps:<br /></b>
-
(right ITR of pAAV_MCS, left ITR of pAAV_MCS and MCS RFC25 for pAAV)
+
-
<br>
+
-
*Hybrization of received oligos: MCS RFC25 for pAAV (forward) and MCS RFC25 for pAAV (reverse)
+
-
*Centrifuge tubes prior to open tubes (13.000 rpm, 30 sec)
+
-
**MCS RFC25 for pAAV (forward): Add 92µL Millipore H<sub>2</sub>O (Volume on obtained sheet)
+
-
**MCS RFC25 for pAAV (reverse): Add 394 µL Millipore H<sub>2</sub>O (Volume on obtained sheet)
+
-
*Vortex the resuspended DNA
+
-
*Make aliquots of both Oligos (1:10): 10 µL Oligo + 90 µLH<sub>2</sub>O (final volume usually 100 µl)
+
-
*Mix together(into PCR-tube):
+
-
<br>
+
-
{| border="1"
+
New Mini-Preps of the samples with no/mutated insert were prepared. The following clones were used:
-
| align="right" | '''Volume/µL''' ||align="right"| '''solution'''
+
-
|-
+
-
|  align="right" | 10 (1:10)||align="right"|Oligo 1: MCS RFC25 for pAAV (forward)
+
-
|-
+
-
|  align="right" |10||align="right"|Oligo 2: MCS RFC25 for pAAV (reverse)
+
-
|-
+
-
|  align="right" |4||align="right"| 100mM TrisHCl pH8
+
-
|-
+
-
|  align="right" |8||align="right"|5mM MgCl2
+
-
|-
+
-
|  align="right" |8||align="right"| H20
+
-
|}
+
-
<br>
+
-
* Program: ORIGAMI 1 modified for long oligos:
+
-
** 1    99°C    7’
+
-
** 2    99°C    1’
+
-
** -1°C  R=0.3 °/s
+
-
** Goto 2 rep 74
+
-
** Hold 4°C
+
-
<br>
+
-
*While hybridization of oligos is performed, digestion of pAAV_MCS vector can be conducted <br>
+
-
following standard protocol for cloning.
+
-
<br>
+
-
*Title: Ligation MCS_Oligo with pAAV_MCS
+
-
*Plasmid: pAAV_MCS
+
-
*Buffer used: 3
+
-
*BSA: Yes
+
-
*Measure DNA-concentration with Nanodrop
+
-
*DNA-Concentration:260 ng/uL
+
-
*Restriction-enzyms used: http://www.neb.com/nebecomm/DoubleDigestCalculator.asp
+
-
Enzyme1 (Nr. Lab: 152): ClaI
+
-
Enzyme2 (Nr. Lab: 15): BglII   
+
-
<br>
+
-
*Digestion components :
+
{| border="1"
{| border="1"
-
| '''components'''  || align="right" | '''pAAV_MCS'''
 
-
|-
 
-
| DNA  ||  align="right" | 4
 
-
|-
 
-
| BSA (10x) ||  align="right" |3
 
-
|-
 
-
| Buffer 3 (10x)||  align="right" |3
 
-
|-
 
-
|Enzyme: ClaI (no.Lab:152)||  align="right" |2
 
-
|-
 
-
|Enzyme: BglII (no.Lab:15)||  align="right" |1
 
-
|-
 
-
|H<sub>2</sub>O||  align="right" |17
 
-
|-
 
-
|'''Total volume'''||  align="right" |<b>30</b>
 
-
|}
 
-
*Incubate for 1,5 h at 37°C
 
-
<br>
 
-
*1% Agarose gel
 
-
**1% agarose gel was prepared, gel ran for 45 minutes( first: 90V, after 15 minutes: 115 V)
 
-
<br>
 
-
*Amount of loading dye added
 
-
{| border="1"
 
-
|<b>sample/µL </b>||align="right"| '''loading dye/µL'''
 
-
|-
 
-
| marker: 8 ||align="right"|contains loading dye
 
-
|-
 
-
|pAAV_MCS: 24 ||align="right"|6
 
-
|-
 
-
|}
 
-
<br>
 
-
*Expected size of fragments
 
-
{| border="1"
+
|align="left" | '''Components''' ||align="left"| '''453 BAP''' ||align="left"| '''587 BAP''' ||align="left"| '''453 RGD'''||align="left"| '''587 KO RGD'''||align="left"| '''587 KO HIS'''||align="left"| '''453 Z34C'''||align="left"| '''587 Z34C'''||align="left"| '''587 KO Z34C'''||align="left"| '''587 KO Z34C SPACER'''
-
| '''sample''' ||align="right"| '''expected size'''  
+
|-
|-
-
|  align="right" | pAAV_MCS: cut with ClaI and BglII||align="right"|4580 bp
+
| align="left" | Clone||align="left"|1.3 + 1.4 ||align="left"|2.3 + 2.4 ||align="left"|4.3 + 4.4 ||align="left"|6.3 + 6.4 ||align="left"|9.3 + 9.4 ||align="left"|11.3 + 11.4||align="left"|12.2 + 12.4 ||align="left"| 13.2 + 13.4 ||align="left"| 14.3 + 14.4
|-
|-
|}
|}
-
<br>
 
-
==== 19. Labortag 02.06.2010: Oligos (NotI)====
+
<br />
 +
<p style="font-size:13px; color:#66bbff;"><b>
 +
Comment:</b> Samples 1.3, 2.3, 4.3, 6.3, 9.3, 11.3, 12.2, 13.2, 14.3 were sent for sequencing. For sequencing results go to labday 02.09.10. </p>.
-
Investigators: Adrian, Bea, Chris W., Hanna, Anissa<br>
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Design of primers for pAAV_RC</b></p>====
-
<br>
+
<b>Investigator: Bea <br /></b>
-
'''Practical work:''' <br>
+
<p style="font-size:13px; color:#66bbff;">Primers for different cloning strategies of the synthesized cap gene into pAAV_Rc have been designed.</p>
-
Control plate contained no clones. :)
+
<ol>
-
4 colonies were picked and grown @ 37°C over night.
+
<li>The first primers are mutagenesis primers which delete the KpnI recognition site at position 3968. These primers can (or should be used) be used if cloning with BspMI/BfuI (isochizomer) does not cut the pAAV_RC efficiently. Instead of using this enzyme we can use XcmI to subclone the cap gene with performing a site-directed mutagenesis afterwards with designed primers. </li>
-
<br>
+
<li>The second idea is to design oligoduplexes (hybridized oligos) which contain the recognition site for BspMI. In Gormley et al (2002) the idea was to add oligodupexes with the recognition site for BspMI and therefore provide the "second recognition site" in trans. </li>
-
'''Theoretical work:'''<br>
+
</ol>
-
Oligos for site directed mutagenesis of the NotI restriction sites in pAAV_MCS (ITRs) were designed:[[File:Freiburg10 NotI ITR Oligos.pdf]]
+
<b>Next step:</b> Check primers and order them today! Designed primers are stored in my Workingfolder under paav_rc and a word document was created whcih can be found under Oligos --> primers for different strategies...
-
<br>
+
<br/>
-
'''Sponsoring work:''' <br>
+
<br/>
-
Sponsoring letter was adapted for Quiagen.
+
-
====20. Labortag 03.06.2010: pAAV_RFC25_MCS -> problem====
+
====<p style="font-size:15px; background-color:#ff00ff;"><b>Sequencing results of pSB1C3_Zegfr:1907_Linker</b></p>====
 +
<b>Investigator: Hanna<br /></b>
 +
<br/>
-
Investigators: Anissa, Bea, Melanie, Christian L.
+
<p><font color="#00ff00;"><b>Comment:</b> Sequencing results looked all well. One bp was missing in the theoretical sequence of SEG suffix - but is correct in the actual sequence.</font></p>
-
<br>
+
<br/>
 +
<b><u>pSB1Cr_Zegfr:1907_LongLinker:</u></b> <br/>
 +
[[File:PSB1C3 Zegfr1907 LongLinker.JPG|700px]]
 +
<br/>
-
'''Comment''': Continue with Mini-Prep and test digestion of pAAV_RFC25_MCS <br>
+
<b><u>pSB1Cr_Zegfr:1907_SEG:</u></b><br/>
-
Mini-Prep and test digestion have been performed: <br>
+
[[File:PSB1C3 Zegfr1907 SEG.JPG|700px]]
 +
<br/>
-
<span style="color:red; font-weight:bold;">Problem</span>: Designed oligos (MCS_RFC25) for altering the MCS of the pAAV_MCS vector cannot be used. <br> Two startcodons are in the MCS.
+
<b><u>pSB1Cr_Zegfr:1907_MiddleLinker:</u></b><br/>
-
[[File:Oligo RFC25 MCS.jpg|800px|thumb|left| Oligo MCS_RFC25: contains 2 Startcodons. the "wrong" Codon is the first ATG which results in peptide chain with 30 aa. The second ATG is the right ATG which is right before the Gene of Interest.]]
+
[[File:PSB1C3 Zegfr1907 MiddleLinker.JPG|700px]]
-
<br>
+
<br/>
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
The two startcodons are not in the same open reading frame (ORF). Therefore two proteins will be produced. The Gene of Interest and the short peptide (30 aa).<br>
+
-
The idea of the oligos was to ligate the oligos into the pAAV_MCS vector. The oligos contained two overhangs which correspond to the sequences of the two restriction sites ClaI and BglII: <br>
+
-
The pAAV_MCS vector was digested with ClaI and BglII and then we ligated the oligo and the vector. Problem was that we did not notice that the overhang of ClaI and the sequence of EcoRI of the MCS_RFC25 resulted in another ATG startcodon.
+
-
<br>
+
-
<br>
+
-
'''Possible Solutions''':
+
-
<ul>
+
-
# first: modify MCS with ordered oligos of Sven (shorter MCS which cannot be used for pEX)and clone mVenus
+
-
# Perform site-directed-mutagenesis (QuikChange from Stratagene)
+
-
# Order new MCS-oligos and consider that '''no''' new ATG is produced. For example: add another base between ClaI overhang and EcoRI sequence. -----AT'''X'''G---- '''This solution is the more possible one we are going to perform.'''
+
-
</ul>
+
-
<br>
+
-
<span style="color:blue; font-weight:bold;">Practical work</span>
+
-
<br>
+
-
<ul>
+
-
*Preparing four glycerol stocks (2:1)
+
-
**numbers: B4 - B7 (for details see nomenclature)
+
-
**stored in -80°C, Box 1
+
-
</ul>
+
-
*<b>MiniPrep</b>
+
-
**Nanodrop concentrations
+
-
<br>
+
-
{| border="1"
+
-
| align="right" | '''Sample''' ||align="right"| '''Concentration/ng*µl-1'''
+
-
|-
+
-
|  align="right" | P11 ||align="right"|340,5
+
-
|-
+
-
|  align="right" | P12 ||align="right"|364,0
+
-
|-
+
-
|  align="right" | P13 ||align="right"|358,5
+
-
|-
+
-
|  align="right" | P14 ||align="right"|284,4
+
-
|-
+
-
|}
+
-
<br>
+
-
*Test digestion
+
-
<br>
+
-
{| border="1"
+
-
| Components  || align="right" |Volume µl ||align="right"| Mastermix µl
+
-
|-
+
-
| DNA  ||  align="right" | 800 ||  align="right" | --
+
-
|-
+
-
| BSA (10x) ||  align="right" | 1,5 ||  align="right" | 7,5
+
-
|-
+
-
| Buffer No.2 (10x)||  align="right" | 1,5 ||  align="right" | 7,5
+
-
|-
+
-
|Enzyme 1 (no.Lab:45) Nde I ||  align="right" | 0,5 ||  align="right" | 2,5
+
-
|-
+
-
|Enzyme 2 (no.Lab:71) Spe I ||  align="right" | 0,5 ||  align="right" | 2,5
+
-
|-
+
-
|H<sub>2</sub>O||  align="right" | variable ||  align="right" | --
+
-
|-
+
-
|'''Total volume '''||  align="right" | 15 ||  align="right" | 20
+
-
|}
+
-
<br>
+
-
{| border="1"
+
-
| Sample  || align="right" | Volume/ µl ||align="right"| H<sub>2</sub>O / µl
+
-
|-
+
-
| P11  ||  align="right" | 2,3 ||align="right"| 8,7
+
-
|-
+
-
| P12  ||  align="right" | 2,2 ||align="right"| 8,8
+
-
|-
+
-
| P13  ||  align="right" | 2,2 ||align="right"| 8,8
+
-
|-
+
-
| P14  ||  align="right" | 2,8 ||align="right"| 8,2
+
-
|-
+
-
|}
+
-
*Incubation: 1,5 h
+
-
<br>
+
-
<li>Agarose-Gel
+
-
*Materials
+
<b><u>pSB1Cr_Zegfr:1907_ShortLinker:</u></b><br/>
-
0,5 g Agarose, 50 ml TAE, 3µl GELRED, at 100 Volt, running time: 45 minutes
+
[[File:PSB1C3 Zegfr1907 ShortLinker.JPG|700px]]
 +
<br/>
 +
These constructs will be cloned into pCerulean for N-terminal fusion to VP2.
 +
<!--insert this text wherever you want. copy from here until "STOP"-->
 +
<html>
 +
<br />
 +
<a href="#top">go to the top ;)</a>
 +
</html>
 +
<!--"STOP"-->
 +
====<p style="font-size:15px; background-color:#66bbff;"><b>Trafo evalutaion and Inoculation</b></p>====
 +
<b>Investigator: Kira</b>
 +
<br/>
 +
The plate with transformed CD-biobrick contains around 40 colonies. 4 of them will be inoculated into LB and incubated @37 C over-night.
 +
<!--insert this text wherever you want. copy from here until "STOP"-->
 +
<html>
 +
<br />
 +
<a href="#top">go to the top ;)</a>
 +
</html>
 +
<!--"STOP"-->
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273)</b></p>====
-
!Sample
+
-
!Sample/µl]
+
-
!Loading dye (5x/6x)/µl
+
-
!Expected size 1 (Geneious)
+
-
!Expected size 2 (Geneious)
+
-
|--
+
-
|P11
+
-
|15 µl
+
-
|3 µl
+
-
|3677 bp
+
-
| 974 bp
+
-
|--
+
-
|P12
+
-
|15 µl
+
-
|3 µl
+
-
|3677 bp
+
-
| 974 bp
+
-
|--
+
-
|P13
+
-
|15 µl
+
-
|4 µl
+
-
|3677 bp
+
-
| 974 bp
+
-
|--
+
-
|P14
+
-
|15 µl
+
-
|4 µl
+
-
|3677 bp
+
-
| 974 bp
+
-
|--
+
-
|}
+
<b>Investigator: Patrick</b>
-
{| align=right
+
-
|}
+
-
{| border="1"
+
The two Ligations were performed according to the standard protocol:<br>
-
|
+
1 µl T4 DNA ligase, 1 µl 10x Buffer, 4,6 µl vector (P273), 3,34 µl Insert (P276, upper and lower band).<br>
-
!Marker
+
Incubation time: 50 minutes.
-
!Sample P11 /18 µl
+
-
!Sample P12 /18 µl
+
-
!Sample P13 /19 µl
+
-
!Sample P14 /19 µl
+
-
|-
+
-
!Lane
+
-
| 1
+
-
| 3
+
-
| 5
+
-
| 7
+
-
| 9
+
-
|-
+
-
|}
+
-
'''Results of agarose-gel:'''
+
During the transformation i forgot to put the cells into the 37°C shaker so i incubated them afterwards again for 45 minutes at 37 °C on a shaker.
-
<br>
+
-
<ul>
+
-
*Expected fragments of 3677 bp and 974 bp can be cerified. The insertion of the RFC25_MCS has been inserted. <br>
+
-
For further verification the insert has to be sequenced has to be conducted (to do for 04.06.2010). <br>
+
-
</ul>
+
-
<br>
+
-
<span style="color:blue; font-weight:bold;">Picking clones of Thymindinkinase of Amor</span>
+
The mutual conles will be picked tomorrow to inoculate 10 ml DYT following a mini-prep on 03.09.2010
-
**5 clones of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 with the thymidinkinase''' have been picked from LBamp-agarplates
+
-
**1 clone of the XL-1 Blue colonies containing the plasmid '''pUB6/HV5/His6 without the thymidinkinase (control) has been picked from LBamp-agarplates
+
-
**all clones have been inoculated in 10 mL LB containing 10 µL Amp. Incubation: 37°C over-night.
+
-
**'''to do: Mini-Prep of pUB6/HV5/His6 with the thymidinkinase and pUB6/HV5/His6 without the thymidinkinase (control)'''
+
-
<br>
+
-
<span style="color:blue; font-weight:bold;">Idea</span>
+
-
<ul>
+
-
*Insertion of Kozak consensus sequence before MCS to enhance gene expression (cloning consideration in Stratagene manual)
+
-
** New RFC standard with Kozak sequence for eucaryotes??
+
-
====21. Labortag 04.06.2010: DKFZ plasmid Retrafos, TK/GMK Mini-Prep====
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Transfection, Seeding AAV293 and HT1080</b></p>====
 +
<b> Investigator: Kerstin </b>
-
Investigators: Adrian, Bea, Chris W., Hanna<br>
+
*Transfection: 10 plates, same treatment (10µg of RC (P357), pHelper (P356)and mVenus (P263), following the standard protocol)
-
<p style="font-size:15px; font-weight: bold; color: green;"><u>DKFZ</u></p>
+
*Seeding HT1080 for transduction with virus from 21.08.2010 (10µg of RC, pHelper, TKGMK; pH=7,10)
 +
*Seeding AAV293 for transfection with plasmids without HgH or beta-globin (verifying functionality)
-
'''Comments''': Plasmids of PD Kleinschmidt of the DKFZ arrived. The DNA was dried on a whatman paper.<br>
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Cloning of Z<sub>EGFR</sub>:1907_Middle-Linker,Z<sub>EGFR</sub>:1907_Short-Linker, Z<sub>EGFR</sub>:1907_SEG-Linker and Z<sub>EGFR</sub>:1907_Long-Linker into pCerulean</b></p>====
-
Plasmids received: <br>
+
<b>Investigator: Stefan </b>
 +
<p style="font-size:13px; color:red;"><b>Comment</b>:</p>
 +
<br/>
 +
'''Digestion:'''
-
*'''pXX6''' alle Adenovirus Helfer Gene ohne AAV Gene; Plasmid von J. Samulski; evtl. Anfragen für Benutzererlaubnis
 
-
*'''pKEX-2XL.Rep40''' Expressionsplasmide für das Rep Proteine 40
 
-
*'''pKEX-2XL.Rep 52''' Expressionsplasmide für das Rep Proteine 52
 
-
*'''pKEX-2XL.Rep 68''' Expressionsplasmide für das Rep Proteine 68
 
-
*'''pKEX-2XL.Rep 78''' Expressionsplasmide für das Rep Proteine 78
 
-
*'''pCMV-VP(HS)''' Expressionsplasmid der drei VP Proteine in Kombination (assemly kompetent
 
-
*'''pKEX-VP1''' Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
 
-
*'''pKEX-VP2'''Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
 
-
*'''pKEX-VP3'''Expressionsplasmide für die einzelnen VP (cap) Proteine (VP1, VP2 und VP3) vorsicht: sind alleine nicht assembly kompetent; Ruffing et al 1992; Steinbach et al. 1997;
 
-
*'''pTRUF_CMV_eGFP'''Einzelstrang Vektor zur Expression von eGFP
 
-
*'''dsAAV_CMV_eGFP'''"self complementary" Expressionsvektor von X. Xiao; evtl. anfragen wegen Benutzererlaubnis
 
-
*'''pTAV2 (gesamtes AAV Genom im "blue script" Vektor)
 
-
*'''pDG''' komplettes Helferplasmid zur Vektorherstellung; Grimm et al. 1998
 
-
<br>
 
-
*In order to obtain the DNA following steps have been performed:
 
-
**cut out the spot where the DNA is spotted with a clean scalpel (note: scalpel should not have any contamination).
 
-
**put a 0,5 mL Eppi in a 1,5 mL Eppi. Put little holes in the smaller eppi.
 
-
**transfer Whatman paper into Eppi
 
-
**add 50 µL TE-EF (Redissolving buffer) to whatman paper and wait 15 minutes
 
-
**centrifuge eppis at 2000 rpm, 10 minutes
 
-
*Transformation with obtained plasmids was performed.
 
-
</ul>
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: green;"><u>Fusion Enzyme: Thymidinkinase/Guanylate Kinase (TK/GMK)</u></p>
 
-
<p style="font-size:12px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
 
-
*experiment date: 04.06.2010 ; time: 3,5h
 
-
*name of investigator: Adrian, Bea, ChrisW.,Hanna
 
-
*new vector name: pUB_V5_His6 + TK/GMK (fusionenzyme)
 
-
<br />
 
-
<u>Glycerol Stocks</u>
 
{| border="1"
{| border="1"
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5'''||align="left"|'''Control'''
+
| components  || align="right" |Vector (P273) || align="right" |Z<sub>EGFR</sub>:1907_Middle-Linker (P290) || align="right" |Z<sub>EGFR</sub>:1907_Short-Linker (P292) || align="right" |Z<sub>EGFR</sub>:1907_SEG-Linker (P296) || align="right" |Z<sub>EGFR</sub>:1907_Long-Linker (P298)
|-
|-
-
| align="left" | '''Bacteria strain''' ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue ||align="left"| XL-1 Blue
+
| DNA  || align="right" |3,8 || align="right" | 8,8 || align="right" | 10,2 || align="right" | 9,2 || align="right" | 8,7
|-
|-
-
| align="left" | '''Plasmidname''' ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK ||align="left"| pUB_V5_His6 + TK/GMK
+
| BSA (10x) || align="right" |2|| align="right" | 2|| align="right" | 2|| align="right" | 2|| align="right" | 2
|-
|-
-
| align="left" | '''Date''' ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010 ||align="left"| 04.06.2010
+
| Buffer 4 (10x)|| align="right" |2 || align="right" | 2 || align="right" | 2||  align="right" | 2|| align="right" | 2
|-
|-
-
| align="left" | '''given number''' ||align="left"| B8 ||align="left"| B9 ||align="left"| B10 ||align="left"| B11 ||align="left"| B12 ||align="left"| B13
+
|XbaI || align="right" |1 || align="right" |1|| align="right" |1|| align="right" |1||  align="right" |1
-
|}
+
-
<br />
+
-
<u>Given Plasmid-Number</u>
+
-
{| border="1"
+
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Control'''
+
|-
|-
-
| align="left" | '''given number''' ||align="left"| P15 ||align="left"| P16 ||align="left"| P17 ||align="left"| P18 ||align="left"| P19 ||align="left"| P20
+
|PstI  ||  align="right" |1|| align="right" |1||  align="right" |1||  align="right" |1||  align="right" |1
 +
|-
 +
|H<sub>2</sub>O||  align="right" |10,2 ||  align="right" | 5,2||  align="right" | 3,8||  align="right" | 4,8||  align="right" | 5,3
 +
|-
 +
|'''Total volume '''|| align="right" |20|| align="right" | 20|| align="right" | 20|| align="right" | 20|| align="right" | 20
|}
|}
 +
<br>
 +
 +
0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED , at 115 Volt, running time: 50 minutes
<br />
<br />
-
<p style="font-size:12px; font-weight: bold; color: blue;"><u>Nanodrop concentration</u></p>
 
-
*Plasmid
 
-
**Given Plasmid-Number: P15; DNA concentration: 493,7 ng/µL ;
 
-
**Given Plasmid-Number: P16; DNA concentration: 464,4 ng/µL;
 
-
**Given Plasmid-Number: P17; DNA concentration: 445,6 ng/µL;
 
-
**Given Plasmid-Number: P18; DNA concentration: 562,9 ng/µL;
 
-
**Given Plasmid-Number: P19; DNA concentration: 528,1 ng/µL;
 
-
**Given Plasmid-Number: P20; DNA concentration: 499,9 ng/µL;
 
<br />
<br />
-
'''Comments:'''A Plasmid-Mini Prep with the received Fusionenzyme Thymidinkinase/Guanylate Kinase (TK/GMK)from Amor has been performed.<br>
 
-
The DNA will be sent to GATC for sequencing.
 
-
*pUB6_V5_His6 - clone 1 (P15) (3 µL added to 27µL H20) has been sent to GATC.
 
-
*Expected results: Saturday
 
<br />
<br />
 +
<br />
 +
[[File:Freiburg10 pCerulean affi linker.jpg|500px|]]
 +
<br />
 +
<br />
 +
<br />
 +
<br />
 +
<br />
 +
 +
'''Gelextraction:'''<br />
 +
 +
The gelextraction was performed according to the standard protocol. DNA concentration of the extracts:
 +
* P273: c= 3,1 ng/µl
 +
* P290: c= 3,2 ng/µl
 +
* P292: c= 1,8 ng/µl
 +
* P296: c= 3,0 ng/µl
 +
* P298: c= 3,2 ng/µl
<br>
<br>
 +
'''T4 Ligation:'''<br />
-
====22. Labortag 05.06.2010: Insertion of iGEM expression parts into pAAV_MCS====
+
The  Ligation was performed as following:<br />
 +
<p style="font-size:13px; color:red;"><b>Comment</b>: No sufficent vector concentration, therefore 5 µl of vector was used for every approach. </p>
 +
* Vector Volume: 5 µl
 +
* Insert Volume: 3 µl
-
Investigators: Adrian, Bea, Melanie, Hanna<br>
 
<br>
<br>
-
<p style="font-size:15px; font-weight: bold; color: blue;">Hybridization:</p>
+
* 1µl T4-Ligase buffer (10x)
-
*Hybridization of received oligos: iGEM expression parts (RFC25 without EcoRI, NotI)
+
* 8µl (Vector + Insert) mix
-
*Prior to opening the tubes, they were centrifugated at 13.000 rpm for 30 sec.
+
* 1µl T4-Ligase
-
**expression part MCS_for (charge-no: ST00114065): 108 µL Millipore H<sub>2</sub>O (Volume on obtained sheet)were added.
+
<br> Incubating for 40 minutes.
-
**expression part MCS_for (charge-no: ST00114066): 165 µL Millipore H<sub>2</sub>O (Volume on obtained sheet)were added.
+
 
-
*Resuspended DNA was vortexted.
+
-
*Aliquots of both Oligos (1:10) were prepared: 10 µL Oligo + 90 µL H<sub>2</sub>O (final volume usually 100 µl).
+
-
*Mix together(into PCR-tube):
+
<br>
<br>
-
{| border="1"
+
'''Transformation:'''<br />
-
| align="right" | '''Volume/µL''' ||align="right"| '''solution'''
+
-
|-
+
-
|  align="right" | 10 (1:10)||align="right"|Oligo 1: expression part MCS_for (charge-no: ST00114065)
+
-
|-
+
-
|  align="right" |10 (1:10)||align="right"|Oligo 2: expression part MCS_for (charge-no: ST00114066)
+
-
|-
+
-
|  align="right" |4||align="right"| 100 mM TrisHCl pH8
+
-
|-
+
-
|  align="right" |8||align="right"|5 mM MgCl2
+
-
|-
+
-
|  align="right" |8||align="right"| H20
+
-
|}
+
-
<br>
+
-
* Program: ORIGAMI 1 modified for long oligos:
+
-
** 1    99°C    7’
+
-
** 2    99°C    1’
+
-
** -1°C  R=0.3 °/s
+
-
** Goto 2 rep 74
+
-
** Hold 4°C
+
-
<br>
+
-
*While hybridization of oligos was performed, digestion of pAAV_MCS vector was conducted <br>
+
-
following standard protocol for cloning.
+
-
<br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion:</p>
+
-
*Title: Ligation iGEM expression parts (="iGEM-MCS") with pAAV_MCS
+
-
*Plasmid: pAAV_MCS
+
-
*Buffer used: 3
+
-
*BSA: Yes
+
-
*DNA-Concentration: 260 ng/uL
+
-
*Restriction-enzyms used:
+
-
Enzyme1 (Nr. Lab: 152): ClaI
+
-
Enzyme2 (Nr. Lab: 15): BglII   
+
-
<br>
+
-
*Digestion components :
+
-
{| border="1"
+
Trafo was performed according to the standard protocol (BL21). The cells were plated on a agar plate with chloramphenicol
-
| '''components'''  || align="right" | '''pAAV_MCS'''
+
-
|-
+
-
| DNA  ||  align="right" | 5.8 µL
+
-
|-
+
-
| BSA (10x) ||  align="right" |3 µL
+
-
|-
+
-
| Buffer 3 (10x)||  align="right" |2 µL
+
-
|-
+
-
|Enzyme: ClaI (no.Lab:152)||  align="right" |2 µL
+
-
|-
+
-
|Enzyme: BglII (no.Lab:15)||  align="right" |1 µL
+
-
|-
+
-
|H<sub>2</sub>O||  align="right" |16.2 µL
+
-
|-
+
-
|'''Total volume'''||  align="right" |<b>30 µL</b>
+
-
|}
+
-
*Mixture was incubated for 1,5 h at 37°C.
+
<br>
<br>
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
 
-
*1% agarose gel was prepared, gel ran for 45 minutes(110 V)
 
-
<br>
 
-
*Amount of loading dye added
 
-
{| border="1"
 
-
|<b>sample/µL </b>||align="right"| '''loading dye/µL'''
 
-
|-
 
-
| marker: 8 ||align="right"|contains loading dye
 
-
|-
 
-
|pAAV_MCS: 30 ||align="right"|6 (6x loading dye)
 
-
|-
 
-
|}
 
-
<br>
 
-
*Expected size of fragments
 
-
{| border="1"
 
-
|  '''sample''' ||align="right"| '''expected size'''
 
-
|-
 
-
|  align="right" | pAAV_MCS: cut with ClaI and BglII||align="right"|4580 bp
 
-
|-
 
-
|}
 
 +
===108. labday 02.09.2010===
 +
====<p style="font-size:15px; background-color:#66bbff;"><b>Sequencing of loop insertions BioBricks: 2nd round</b></p>====
 +
<b>Investigator: Achim, Anna <br /></b>
 +
<br />
 +
We analyzed the new sequencing results and found two correct sequences:
-
</ul>
+
*587 BAP clone 2.3
-
<br>
+
*453 RGD clone 4.3
-
<br>
+
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction:</p>
+
The other samples didn't contain any inserts or had wrong insertions. Apparently, the vector tends to religate easily. A possible reason for the religation of the incompatible ends is the overnight ligation at 18°C. We sent preps of the remaining 7 ligations for sequencing and will prep new clones or repeat the ligation tomorrow, depending on the new sequences.
 +
 
 +
<p style="font-size:13px; color:#66bbff;"><b>
 +
Comment:</b> Clones 1.4, 6.4, 9.4, 11.4, 12.4, 13.4, 14.4 were sent for sequencing.  For sequencing results go to labday 03.09.10. </p>.
 +
 
 +
====<p style="font-size:15px; background-color:#66bbff;"><b>Mini-preps of pSB1C3_SV40 and pCerulean_VP1_NLS</b></p>====
 +
<b>Investigator: Bea (Chris L) <br /></b>
<br />
<br />
-
Gel measurement:
+
Mini-Prep was performed according to the standard protocol
<br />
<br />
-
{| border="1"
+
<li>P363 = pSB1C3_SV40 clone 1 = 277,70 ng/µl
-
| align="left" | '''Sample''' ||align="left"| '''weight'''
+
<li>P364 = pSB1C3_SV40 clone 2 = 265,01 ng/µl
-
|-
+
<li>P365 = pCerulean_VP1up_NLS (1) clone 1 = 473,14 ng/µl
-
| align="left" |pAAV_MCS ||align="left"| 60 mg
+
<li>P366 = pCerulean_VP1up_NLS (1) clone 2 = 455,88 ng/µl
-
|-
+
<li>P367 = pCerulean_VP1up_NLS (1) clone 3 = 482,86 ng/µl
-
|}
+
<li>P368 = pCerulean_VP1up_NLS (2) clone 1 = 438,52 ng/µl
-
*Gelextraction was performed following standard protocol.
+
<li>P369 = pCerulean_VP1up_NLS (2) clone 2 = 478,00 ng/µl
-
*DNA-concentrations were meassured: pAAV_MCS 18.2 ng/µL, Oligos: 136.7 ng/µL -> 1:10 dilution was prepared: 13.67 ng/µL
+
<li>P370 = pCerulean_VP1up_NLS (2) clone 3 = 419,00 ng/µl
-
<br /><br />
+
<br />
-
<p style="font-size:15px; font-weight: bold; color: blue;">Ligation:</p>
+
Construct were digested with XbaI and PstI for 45 minutes at 37°C. The loading plan on the 1% agarose gel looks like this:
<br />
<br />
-
{| border="1"
 
-
| align="left" |  ||align="left"| '''iGEM-MCS''' ||align="left"| '''pAAV_MCS'''
 
-
|-
 
-
| align="left" | '''Volume/µl''' ||align="left"| 0.4 ||align="left"| 8.6
 
-
|}
 
<br />
<br />
-
Trafo was performed (using XL1B cells) following standard protocol.
+
_M_  ___ _363_  ___  _364_  _365_  _366_  _367_  _368_  _369_  _370_  ___
-
<br>
+
<br />
-
<br>
+
<br />
 +
<b>Results:</b>
 +
P365 was sent for sequencing because test digestion looks goos. In contrast to the SV40 appraoch. This needs to be repeated tomorrow.<br />
-
====23. Labortag 07.06.2010: Mini-Preps (Kleinschmidt-plasmids and pAAV_iGEM-MCS)====
+
<ul>
-
investigators: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea
+
<li>Plasmid: pCerulean_VP1up_NLS</li>
-
<br>
+
<li>Plasmid number: P365</li>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-MCS</u></p>
+
<li>Tube name: SB1</li>
-
<p style="font-size:15px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
+
<li>Primer used: CMV-F</li>
-
*experiment date:07.06.2010; time: whole day
+
</ul>
-
*name of investigator: Achim, Kira,Jessy, Chris W., Hanna, Adrian, Bea
+
 
 +
====<p style="font-size:15px; background-color:#ff00ff;"><b>Mini-Prep and test digestion of pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker</b></p>====
 +
<b>Investigator: Hanna <br /></b>
 +
<br/>
 +
<p style="color:#ff00ff;"><b>Comment:</b> Zegfr:1907 (Affibody) and the His-Tag which was coupled to the middle linker were cloned into pCerulean. 3 clones of each construct were picked yesterday. </p>
 +
<br/>
 +
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Plasmid Mini-Prep</p>
 +
*new vector name: pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker
<br />
<br />
-
<u>Glycerol Stocks</u>
+
<b><u>Glycerol Stocks</u></b> <br/>
 +
<b>1. pCerulean_Zegfr:1907</b>
{| border="1"
{| border="1"
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''  
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3'''  
|-
|-
-
| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
+
| align="left" | '''Bacteria strain''' ||align="left"| XL1b ||align="left"| XL1b  ||align="left"| XL1b 
|-
|-
-
| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM-MCS ||align="left"| pAAV_iGEM-MCS||align="left"| pAAV_iGEM-MCS||align="left"| pAAV_iGEM-MCS
+
| align="left" | '''Plasmidname''' ||align="left"| pCerulean_Zegfr:1907 ||align="left"| pCerulean_Zegfr:1907 ||align="left"| pCerulean_Zegfr:1907
|-
|-
-
| align="left" | '''Date''' ||align="left"| 07.06.2010 ||align="left"| 07.06.2010||align="left"| 07.06.2010||align="left"| 07.06.2010
+
| align="left" | '''Date''' ||align="left"| 2.9.10 ||align="left"| 2.9.10 ||align="left"| 2.9.10
|-
|-
-
| align="left" | '''given number''' ||align="left"| - ||align="left"| B27 ||align="left"| B28||align="left"| B29
+
| align="left" | '''given glycerol-stock no.''' ||align="left"| B275 ||align="left"| B276 ||align="left"| B277
 +
|-
 +
| align="left" | '''given plasmid no.''' ||align="left"| P371 ||align="left"| P372 ||align="left"| P373 
|}
|}
<br />
<br />
-
<u>Given Plasmid-Number</u>
+
<b>2. pCerulean_6xHis_MiddleLinker</b>
{| border="1"
{| border="1"
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''  
+
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3'''  
|-
|-
-
| align="left" | '''given number''' ||align="left"| - ||align="left"| P34.2 ||align="left"| P34.3||align="left"| P34.4
+
| align="left" | '''Bacteria strain''' ||align="left"| XL1b ||align="left"| XL1b  ||align="left"| XL1b 
 +
|-
 +
| align="left" | '''Plasmidname''' ||align="left"| pCerulean_6xHis_MiddleLinker ||align="left"| pCerulean_6xHis_MiddleLinker ||align="left"| pCerulean_6xHis_MiddleLinker
 +
|-
 +
| align="left" | '''Date''' ||align="left"| 2.9.10 ||align="left"| 2.9.10 ||align="left"| 2.9.10
 +
|-
 +
| align="left" | '''given glycerol-stock no.''' ||align="left"| B278 ||align="left"| B279 ||align="left"| B280
 +
|-
 +
| align="left" | '''given plasmid no.''' ||align="left"| P374 ||align="left"| P375 ||align="left"| P376 
|}
|}
<br />
<br />
-
<p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
+
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Test digestion</p>
-
*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) NdeI
+
*buffer used: 4; Restriction-enzymes used: Enzyme 1 PstI-HF ; Enzyme 2 EcoRI-HF
*Plasmid
*Plasmid
-
**Given Plasmid-Number: P34.2; DNA concentration: 433.78 ng/µL ;
+
**Given Plasmid-Number: 371; DNA concentration: 381.3 ng/µL;
-
**Given Plasmid-Number: P34.3; DNA concentration: 408.48 ng/µL ;
+
**Given Plasmid-Number: 372; DNA concentration: 377.5 ng/µL;
-
**Given Plasmid-Number: P34.4; DNA concentration: 409.80 ng/µL ;
+
**Given Plasmid-Number: 373; DNA concentration: 409.7 ng/µL;
-
 
+
**Given Plasmid-Number: 374; DNA concentration: 404.2 ng/µL;
 +
**Given Plasmid-Number: 375; DNA concentration: 366.1 ng/µL;
 +
**Given Plasmid-Number: 376; DNA concentration: 375.0 ng/µL;
<br />
<br />
-
'''Comments:'''Clone no.1 was dismissed...
+
'''Comments:''':)
<br />
<br />
<br />
<br />
-
'''Test digestion:'''
+
<b>Pipetting scheme for each test digestion:</b>
{| border="1"
{| border="1"
-
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix'''
+
| align="left" | <b>Components</b> ||align="left"| <b>Volume/µL</b> 
|-
|-
-
| align="left" | DNA (clone 2)||align="left"| 1000 ng ||align="left"| -
+
| align="left" | DNA ||align="left"| 2.7
|-
|-
-
| align="left" | BSA (10x) ||align="left"| no ||align="left"| -
+
| align="left" | BSA (10x) ||align="left"| 1
|-
|-
-
| align="left" | Buffer no. 4 (10x) ||align="left"| 1.5 µL||align="left"| -
+
| align="left" | Buffer no. 4 (10x) ||align="left"| 1
|-
|-
-
| align="left" | Enzyme 1 (no. Lab:    ) AgeI ||align="left"| 0.75 µL ||align="left"| -
+
| align="left" | EcoRI-HF ||align="left"| 0.5
|-
|-
-
| align="left" | Enzyme 2 (no. Lab:    ) NdeI ||align="left"| 0.5 µL||align="left"| -
+
| align="left" | PstI-HF ||align="left"| 0.5
|-
|-
-
| align="left" | H<sub>2</sub>O ||align="left"| variable ||align="left"| -
+
| align="left" | H<sub>2</sub>O ||align="left"| 4.3
|-
|-
-
| align="left" | '''Total volume''' ||align="left"| '''15 µL''' ||align="left"| -
+
| align="left" | <b>Total volume</b> ||align="left"| <b>10</b>
|}
|}
<br />
<br />
-
{| border="1"
 
-
| Sample  || align="right" | Volume sample/ µl ||align="right"| Volume H<sub>2</sub>O / µl
 
-
|-
 
-
| P34.2  ||  align="right" |2.3 ||align="right"| 9.95
 
-
|-
 
-
| P34.3  ||  align="right" | 2.4 ||align="right"| 9.85
 
-
|-
 
-
| P34.4  ||  align="right" | 2.4||align="right"| 9.85
 
-
|-
 
-
|-
+
*Incubation: 55 minutes
-
|}
+
-
*Incubation: 45 min, 37°C
+
<br />
<br />
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Agarose-Gel:</p>
<br />
<br />
-
0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 110 Volt, running time: 45 minutes
+
0.875 g Agarose, 50 mL TAE (1.75 %), 3 µL EthBr, at 115 Volt, running time: 35 minutes
<br />
<br />
<br />
<br />
Line 672: Line 432:
!Sample
!Sample
!Sample/µl]
!Sample/µl]
-
!Loading dye (5x/6x)/µl
+
!Loading dye (6x)/µl
-
!Expected size 1 (Geneious)
+
!Expected size  
-
!Expected size 2 (Geneious)
+
|--
|--
-
|P34.2
+
|pCerulean_Zegfr:1907 clone 1
-
|15 µl  
+
|10 µl  
-
|3 µl
+
|2 µl
-
|3686 bp
+
|231 bp
-
|951 bp
+
-
 
+
|--
|--
-
|P34.3
+
|pCerulean_Zegfr:1907 clone 2
-
|15 µl  
+
|10 µl  
-
|3 µl
+
|2 µl
-
|3686 bp
+
|231 bp
-
|951 bp
+
-
 
+
|--
|--
-
|P34.4
+
|pCerulean_Zegfr:1907 clone 3
-
|15 µl  
+
|10 µl  
-
|3 µl
+
|2 µl
-
|3686 bp
+
|231 bp
-
|951 bp
+
|--
 +
|pCerulean_6xHis_MiddleLinker clone 1
 +
|10 µl
 +
|2 µl
 +
|105 bp
 +
|--
 +
|pCerulean_6xHis_MiddleLinker clone 2
 +
|10 µl
 +
|2 µl
 +
|105 bp
 +
|--
 +
|pCerulean_6xHis_MiddleLinker clone 3
 +
|10 µl
 +
|2 µl
 +
|105 bp
|--
|--
-
 
|}
|}
Line 705: Line 473:
{| border="1"
{| border="1"
|
|
-
!Marker
+
!Marker /µL
-
!Sample  
+
!Sample P371 /µl
-
!Sample
+
!Sample P372 /µl
-
!Sample  
+
!Sample P373 /µl
 +
!Sample P374 /µl
 +
!Sample P375 /µl
 +
!Sample P376 /µl
|-
|-
!Lane  
!Lane  
-
|34.2 / 18 µl
+
|5
-
| 34.3 / 18 µl
+
|12
-
|34.4 / 18 µl
+
|12
-
 
+
|12
 +
|12
 +
|12
 +
|12
|-
|-
|}
|}
<br />
<br />
-
<br>
+
'''Comments:''' Test digestion looked well: <br/>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Kleinschmidt-plasmids</u></p>
+
<br/>
-
<p style="font-size:15px; font-weight: bold; color: blue;"><u>Plasmid Mini-Prep</u></p>
+
[[File:Freiburg10 pCerulean Zegfr1907andpCerulean 6xHis ML.png|700px]]
-
*experiment date: 07.06.2010 ; time: 10 – 20 h
+
<br/>
-
*name of investigator: Kira, Achim, Jessy, Bea, Adrian, Hanna
+
Clone 1 of each construct were sent for sequencing (P371 and P374 = HW1 and HW2). Used primer: GATC_std_CMV-F.
-
*Kleinschmidt-plasmids
+
<br/>
-
<br />
+
 
-
<u>Glycerol Stocks</u>
+
====<p style="font-size:15px; background-color:#66bbff;"> Midi-Prep of pSB1C3_lITR_CMV_mVenus_hGH_rITR clone1 & pSB1C3_lITR_CMV_beta-globin_mVenus_rITR clone1</p>====
-
{| border="1"
+
 
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7''' ||align="left"| '''Clone 8''' ||align="left"| '''Clone 9''' ||align="left"| '''Clone 10''' ||align="left"| '''Clone 11''' ||align="left"| '''Clone 12''' ||align="left"| '''Clone 13'''
+
'''Investigators: Chris W. <br>
-
|-
+
<p style="font-size:13px; color:#003399;"> Midi-Preps of pSB1C3_lITR_CMV_mVenus_hGH_rITR clone1=P377 and pSB1C3_lITR_CMV_beta-globin_mVenus_rITR clone1=P378</p>
-
| align="left" | '''Bacteria strain''' ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B ||align="left"| XL1B
+
The Midi-Preps were performed according to the standard protocol yielding the following concentrations:
-
|-
+
-
| align="left" | '''Plasmidname''' ||align="left"| pXX6 ||align="left"| pKEX-2XL.Rep 40 ||align="left"| pKEX-2XL.Rep 52 ||align="left"| pKEX-2XL.Rep 68 ||align="left"| pKEX-2XL.Rep 78 ||align="left"| pCMV-VP(HS) ||align="left"| pKEX-VP1 ||align="left"| pKEX-VP2 ||align="left"| pKEX-VP3 ||align="left"| pTRUF_CMV_eGFP ||align="left"| dsAAV_CMV_eGFP ||align="left"| pTAV2||align="left"| pDG
+
-
|-
+
-
| align="left" | '''Date''' ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010 ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010  ||align="left"| 07.06.2010
+
-
|-
+
-
| align="left" | '''given number''' ||align="left"| B14 ||align="left"| B15 ||align="left"| B16 ||align="left"| B17 ||align="left"| B18 ||align="left"| B19 ||align="left"| B20 ||align="left"| B21 ||align="left"| B22 ||align="left"| B23 ||align="left"| B24 ||align="left"| B25 ||align="left"| B26 
+
-
|}
+
-
<br />
 
-
<u>Given Plasmid-Number</u>
 
{| border="1"
{| border="1"
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4''' ||align="left"| '''Clone 5''' ||align="left"| '''Clone 6''' ||align="left"| '''Clone 7'''||align="left"| '''Clone 8''' ||align="left"| '''Clone 9''' ||align="left"| '''Clone 10'''||align="left"| '''Clone 11''' ||align="left"| '''Clone 12''' ||align="left"| '''Clone 13'''
+
| plasmid-no. || align="right" |P377|| align="right" |P378
|-
|-
-
| align="left" | '''given number''' ||align="left"| P21 ||align="left"| P22 ||align="left"| P23 ||align="left"| P24 ||align="left"| P25 ||align="left"| P26 ||align="left"| P27 ||align="left"| P28 ||align="left"| P29 ||align="left"|  P30 ||align="left"| P31 ||align="left"| P32 ||align="left"| P33
+
| concentration (ng/µl)|| align="right" |325,04 || align="right" |561,15
|-
|-
-
| align="left" | '''measured concentration''' ||align="left"|351,01 ||align="left"| 673,1 ||align="left"| 532,22 ||align="left"| 579,05 ||align="left"| 725,31 ||align="left"| 659,68||align="left"| 692,8 ||align="left"| 545,46 ||align="left"| 568,34 ||align="left"|  420,62 ||align="left"| 446,95 ||align="left"| 496,8 ||align="left"| 472,58
 
|}
|}
-
<br />
 
<br>
<br>
-
'''Comments:'''
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Mini-Prep and test digestion of the CD biobricks</b></p>====
-
Many things went wrong today!
+
<b>Investigator: Kira <br /></b>
-
* Glycerol stocks must be vortexted!
+
-
* Check mini-prep buffers - especially buffer PE (needs to contain ethanol!)
+
-
* Always check volumes - try to estimate if volume makes sense (check pipettes!)
+
-
* Don't discard bacteria cultures until glycerol stocks and mini-preps are successfully done!!!
+
-
<p style="font-size:20px; font-weight: bold; color: red;">'''Today's conclusion: Better ask 2 times than do something wrong without asking!!!'''</p>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Site-directed mutagenesis of pAAV_iGEM-MCS (PstI)</u></p>
+
-
<br>
+
-
'''Quickchange site directed mutagenesis:'''
+
-
PCR reaction:
+
-
* 2.5 µL 10x Pfu Ultra II buffer
+
-
* 0.5 µL template (therefore the a 1:20 dilution of the pAAV_iGEM-MCS (433 ng/µL) was prepared) = 10.825 ng
+
-
* 0.56 µL primer 1 (of 1:10 dilution)
+
-
* 0.56 µL primer 2 (of 1:10 dilution)
+
-
* 1 µL DMSO (primers form very strong secondary structures)
+
-
* 0.5 µL dNTP
+
-
* 18.88 µL dH<sub>2</sub>O
+
-
* 0.5 µL PfuUltra II fusion (1.25 U)
+
-
-> end volume: 25 µL
+
-
<br>
+
-
<br>
+
-
'''PCR program:'''
+
-
<br>
+
-
1 x : 2' 95°C (HotStart polymerase)
+
-
20 x : 30 s 95°C -> 1' 55°C -> 5' 68°C
+
-
1 x : 4°C (over night)
+
-
<br>
+
-
Experiment will be continued tomorrow.
+
-
<br>
+
-
<br>
+
-
 
+
-
====24. Labortag 08.06.2010: Cloning of mVenus_YFP into pAAV_iGEM-MCS, continuation of site-directed mutagenesis====
+
-
 
+
-
Investigators: Kira, Jessy, Hanna, Achim <br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Analysis of iGEM-MCS sequence (RFC25 without EcoRI and NotI):</u></p> <br>
+
-
[[File:Freiburg10 iGEM-MCS.jpg|800x800px|]] <br>
+
-
The alignment with the theoretical pAAV_iGEM-MCS delivered a "C-deletion" within the NgoMIV restriction site. Due to that the pAAV_iGEM-MCS lacks this site. We controlled the bill of delivery and noted that the deletion must be GATC's fault.
+
-
All in all this doesn't matter, because parts which are in iGEM standard can be inserted and therefore they will deliver the lacking NgoMIV restriction site. Further on this could be an advantage because after digestion the fragment which is cut out can be better detected in the gel.
+
-
<br>
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Insertion of mVenus_YFP into pAAV_iGEM-MCS</u></p>
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion:</p>
+
-
<li>plasmid: insert: pGA14mVenusGeneart; number: - origin:Sven
+
[[File:mistake.png|thumb|right|200px]]
-
<li>plasmid: vector: pAAV_iGEM-MCS; number: P32.2 production date:05.06.2010 origin: ____
+
[[File:Cartoons48.jpg|thumb|right|200px|Ohne Worte *lach*]]
-
<li>new vector name: pAAV_iGEM-MCS_mVenus <br>
+
Wh did you digest with eco and ndeI?? is there a spechía reasonn for it?? if the coonstruct was in the rfc standard could digest it with the igem standard enzymes??
-
<li>buffer used:4 ; Restriction-enzymes used: Enzyme AgeI (no. Lab:149); Enzyme XbaI (no. Lab: 63)
+
-
<li>DNA concentration (vector):433,78ng/µl ; DNA concentration (insert): 530 ng/µl<br /><br />
+
{| border="1"
{| border="1"
-
| components  || align="right" | V (pAAV_iGEM-MCS)/ µl ||align="right"| I(pGA14mVenus_Geneart) / µl
+
| components  || align="right" |sample /µl
|-
|-
-
| DNA  ||  align="right" | 2,3||align="right"|3,8
+
| DNA  ||  align="right" | 2,5
|-
|-
-
| BSA (10x) ||  align="right" |2||align="right"|2
+
| BSA (100x) ||  align="right" | 0
|-
|-
-
| Buffer 3 (10x)||  align="right" |2||align="right"|2
+
| Buffer ___4_ (10x)||  align="right" | 1,5
|-
|-
-
|Enzyme: AgeI (no.Lab:149)||  align="right" |1,25||align="right"|1,25
+
|Enzyme NdeI (no.Lab:___)||  align="right" | 0,5
|-
|-
-
|Enzyme: XbaI (no.Lab:63)||  align="right" |0,75||align="right"|0,75
+
|Enzyme EcoRI (no.Lab:___)||  align="right" |0,5
|-
|-
-
|H<sub>2</sub>O||  align="right" |11,7||align="right"|10,2
+
|H<sub>2</sub>O||  align="right" |10
|-
|-
-
|'''Total volume'''||  align="right" |<b>20</b>||align="right"|<b>20</b>
+
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | |15
|}
|}
-
<li> Incubation: 1 1/2 h at 37°C<br>
+
<li> Incubation: 1 h
 +
<br />
 +
<br />
-
0.5 g Agarose, 50 ml TAE (1%), 3 µL GELRED (3-6µl), at 115 Volt, running time:  
+
[[File:Freiburg10 test digestion of CD.jpg|500px|]]
<br />
<br />
<br />
<br />
-
{| border="1" cellspacing="0" cellpadding="2" bordercolor="black"
 
-
!Sample
 
-
!Sample/µl]
 
-
!Loading dye (6x)/µl
 
-
!Expected size 1 (Geneious)
 
-
!Expected size 2 (Geneious)
 
-
|--
 
-
|P34.2
 
-
|20 µl
 
-
|4 µl
 
-
|4617 bp
 
-
|22 bp
 
-
|--
+
Sample 1 was sent for sequencing
-
|pGA14mVenus
+
<br/>
-
|20 µl
+
-
|4 µl
+
-
|2870 bp
+
-
|774 bp
+
-
|}
+
-
<br /><br />
+
-
<li>Gel loaded with vector and insert samples, 24 µl each & 8 µl marker
+
-
<li>after 20 minutes, the insert band was cut out. Two overlapping bands were visible in the vector well, after 1 1/2 hours those bands were separated and both were cut out. <br /><br />
+
 +
===109. labday 03.09.2010===
 +
====<p style="font-size:15px; background-color:#ff00ff;"><b>Miniprep and test digestion of pSB1C3_lITR_pTERT_ßglobin_mVenus_hGH_rITR</b></p>====
 +
<b>Investigator: Achim <br /></b>
 +
<br/>
 +
Comment: The test digestion did not show the expected fragments of 2000 and 2500 bp. the photo was exposed too long to see distinct bands. Digestion will be repeated.
-
{| border="1"
+
[[File:AA1.png|100px]]
-
| Sample|| align="right" | weight || align="right" | concentration
+
<br/>
-
|-
+
-
| Vektor_Oben  ||  align="right" |0,32 g  ||  align="right" |29,8 ng/µl
+
-
|-
+
-
| Vektor_Unten ||  align="right" |0,14 g  ||  align="right" |12,8 ng/µl
+
-
|-
+
-
| Insert||  align="right" |0,3 g  ||  align="right" |12,9 ng/µl
+
-
|}
+
====<p style="font-size:15px; background-color:#ff00ff;"><b>Sequencing results</b></p>====
-
<br /><br />
+
<b>Investigator: Hanna <br /></b>
-
<li>the exact volume of insert and vector was calculated with LabTools:
+
<br/>
-
<li>Ligation I with Vektor_Oben:
+
<b>Comment:</b> pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker were cloned and sent for sequencing yesterday.
-
<ul>
+
<br/>
-
*Vector: 4,16 µl
+
-
*Insert: 4,84 µl
+
-
</ul>
+
-
<li>Ligation II with Vektor_Unten:
+
-
<ul>
+
-
*Vector: 6 µl
+
-
*Insert: 3 µl
+
-
</ul>
+
 +
<b>1. pCerulean_Zegfr:1907:</b> Sequencing looked well.
 +
<br/>
 +
[[File:Freiburg10 pCerulean Zegfr1907 seq.JPG|700px]]
 +
<br/>
 +
<b>2. pCerulean_6xHis_MiddleLinker:</b> Sequencing looked also well.
 +
[[File:Freiburg10 pCeruelan 6xHis MiddleLinker seq.JPG|700px]]
 +
<br/>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>continuation of site-directed mutagenesis</u></p>
+
====<p style="font-size:15px; background-color:#ff00ff;"><b>Cloning of pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker</b></p>====
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion with DpnI:</p>
+
<b>Investigator: Hanna <br /></b>
-
<li>0.5 µl DpnI added
+
<br/>
-
<li>incubated for 1 hour at 37°C
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Trafo:</p>
+
<p style="color:#ff00ff;"><b>Comment:</b> For N-terminal fusion to VP2, the Affibody - fused to different kinds of linkers - will be cloned into the expression plasmid pCerulean. For imaging CFP, which was fused to the middle linker, will be cloned into pCerulean. </p> <br/>
-
<li>Cells used for transformation: XL1B
 
-
<li>Centrifugation for 3 min at 8000 rpm instead of 6000 rpm (accidentaly)
 
-
<li>Plated on agar plate: pAAV_IGEM-MCS Mutagenese PST1 8.6.2010 AM XL1B
 
-
<li>incubated over night
 
-
<br>
 
-
<br>
 
-
====25. Labortag 09.06.2010: pAAV_iGEM-MCS_mVenus-YFP, site-directed mutagenesis====
 
-
investigators: Jessy, Achim, Sven, Toby, Hanna
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: red;">'''No pAAV_iGEM-MCS_w/oPstI transformed bacteria (site-directed mutagensis) grew on the ampicillin agar plates over night! '''</p> Experiment is conducted again by Toby (Thanks a lot!!!).<br>
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: red;">'''Further on the cloning of mVenus-YFP into pAAV_iGEM-MCS seemed to fail: '''</p> Only on the agar plate cotaining the bacteria transformed with the "vector_oben" ligation, which actually should be the "wrong" ligation (gelextraction of a band which contained fragments that were too large, see picture in lab journal), revealed colonies. Therefore this experiments is also conducted one more time by Sven (thanks also a lot!!!)<br>
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Insertion of mVenus_YFP into pAAV_iGEM-MCS</u></p>
 
-
*experiment date: 9.6.2010
 
-
*name of investigator: Sven
 
-
*plasmid:
 
-
**Vector: name: pAAV_iGEM-MCS number: 34.2 production date: 5.6.2010
 
-
**Insert: name: pOG14_mVenus number: - production date: ____ origin: Sven :)
 
-
*new vector name: pAAV_iGEM-MCS_mVenus-YFP
 
-
*buffer used: NEB4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) AgeI ; Enzyme 2 (no.Lab:___) XbaI
 
-
*DNA concentration (vector): 433 ng/µL ; DNA concentration (insert): 530 ng/µL
 
-
<br />
 
-
<br />
 
-
<p style="font-size:15px; font-weight: bold; color: blue;">Digestion</p>
 
-
{| border="1"
 
-
| components  || align="right" |volume of vector /µl || align="right" |volume of insert /µl
 
-
|-
 
-
| DNA  ||  align="right" |2.83  ||  align="right" | 2.77
 
-
|-
 
-
| BSA (100x) ||  align="right" | 0.5 ||  align="right" | 0.5
 
-
|-
 
-
| Buffer NEB4 (10x)||  align="right" | 3.0 ||  align="right" | 3.0
 
-
|-
 
-
|Enzyme 1 (AgeI)||  align="right" | 1.75 ||  align="right" | 1.75
 
-
|-
 
-
|Enzyme 2 (XbaI)||  align="right" | 1.25 ||  align="right" | 1.25
 
-
|-
 
-
|H<sub>2</sub>O||  align="right" |20.73 ||  align="right" | 20.67
 
-
|-
 
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | 30 ||  align="right" | 30
 
-
|}
 
-
<br /><br />
+
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Practical Cloning:</p>
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
-
<br />
+
-
0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED (3-6µl), at 115 Volt
+
-
<br />
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Gelextraction</p>
+
*plasmid:
 +
**Vector: name: pCerulean number: P273
 +
**Insert: name: pSB1C3_Zegfr:1907_LongLinker (P298), pSB1C3_Zegfr:1907_MiddleLinker (P290), pSB1C3_Zegfr:1907_SEG (P296), pSB1C3_Zegfr:1907_ShortLinker (P292), pSB1C3_CFP_MiddleLinker (P276)
 +
*new vector name: pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker
 +
*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 EcoRI-HF ; Enzyme 2 PstI-HF
 +
*DNA concentration (vector): 419.5 ng/µL ; DNA concentration (insert): P298 229.7 ng/µL, P290 227.4 ng/µl; P296 218.7 ng/µL; P292 196.6 ng/µL; P276 207.7  ng/µL
<br />
<br />
-
* insert (mVenus-YFP): 26 ng/µL
+
'''Comments:''' No.
-
* vector (pAAV_iGEM-MCS): 30 ng/µL
+
-
<p style="font-size:15px; font-weight: bold; color: blue;">Ligation</p>
+
-
<br />
+
-
* vector: 5.85 µL
+
-
* insert: 3.15 µL
+
-
* ligase: 1 µL
+
-
* buffer: 10 µL
+
-
<br>
+
-
<br />
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Test digestion of pAAV_iGEM-MCS</u></p>
+
-
p style="font-size:15px; font-weight: bold; color: blue;">Test digestion</p>
+
-
*buffer used: 1 ; Restriction-enzymes used: Enzyme 1 (no. Lab:___) NgoMIV
+
-
*Plasmid
+
-
**Given Plasmid-Number: P34.2 ; DNA concentration: 433.78 ng/µL;
+
-
**Given Plasmid-Number: P34.3 ; DNA concentration: 408.48 ng/µL;
+
-
**Given Plasmid-Number: P34.4 ; DNA concentration: 409.8 ng/µL;
+
<br />
<br />
<br />
<br />
 +
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Digestion</p>
{| border="1"
{| border="1"
-
| align="left" | '''Components''' ||align="left"| '''P34.2 [µL] ''' ||align="left"| '''P34.3 [µL] '''||align="left"| '''P34.4 [µL] '''
+
| components  || align="right" |volume of pCerulean /µl || align="right" |volume of Zegfr:1907_MiddleLinker /µl || align="right"|volume of CFP_MiddleLinker /µL
|-
|-
-
| align="left" | DNA ||align="left"| 2.3 ||align="left"| 2.5 ||align="left"| 2.4  
+
| DNA || align="right" | 8.3 || align="right" | 7.6 || align="right" | 4.8
|-
|-
-
| align="left" | BSA (10x) ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
+
| BSA (10x) || align="right" | - || align="right" | - || align="right" | -
|-
|-
-
| align="left" | Buffer no. 1 (10x) ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
+
| Buffer 4 (10x)|| align="right" | 2 || align="right" | 2 || align="right" | 2
|-
|-
-
| align="left" | Enzyme 1 (no. Lab: 113) ngoMIV ||align="left"| 1 ||align="left"| 1 ||align="left"| 1
+
|Enzyme 1 EcoRI-HF|| align="right" | 1 || align="right" | 1 || align="right" | 1
|-
|-
 +
|Enzyme 2 PstI-HF||  align="right" | 1 ||  align="right" | 1 ||  align="right" | 1
|-
|-
-
| align="left" | H<sub>2</sub>O ||align="left"| 4.7 ||align="left"| 4.5 ||align="left"| 4.6
+
|H<sub>2</sub>O|| align="right" | 7.7 || align="right" | 8.4 || align="right" | 11.2
|-
|-
-
| align="left" | '''Total volume''' ||align="left"| '''10''' ||align="left"| '''10''' ||align="left"| '''10'''
+
|'''Total volume'''|| align="right" | 20 || align="right" | 20 || align="right" | 20
|}
|}
 +
*Incubation: 1.5 h
 +
<br /><br />
-
*Incubation: 1 h, 37°C
+
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Agarose-Gel:</p>
<br />
<br />
-
<p style="font-size:15px; font-weight: bold; color: blue;">Agarose-Gel:</p>
+
0.8 g Agarose, 50 TAE (1.5 %), 5 µL EthBr, at 70 Volt, running time: ~ 1 hour
-
<br />
+
-
0.5 g Agarose, 50 ml TAE (1 %), 3 µL GELRED, at 115 Volt, running time: 45 minutes + 20 minutes
+
<br />
<br />
<br />
<br />
Line 980: Line 621:
!Sample/µl]
!Sample/µl]
!Loading dye (6x)/µl
!Loading dye (6x)/µl
-
!Expected size 1 (Geneious)
+
!Expected size 1
-
!Expected size 2 (Geneious)
+
|--
|--
-
|P34.2
+
|P273
-
|10 µl  
+
|20 µl  
-
|2 µl
+
|4 µl
-
|3728 bp
+
|3922 bp
-
|903 bp
+
|--
|--
-
|P34.3
+
|P298
-
|10 µl  
+
|20 µl  
-
|2 µl
+
|4 µl
-
|3782 bp
+
|273 bp
-
|903 bp
+
|--
|--
-
|P34.4
+
|P290
-
|10 µl  
+
|20 µl
-
|2 µl
+
|4 µl
-
|3782 bp
+
|261 bp
-
|903 bp
+
|--
 +
|P296
 +
|20 µl
 +
|4 µl
 +
|345 bp
 +
|--
 +
|P292
 +
|20 µl
 +
|4 µl
 +
|249 bp
 +
|--
 +
|P276
 +
|20 µl
 +
|4 µl
 +
|801 bp
|--
|--
-
 
|}
|}
{| align=right
{| align=right
Line 1,010: Line 661:
|
|
!Marker
!Marker
-
!Sample P34.2 /µl
+
!Sample P273 /µl
-
!Sample P34.3 /µl
+
!Sample P276 /µl
-
!Sample P34.4 /µl
+
!Sample P290 /µl
 +
!Sample P292 /µl
 +
!Sample P296 /µl
 +
!Sample P298 /µl
|-
|-
!Lane  
!Lane  
-
| 8 µL
+
|5
-
| 10 µL
+
|24
-
| 10 µL
+
|24
-
| 10 µL
+
|24
 +
|24
 +
|24
 +
|24
|-
|-
|}
|}
<br />
<br />
-
'''Comments:''' Digestion of P34.2 delivered just one fragment size, revealing that - as expected after sequencing (C-deletion: no NgoMIV site in iGEM-MCS) - there was just one NgoMIV restriction site in the vector. In contrast to that the digestion of P34.3 and P34.4 delivered two bands - whereas the band of the smaller fragments looked like a smier. Because of this obscure and non-satisfying results (besides our assumption that there's something wrong with the marker :) )we decided to sequence the P34.3 vector:
 
-
* c(P34.3): 408.48 ng/µL
 
-
* Volume (plasmid): 5.14 µL
 
-
* Volume (vector): 24.86 µL
 
-
* Name of eppi: HW_34
 
-
* Primer: GATC_std_pTeSp-1
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Picking of Clones from pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben</u></p>
 
-
*experiment date: 9.6.2010
 
-
*name of investigator: Hanna, Achim
 
-
*plasmid:
 
-
**Vector: name: pAAV_iGEM-MCS_Vektor_oben 
 
-
**Insert: name: pOG14_mVenus
 
-
*new vector name: pAAV_iGEM-MCS_mVenus-YFP_Vektor_oben
 
-
<br />
 
-
The Clones were picked and incubated in 10 mL LB-Medium containing 10µL ampicillin over night at 37°C on a rotary shaker.
 
-
===26. Labortag 10.06.2010:===
+
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Gel extraction</p>
-
====Site-directed mutagenesis of PstI in ITRs====
+
<br />
-
<p style="font-size:12px; font-weight: bold; color: blue;">1. Site directed mutagenisis</p><br>
+
Gel measurement:
-
 
+
<br />
-
* Aim: deletion of PstI from both ITR's
+
-
* 2 PCR tubes got prepared, one for the left ITR and one for the right. (The SDM was performed according to the standart protocol)
+
-
* [[Media:Freiburg10_Site_directed_Mutagenesis_pAAV_MCS_deletion_PstI.pdf‎]]
+
-
<br>
+
-
====Mini-Prep of pAAV_iGEM_Venus_YFP and test digestion====
+
-
<p style="font-size:12px; font-weight: bold; color: blue;">2.1 Mini-Prep of pAAV_iGEM_mVenus_YFP</p><br>
+
-
 
+
-
Title: '''pAAV_iGEM_mVenus_'''  <br>
+
-
investigator: Jessy, Achim <br>
+
-
<u>Glycerol Stocks</u>
+
{| border="1"
{| border="1"
-
| align="left" | ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2'''  
+
| align="left" | '''Sample'''
 +
| align="left" | '''Volume'''  
 +
| align="left" | '''Concentration'''  
|-
|-
-
| align="left" | '''Bacteria strain''' ||align="left"| XL1 blue ||align="left"| XL1 blue
+
| align="left" | P273
 +
| align="left" | 20
 +
| align="left" | 115.45 ng/µL 
|-
|-
-
| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM_mVenus||align="left"| pAAV_iGEM_mVenus
+
| align="left" | P276
 +
| align="left" | 20
 +
| align="left" | 9.91 ng/µL
|-
|-
-
| align="left" | '''Date''' ||align="left"| 10.06.2010 ||align="left"| 10.06.2010 
+
| align="left" | P298
 +
| align="left" | 20
 +
| align="left" | 5.07 ng/µL
|-
|-
-
| align="left" | '''given number''' ||align="left"| B30 ||align="left"| B31
+
| align="left" | P296
 +
| align="left" | 20
 +
| align="left" | 9.03 ng/µL
 +
|-
 +
| align="left" | P290
 +
| align="left" | 20
 +
| align="left" | 10.31 ng/µL
 +
|-
 +
| align="left" | P292
 +
| align="left" | 20
 +
| align="left" | 20.78 ng/µL
|}
|}
 +
<br /><br />
 +
 +
 +
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Ligation</p>
<br />
<br />
-
<u>Given Plasmid-Number</u>
+
<b>1. PCerulean_Zegfr:1907_LongLinker</b>
{| border="1"
{| border="1"
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2'''  
+
| align="left" |  ||align="left"| '''P298''' ||align="left"| '''P273'''  
|-
|-
-
| align="left" | '''given number''' ||align="left"| P35 ||align="left"| P36
+
| align="left" | '''Volume/µl''' ||align="left"| 6.61 ||align="left"| 1.39
|}
|}
<br />
<br />
-
 
+
<b>2. PCerulean_Zegfr:1907_MiddleLinker</b>
-
Title: '''pAAV_iGEM_mVenus_YFP''' (guided by Sven) <br>
+
-
investigator: Bea
+
-
<u>Glycerol Stocks</u>
+
{| border="1"
{| border="1"
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''  
+
| align="left" |  ||align="left"| '''P290''' ||align="left"| '''P273'''  
|-
|-
-
| align="left" | '''Bacteria strain''' ||align="left"| BL-21 ||align="left"| BL-21 ||align="left"| BL-21 ||align="left"| BL-21
+
| align="left" | '''Volume/µl''' ||align="left"| 5.53 ||align="left"| 2.47
-
|-
+
|}
-
| align="left" | '''Plasmidname''' ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP ||align="left"| pAAV_iGEM_mVenus_YFP
+
<br />
-
|-
+
<b>3. PCerulean_Zegfr:1907_SEG</b>
-
| align="left" | '''Date''' ||align="left"| 10.06.2010 ||align="left"| 10.06.2010 ||align="left"| 10.06.2010 ||align="left"| 10.06.2010
+
{| border="1"
 +
| align="left" | ||align="left"| '''P296''' ||align="left"| '''P273'''  
|-
|-
-
| align="left" | '''given number''' ||align="left"| B32 ||align="left"| B33 ||align="left"| B34 ||align="left"| B35
+
| align="left" | '''Volume/µl''' ||align="left"| 6.17 ||align="left"| 1.83
|}
|}
<br />
<br />
-
<u>Given Plasmid-Number</u>
+
<b>4. PCerulean_Zegfr:1907_ShortLinker</b>
{| border="1"
{| border="1"
-
| align="left" |  ||align="left"| '''Clone 1''' ||align="left"| '''Clone 2''' ||align="left"| '''Clone 3''' ||align="left"| '''Clone 4'''  
+
| align="left" |  ||align="left"| '''P292''' ||align="left"| '''P273'''  
|-
|-
-
| align="left" | '''given number''' ||align="left"| P37 ||align="left"| P38 ||align="left"| P39 ||align="left"| P40
+
| align="left" | '''Volume/µl''' ||align="left"| 4.11 ||align="left"| 3.89
|}
|}
<br />
<br />
-
<p style="font-size:12px; font-weight: bold; color: blue;">2.2 Test digestion</p>
+
<b>5. PCerulean_CFP_MiddleLinker</b>
-
*buffer used: 4 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme AgeI (no.Lab:___) ____
+
-
*Plasmid
+
-
**Given Plasmid-Number: P37; DNA concentration: 114,8 ng/µL ;
+
-
**Given Plasmid-Number: P38 ; DNA concentration: 179,8 ng/µL;
+
-
**Given Plasmid-Number: P39 ; DNA concentration: 180,8ng/µL ;
+
-
**Given Plasmid-Number: P40; DNA concentration: 189,2 ng/µL;
+
-
<br />
+
-
'''Comments:''' Clones were picked from trafo-plate in the morning and mini-prep was performed in the late afternoon. Due to this and the fact that bacterial strain was BL-21, DNA-concentrations are quite low.
+
-
<br>
+
-
<br>
+
-
Investigators: Bea, Chris W. <br>
+
-
 
+
{| border="1"
{| border="1"
-
| align="left" | '''Components''' ||align="left"| '''Volume/µL''' ||align="left"| '''Mastermix''' ||align="left"| '''Sample: P37''' ||align="left"| '''Sample: P38''' ||align="left"| '''Sample: P39''' ||align="left"| '''Sample: P40'''
+
| align="left" | ||align="left"| '''P276''' ||align="left"| '''P273'''  
-
|-
+
-
| align="left" | DNA ||align="left"| 800 ng ||align="left"| - ||align="left"|7,0 µL||align="left"|4,5 µL||align="left"|4,4 µL||align="left"| 4,2 µL
+
-
|-
+
-
| align="left" | BSA (10x) yes ||align="left"| 1,5 µL ||align="left"| 7,5 µL ||align="left"|MM 4,5 µL||align="left"|MM 4,5 µL||align="left"|MM 4,5 µL||align="left"| MM 4,5 µL
+
|-
|-
-
| align="left" | Buffer no. 4 (10x) ||align="left"| 1.5 µL||align="left"| 7,5 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
+
| align="left" | '''Volume/µl''' ||align="left"| 7.02 ||align="left"| 0.98
-
|-
+
-
| align="left" | Enzyme 1 (no. Lab:    ) AgeI ||align="left"| 0.75 µL ||align="left"| 3,75 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
+
-
|-
+
-
| align="left" | Enzyme 2 (no. Lab:    ) XbaI ||align="left"| 0.5 µL||align="left"| 2,5 µL ||align="left"|"||align="left"|"||align="left"|"||align="left"| "
+
-
|-
+
-
| align="left" | H<sub>2</sub>O ||align="left"| variable ||align="left"| - ||align="left"|3,75 µL||align="left"|0,25 µL||align="left"|6,35 µL||align="left"| 6,55 µL
+
-
|-
+
-
| align="left" | '''Total volume''' ||align="left"| '''15 µL''' ||align="left"| - ||align="left"|15 µL||align="left"|15 µL||align="left"|15 µL||align="left"| 15 µL
+
|}
|}
<br />
<br />
-
*Incubation: 45 min, 37°C
+
<p style="font-size:15px; font-weight: bold; color: #ff00ff;">Trafo</p>
<br />
<br />
-
===27. Labortag 11.06.2010:===
+
Trafo was performed following the standard protocol. Used cells: XL1b, DNA amount: 2.5 µL of each ligation reaction. Plates were stored @ 37°C room over night.
-
in additon to<p style="font-size:12px; font-weight: bold; color: blue;">Site directed mutagenisis</p> on 10.06.10
+
<br/>
 +
====<p style="font-size:15px; background-color:#66bbff;"><b>Harvest viral particles, Seeding HT1080 cells</b></p>====
 +
<b>Investigator: Adrian, Kerstin <br /></b>
-
'''transformation'''<br>
+
*Harvest viral particles of Transfection from 31.08.2010 (six approaches: 10µg of RC (2x P326 and 2x P325 and 2x Stratagene), pHelper and GOI (P262))
-
transformation was performed according to the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]]<br>
+
*Seeding HT1080 cells
-
Cells were plated on agar plates (2x 1:100; 2x pellet)containing ampicillin and stored over night at 37°C.
+
-
<p style="font-size:12px; font-weight: bold; color: blue;">Sequenzing</p>
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273)</b></p>====
-
p39 was send to GATC for sequenzing
+
Investigator: Patrick
-
* p39: 180,83 ng*µl^-1
+
<br />
-
* volume plasmid: 8,3 µl
+
The Miniprep was performed according to the standard protocol.
-
* volume water: 21,7 µl
+
Labelling:
-
* primer: GATC_std_pTeSp-1
+
*P381: pCerulean_middlelinker clone 1 upper band : 526,0 ng/µl
-
 
+
*P382: pCerulean_middlelinker clone 2 upper band : 522,0 ng/µl
-
===28. Labortag 12.06.2010:===
+
*P383: pCerulean_middlelinker clone 3 upper band : 463,0 ng/µl
-
Kira <br>
+
*P384: pCerulean_middlelinker clone 1 lower band : 465,0 ng/µl
-
The plates were stored in the iGEM shelf @ 4 °C. Even if the transformation was not very successfull, some colonies can be picked and inoculated either tomorrow or on Monday.
+
*P385: pCerulean_middlelinker clone 2 lower band : 500,0 ng/µl
-
'''Note: Site-directed mutagenesis does not generate lots of intact plasmids, so few colonies are normal!! (Tobias)'''
+
*P386: pCerulean_middlelinker clone 3 lower band : 524,0 ng/µl
 +
[[File:Cartoons48.jpg|thumb|right| Öhm Patrick: Hier ist der Grund, warum das Experiment "wiederholt" wurde: Falsche Beschrieftung hier, als auch in der Excel Tabelle ;) "Finde den Fehler!" :P]]
<br>
<br>
-
===29. Labortag 13.06.2010:===
+
see also http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/index.php/August_2010#Cloning_CFP_middlelinker_.28from_pSB1C3_CFP_middlelinker.2C_P276.29_into_pCerulean_.28P273.29
-
Jessy, Patrick, Hanna <br>
+
[[File:Mistake.png|thumb|right|400px| ;-) bitte ausfüllen]]
-
We weren't able to detect any colonies on the plates - just a few air bubbles :) To be entirely sure, we put them back into the 37°C room over night.
+
Testdigestion: 7 µl DNA sample, 1 µl Buffer 4 (10x), 1 µl BSA, 0,5 µl Xba, 0,5 µl PstI-HF
<br>
<br>
-
 
+
Expected size of the fragments: 786 & 2053bp
-
===30. Labortag 14.06.2010:===
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>pAAV_iGEM-mVenus-YFP:</u></p>
+
-
The sequencing data of pAAV_iGEM_mVenus-YFP was analyzed. The alignment with the "theoretical" pAAV_iGEM_mVenus-YFP showed that we successfully inserted mVenus-YFP into pAAV_iGEM-MCS.
+
-
[[File:Freiburg10 mVenus-Alignment.jpg|800x800px|]]
+
<br>
<br>
-
 
+
There seems to be something wrong.
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Site-directed mutagenesis:</u></p>
+
-
Also today no colonies were detectable on any plates!
+
<br>
<br>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>TK-GMK-Plasmid</u></p>
+
[[File:Freiburg10_pat20100903.jpg‎|400px]]
-
Adrian, Hanna <br>
+
-
puB6_V5_His6_clone1 + TK/GMK (P15) will be sequenced again: <br>
+
-
* name: AF 1
+
-
* primer: GATC_std_BGH-reverse
+
-
* volume(plasmid) = 4.25 µL
+
-
* volume (H<sub>2</sub>O) = 25.75 µL
+
-
Results (15.06.): Unfortunately just ~ 300 bp were sequenced. <br>
+
-
<p style="font-size:13px; font-weight: bold; color: purple;">To do: Therefore more primers have to be designed in order to sequence the whole ~2000 bp TK-GMK fusion construct! </p>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Zellkultur</u></p>
+
Sent for sequencing: P381 & P385
-
AAV 293 and HT1080 Cells have been splitted and plated out on 10 cm dishes for transfektion.
+
Labelling: P381-CMV_rev & P385-CMV_rev <br>
-
The Cells were accounted by using the Neubauer-Meteringchamber.
+
Used primer: O21 : CMV_reverse_qPCR
-
After harvesting by following the standard protocol the pallet have been resuspendiated in 15ml of DTT medium.
+
-
2,5µl of this cell suspension have been mixed with 47.5µl of trypan blue.
+
-
We counted 12,5x 10^6 cells/ml for the T293 AAV cell line and 10x10^6 cells /ml for the HT1080 cell line.
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Cloning of pSB1C3_leftITR_pTert and pSB1C3_mGMK with pSB1C3_leftITR_CMV</b></p>====
 +
<b>Investigator: Chris L. <br /></b>
-
The AAV 293 cells have been plated out on four dishes with 250µl of the cell suspension, on one plated with 1ml and on another dish
+
*Vector: name: pSB1C3_leftITR_pTERT clone 1 '''P256''' c=179,2 ng/µl
-
with 1.5ml.
+
*Vector: name: pSB1C3_leftITR_CMV '''P188''' c=231,6 ng/µl
-
note that that the date is wrong on the plates and the flasks! Cells have been already plated out on the 14th. of June.
+
*Insert: name: pSB1C3_mGMK '''P195''' c=258,6 ng/µl
 +
*new vector name: pSB1C3_leftITR_CMV_GMK
 +
*new vector name: pSB1C3_leftITR_pTERT_GMK
 +
*buffer used: 4 ; Restriction-enzymes used: Enzyme 1 PstI ; Enzyme 2 SpeI ; Enzyme 3 XbaI
 +
<br />
 +
{| border="1"
 +
| '''components'''  || align="right" |'''P195''' || align="right" |'''P256 /µl''' || align="right" |'''P188 /µl'''
 +
|-
 +
| DNA  ||  align="right" | 7,7 ||  align="right" | 11,2 ||  align="right" | 8,6
 +
|-
 +
| BSA (10x) ||  align="right" | 2 ||  align="right" | 2 ||  align="right" | 2
 +
|-
 +
| Buffer 4 (10x)||  align="right" |2 ||  align="right" |2 ||  align="right" |2
 +
|-
 +
|Enzyme SpeI ||  align="right" |1 ||  align="right" |1 ||  align="right" |0
 +
|-
 +
|Enzyme XbaI ||  align="right" |0 ||  align="right" |0 ||  align="right" |1
 +
|-
 +
|Enzyme PstI ||  align="right" |1 ||  align="right" |1 ||  align="right" |1
 +
|-
 +
|H2O||  align="right" | 6,3 ||  align="right" | 2,8 ||  align="right" | 5,4
 +
|-
 +
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | 20||  align="right" |20 ||  align="right" |20
 +
|}
-
We also seated two flasks one for each cell line. Therefor we used 1ml of the HT1080 cell suspension and two ml of the the AAV293 cells.
+
<br />
-
<br>
+
0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED , at 130 Volt, running time:45
 +
<br />
<br>
<br>
 +
'''Results''': <br>
 +
[[File:Freiburg10 pSB1C3 lITR pTERT and pSB1C3 lITR CMV with GMK Insert.jpg|550px]] <br>
 +
<br />
-
===31. Labortag 15.06.2010:===
+
*c(Insert)= 15,37 ng/µl; size: 627 bp <br />
-
Adrian, Achim, Chris W., Hanna
+
*c(Vector)= 50,84 ng/µl; size: 2869 bp
 +
*c(Vector)= 75,64 ng/µl; size: 2672 bp
 +
<br />
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Solutions for transfection were prepared:</u></p>
+
*Ligation of PCR products and vector:
-
* 1 x TE-Buffer: 1.2114 g TRIS, 0.2 mL EDTA, 81 mL milipore-H<sub>2</sub>O were mixed. pH was adjusted with HCl (1M and 5M) to 7.50. Volume was adjusted to 100 mL with milipore-H<sub>2</sub>O. Solution was autoclaved (sterilization by filtration is also possible). <br>
+
-
* 1 M CaCl2: 147.02 g CaCl2 x 2H<sub>2</sub>O (M = 147.02 g/mol) was solved in 1 Liter H<sub>2</sub>O and sterilized by filtration.<br>
+
-
* 2 x HBS: 0.027 g Na2HPO4, 1.636 g NaCl, 1.19155 g HEPES were dissolved in ~ 30 mL milipore-H<sub>2</sub>O. pH was adjusted to 7.10. Volume was adjusted to 100 mL and sterilized by filtration.<br>
+
-
<br>
+
-
===32. Labortag 16.06.2010:===
+
For the Ligation 1µl T4 buffer (10x) and 1µl T4 ligase were used. Incubation time: 45 min
 +
<br />
 +
{| border="1"
 +
| ''' '''  || align="right" |'''pSB1C3_leftITR_CMV + GMK /µl'''|| align="right" |''' pSB1C3_leftITR_pTERT + GMK'''
 +
|-
 +
| Vector || align="right" |5,48 ||  align="right" | 6,21
 +
|-
 +
| Insert || align="right" |2,52 ||  align="right" | 1,79
 +
|-
 +
|}
 +
<br />
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sponsoring:</u></p>
+
*Transformation:
-
Anna, Kerstin, Anissa<br>
+
-
Sponsoring letters were examined and modified one more time. <br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of TK-GMK:</u></p>
+
The transformation was done following the standard protocol using XL1 blue cells.<br />
-
Hanna<br>
+
<br />
-
Two primers were designed and ordered from Sigma-Aldrich. Probably we will receive them on Friday.<br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Mega primer PCR:</u></p>  
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Sequence analysis of pCerulean_VP1up</b></p>====
-
Bea, Hanna <br>
+
<b>Investigator: Bea<br /></b>
-
<br>
+
<p style="font-size:13px; color:#66bbff;">The assembled pCerulean_VP1up which serves as the first construct in the VP1 insertion cloning assembly was sent for sequencing. </p>
-
[[File:Freiburg10 ITRprimer.jpg]]
+
-
 
+
-
===33. Labortag 17.06.2010:===
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Primer designing: VP1 primer for pKEX forward/reverse </u></p>
+
-
Investigator: Volker<br>
+
-
The construnts that we receieved from PD Dr. Kleinschmidt (DKFZ) are mainly in the pKEX backbone. The sequences of the backbone and the inserts are not availible, for this reason we decided to sequence the constructs. The first step is to sequence from one construct into the backbone. In the second step we will designe primers that bind in the backbone and point into the direction of the insert.
+
-
These primers will then be used to sequence the inserts of all the constructs.<br>
+
-
 
+
-
'''Forward primer pKEX in VP1 from bp 4124 to 414'''
+
-
*VP1 primer for pKEX forward: 5' - CAACAAGTCTGTTAATGTGGAC - 3' 22bp; TM: 50°C; CG% 41%
+
-
 
+
-
'''Reverse primer pKEX in VP1 from bp 2081 to 2100'''
+
-
*VP1 primer for pKEX reverse: 5' - GTGGGCCAGGTTTGAGCTTC - 3' 20bp; TM: 54°C CG%: 60%
+
-
 
+
-
The amplicon that should  be produced by the primers is 199 bp long.
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Primer designing: CMV_forward/reverse_qPCR </u></p>
+
-
Investigator: Volker<br>
+
-
Primers for the titering of the CMV region from the literature [Rohr et al., 2002] and [Rohr et al., 2005] were compared and analysed.
+
-
The sequences from 2002 showed a differce in one nucleotide compared to the other primer and to our sequence. For this reason the second set [Rohr et al., 2005] was ordered.<br>
+
-
 
+
-
*CMV_forward_qPCR: 5' - GGGACTTTCCTACTTGGCA - 3'
+
-
*CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'
+
-
 
+
-
[[File:Freiburg10_Binding of the CMV_qPCR primer in the vector plasmid.jpg|900px|left|thumb|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]<br>
+
-
 
+
-
<p style="clear:both;">These primers will be used in a quantitative PCR assay with Sybr-green to measure the genomic titer and the infectious titer of the viral particles we will produce in the future.</p>
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Ordering of required reagents: </u></p>
+
-
Investigator: Volker<br>
+
-
 
+
-
*Nuclease S1 was ordered from Promega (10000Units for 36,00€)
+
-
*Proteinase K was ordered from Sigma  (5mg for 31,30€; BioUltra, ≥30 units/mg protein, lyophilized powder)
+
-
These reagents are required for the procedure to determine the genomic and the infectious titer.<br><br>
+
-
 
+
-
===34. Labortag 18.06.2010: Transfection===
+
-
====Transfection====
+
-
Transfection via calcium phosphat with the prepared solutions (31. Labortag 15.06.2010)
+
-
<br>
+
-
 
+
-
'''investigators:''' Chris W., Hanna, Patrick, Adrian, Volker<br>
+
-
Transfections with the following plasmids:
+
-
 
+
-
1)
+
-
* pAAV_iGEM_mVenus_YFP (glycerol stock B34, P39) P39 has the correct sequence (confirmed)
+
-
* pHelper
+
-
* pAAV_RC
+
-
2)
+
-
* pAAV_iGEM_mVenus_YFP (glycerol stock B33, P38) P38 (we dont know if P39 has the correct sequence!)was used because the amount of P39 ''[[was not sufficient enough]]'' for four Transfections!
+
-
* pHelper
+
-
* pAAV_RC
+
-
 
+
-
Plasmid concentrations: <br>
+
-
pAAV_RC: 1 µg/µl <br>
+
-
pHelper: 280 ng/µl <br>
+
-
pAAV_iGEM_mVenus_YFP, P39: 180,83 ng/µl <br>
+
-
pAAV_iGEM_mVenus_YFP, P38: 179,75 ng/µl <br>
+
-
 
+
-
Cellculture clone 1 and 2 were transfected with P39. Cellculture clone 3 and 4 were transfected with P38. <br>
+
-
 
+
-
Deviations from the standard protocol (currently incomplete):
+
-
We could only pipet 3,3 µg (instead of 10 µg) from each of the 3 plasmids into the 15 ml falcons due to insufficient amount of plasmid.
+
-
 
+
-
Adrian tried to examine the precipation of the CaCl2+ DNA Clusters. We have to optimize the pH of our 2xHBS at the moment it is 11.12
+
-
<br>
+
-
 
+
-
====Theoretical: Digestion of pAAV_MCS for PCR to design ITR BioBrick====
+
-
'''investigator''': Bea <br />
+
-
'''idea:'''
+
<ul>
<ul>
-
<li>Digest vector in order to obtain two fragments which contain the left and the right ITR respectively. </li>
+
<li>Plasmid used: P365</li>
-
<li>Separation (Agarose-gel) and gel extraction of fragments</li>
+
<li>Primer used: CMV-F</li>
-
<li>Perform PCR with iGEM-Primers (forward primer contains EcoRI and Xbai; reverse primer contains SpeI and PstI)</li>
+
<li>Tube name: SB1</li>
-
<li>to do:</li>
+
<li>Folder (Geneious): N-terminal Targeting --> pCerulean_VP1up_NLS</li>
-
* design primers
+
-
* digestion of pAAV_MCS etc.
+
</ul>
</ul>
-
'''Theoretical:''' Digestion of pAAV_MCS with AlwNI produces two fragments which can be separated by agaorse gel.
+
<br />
-
<br>
+
<gallery widths=900px heights=300px>
-
[[File:Freiburg10 pAAV MCS fragments cut with AlwNI preparation for PCR.jpg|900px|thumb|left|Obtaining fragments by digestion with AlwNI. Fragments contain left and right ITR respectively]]
+
Image:Freiburg 10 SeqAnalysis of pCerulean VP1up NLS 03.09.2010.jpg
-
<br>
+
</gallery>
-
<br>
+
<br />
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
===35. Labortag 19.06.2010: Literature seminar===
+
====<p style="font-size:15px; background-color:#66bbff;"><b>pCerulean_VP1up_NLS_Targeting molecule</b></p>====
-
 
+
<b>Investigator: Bea<br /></b>
-
'''Investigators: Bea, Hanna, Melanie, Denis, Volker, Christian W., Adrian and Achim'''
+
<p style="font-size:13px; color:#66bbff;">Comment: For preparing the next step in the VP1 insertion, different targeting molecules will be fused to the construct pCerulean_VP1up_NLS. </p>
-
 
+
<ol>
-
Topics:  
+
<li>The first construct is the Affibody Z<sub>EGF-R:1907</sub> which was already cloned into the standard iGEM plasmid and can be sued for target tumor cells overexpressing the EGF receptor.</li>
-
*The ITRs
+
<li>The second construct is the mVenus (Yellow fluorescent protein) which can be used for imaging experiments</li>
-
*The Cap
+
<li>Another motif will be the His-tag. Since the His-tag is very small, the oligos will be hybridized and directly ligated into the pCerulean backbone.</li>
-
 
+
</ol>
-
===36.Labortag 20.06.2010: Picking clones of sequenced pAAV_igEM_mVenus_YFP===
+
<br />
-
'''Investigators: Bea and Chris W'''
+
<b>Digestion of vector:</b>
<ul>
<ul>
-
<li>Incoluate 250 mL  DYT medium (add 250µL ampiciliin) with B34 (glycerol stock: BL-21 E.coli cells with P39 plasmid: pAAV-iGEM_mVenus_YFP </li>
+
<li>Plasmid used: pCerulean_VP1up_NLS (P365) c=470 ng/µL</li>
-
<li>Incubate on rotary shaker over-night (o/n) at 37°C </li>
+
<li>Add BSA</li>
-
<li>to do: perform Midi-Prep tomorrow (21.06.2010)</li>
+
<li>AgeI-HF and SpeI-HF were used</li>
</ul>
</ul>
-
 
+
<br/>
-
===37.Labortag 21.06.2010: Second Transfection, Transduction===
+
<b>Protocol of the digestion of the vector:</b>
-
 
+
-
2x HBS was steril filtrated into two 50 ml flacons. The falcons were put into the cellculture fridge.
+
-
 
+
-
New medium is prepared:
+
-
 
+
-
DMEM-Medium
+
-
*500ml DMEM with Glutamax
+
-
*10% FCS (50 ml)
+
-
*5 ml 100x Pen/Strep
+
-
*5 ml 100x NaPyruvat
+
-
 
+
-
H-DMEM-Medium
+
-
*400 ml DMEM with Glutamax
+
-
*90 ml FCS
+
-
*5 ml 100x Pen/Strep
+
-
*5 ml 100x NaPyruvat
+
-
 
+
-
Investigators: Patrick, Johannes
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Feching dry ice for the experiments </u></p>
+
-
Volker
+
-
 
+
-
Dry ice can be fetched from the department for macromolecular chemistry. The chemical depot is located in the second basement. The dry ice can be retrieved from monday to friday from 11:00 to 11:30 and from 14:15 to 14:30. The requestforms for this institute can be found in the iGEM folder and should be filled out, signed by an advisor and taken to the chemical depot. A styrofoam container is required for the transport.<br>
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Annotation of the BRs and the PLA2 domains </u></p>
+
-
Volker<br>
+
-
The Bacis Regions which are important for the nuclear localisation were annotated in the protein sequences of VP 1-3 according to:
+
-
[[Media:Freiburg10_Separate basic region motifs within the adeno-associated virus capsid proteins are essential for infectivity and assembly.pdf|[Grieger et al, 2006]]]<br>
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Endotoxin-free Midi-Prep of pAAV_iGEM_mVenus-YFP </u></p>
+
-
Chris W., Hanna (guided by Sven) <br>
+
-
Midi-Prep was performed following standard protocol: [[File:Freiburg10 Endotoxinfreie Midi.pdf]] <br>
+
-
DNA concenration was measured: 507 ng/µL <br>
+
-
Plasmid was further used for a... <br>
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>... Second Transfection</u></p>
+
-
Six transfections were performed according to the standart protocol: [[Media:Freiburg10_Transfection_protocoll.pdf]]<br>
+
-
Three 10 cm cellcluture dishes with 293 cells were transfected with 10 µg DNA (3,33 µg each plasmid) and the other three 10 cm cellculture dishes with 30 µg DNA (10 µg DNA each plasmid).
+
-
 
+
-
Plasmids:
+
-
* pAAV_iGEM-MCS_mVenus (P41), 507 ng/µl
+
-
* pAAV_RC , 1000 ng/µl
+
-
* pHelper , 280 ng/µl
+
-
 
+
-
Investigators: Patrick, Johannes
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Preparing Viral Stocks</u></p>
+
-
 
+
-
... according to the standart protocol (see AAV Helper-free System manual). No dilution was performed.
+
-
 
+
-
Investigators: Johannes, Patrick
+
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>HT1080 Transduction</u></p>
+
-
 
+
-
Four 10 cm cellculture dishes with HT1080 cells have been provided for the transduction.
+
-
*1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 1. Note: the virus solution (buffer) showed a yellow coloration.
+
-
*1 ml of the AAV-2-mVenus (derived from P 39) was pipeted to into dish 2. Note: the virus solution showed (buffer) an orange coloration.
+
-
*1 ml of the AAV-2-mVenus (derived from P 38) was pipeted to into dish 3. Note: the virus solution showed (buffer) an orange coloration.
+
-
*1 ml of the AAV-2-mVenus (derived from P 38) was pipeted to into dish 4. Note: the virus solution showed (buffer) an orange coloration.
+
-
 
+
-
Apart from the dilution, the transduction was performed according to the standart protocol.
+
-
 
+
-
Investigators: Johannes, Patrick
+
-
 
+
-
===38.Labortag 22.06.2010: Midiprep of pHelper plasmid; cloning of the rfc25 MCS===
+
-
 
+
-
Investigators: Bea, Chris W, Adrian, Achim
+
-
 
+
-
*Hybridisation of o'''ligos RFC25 EcoR1+BglII for & RFC25 EcoR1+BglII rev'''
+
-
**Programm ORIGAMI1 was modified for normal oligos:
+
-
***1  95°C  7'
+
-
***2  95°C  1'
+
-
***-1°C R=0,3°s
+
-
***Rep 70
+
-
 
+
-
*conc of Oligos: 138,3µg/µl
+
-
 
+
-
<br> '''Digestion'''
+
-
 
+
-
 
+
-
<li> plasmid: name: pAAV_MCS number: P9 production date: 01.06.2010 origin: Adrian, Hanna, Bea
+
-
<li> new vector name: pAAV_RFC25
+
-
<li> buffer used: 3 ; Restriction-enzymes used: Enzyme 1 (no. Lab:23) EcoRI ; Enzyme 2 (no.Lab:15) BglII
+
-
<li> DNA concentration (vector): 261,6 ng/µL
+
-
 
+
-
 
+
{| border="1"
{| border="1"
-
| components  || align="right" |volume of vector /µl || align="right" |volume of insert /µl
+
| align="left" | '''Components''' ||align="left"| <b>v<sub>pCerulean_VP1up_NLS</sub></b>/µL
|-
|-
-
| DNA  ||  align="right" | 5,8|| align="right" | none
+
| align="left" | DNA  ||align="left"| 3
|-
|-
-
| BSA (100x) ||  align="right" | none || align="right" | none
+
| align="left" | BSA (100x) ||align="left"| 2,5
|-
|-
-
| Buffer 3 (10x)||  align="right" |3 || align="right" | none
+
| align="left" | Buffer no. 4 (10x) ||align="left"| 2,5
|-
|-
-
|Enzyme EcoRI (no.Lab:23)||  align="right" |1,5 || align="right" | none
+
| align="left" | Enzyme 1 AgeI ||align="left"| 1
|-
|-
-
|Enzyme BglII (no.Lab:15)||  align="right" |1,5|| align="right" | none
+
| align="left" | Enzyme 2 SpeI HF ||align="left"| 1
|-
|-
-
|H<sub>2</sub>O|| align="right" | 18,2||  align="right" | none
+
| align="left" | H<sub>2</sub>O ||align="left"| 15
|-
|-
-
|'''Total volume (e.g. 15,20,25,30 µl)'''|| align="right" | 30|| align="right" | none
+
| align="left" | '''Total volume''' ||align="left"| <b>25</b>  
|}
|}
 +
<br />
 +
<ul>
 +
<li>Incubation of the sample at 37°C</li>
 +
<li>Incubation for 120 minutes</li>
 +
</ul>
 +
<br />
 +
The Targeting molecules were digested with different enzmyes than the vector for providing the ability to assemble the different constructs together without creating new restriction site but to delete them. This works by fusing NgoMIv and AgeI together.
 +
<br />
 +
<br />
 +
<b>Digestion of the targeting molecules </b>
 +
<ul>
 +
<li>Plasmids used:</li>
 +
<ol>
 +
<li>pSB1C3_zEGF-R:1907 (P284) c=146 ng/µL</li>
 +
<li>pGA14_mVenus(P60) c=280 ng/µL</li>
 +
</ol>
 +
<li>Add BSA</li>
 +
<li>NgoMIV and SpeI-HF were used</li>
 +
</ul>
 +
<br/>
 +
{| border="1"
 +
| align="left" | '''Components''' ||align="left"| <b>v<sub>ZEGFR (P284)</sub></b>/µL ||align="left"| <b>v<sub>pGA_mVenus (P60)</sub></b>/µL
 +
|-
 +
| align="left" | DNA  ||align="left"| 13 µl||align="left"| 7 µl
 +
|-
 +
| align="left" | BSA (10x) ||align="left"| 2,5 µl||align="left"| 2,5 µl
 +
|-
 +
| align="left" | Buffer no. 4 (10x) ||align="left"| 2,5 µl||align="left"| 2,5 µl
 +
|-
 +
| align="left" | Enzyme 1 NgoMIV- ||align="left"| 1,0 µl||align="left"| 1,0 µl
 +
|-
 +
| align="left" | Enzyme 2 AgeI HF ||align="left"| 1,0 µl||align="left"| 1,0 µl
 +
|-
 +
| align="left" | H<sub>2</sub>O ||align="left"| 15 µl||align="left"| 15 µl
 +
|-
 +
| align="left" | '''Total volume''' ||align="left"| <b>25</b> ||align="left"| <b>25</b>
 +
|}
 +
<ul>
 +
<li>Incubation of the sample at 37°C</li>
 +
<li>Incubation for 90 minutes</li>
 +
</ul>
 +
<br />
 +
After incubation the samples were loaded on a 1% agarose gel. The obtained gel (after running the gel for 15 minutes) can be seen below.
 +
<br />
 +
<gallery widths=400px heights=400px>
 +
Image: Freiburg10 pCerulean VP1up NLS TargetingMolecule.jpg
 +
</gallery>
 +
<br />
 +
<b>Results: </b>The boxes mark fragments which ere cut out of the gel. The left lane (pCerulean) looks a bit strange, because Marker was added after the digestion reaction instead of Loading dye.
 +
<br />
 +
<br />
 +
<p style="font-size:13px; color:#33bbff;">Parallel, for assembling the His-Tag to the construct pCerulean_VP1up_NLS, oligos for the His-Tag in the RFC25 standard (provided by Gerrit) were hybridized and can directly be ligated in the digested vector. This strategy was used because of the smal size of the His-Tag which cannot be separated easily by the agarose gel. </p>
 +
<br />
 +
<b>Hybridization of the His-Oligos</b>
 +
<ul>
 +
<li>10µL oligo1 (1:10)</li>
 +
<li>10µL oligo2 (1:10)</li>
 +
<li>4µL 100mM Tris-Cl pH 8 </li>
 +
<li>10µL 5mM MgCl<sub>2</sub></li>
 +
<li>8µL H<sub>2</sub>O</li>
 +
</ul>
 +
The used programm for the hybridization:
 +
<ul>
 +
<li>99°C 7´</li>
 +
<li>99°C 1´</li>
 +
<li>-1°C R=0,3°/s </li>
 +
<li>Goto 2 rep 74</li>
 +
<li>Hold 4°C</li>
 +
</ul>
 +
<br/>
 +
After the gel extraction of a T4 ligation was performed.
 +
<ul>
 +
<p style="font-size:13px; color:#cc3300;">Affibody Z<sub>EGF-R:1907</sub>:</p>
 +
v<sub>Cerulean_VP1up_NLS</sub> = 5,82µL<br />
 +
v<sub>ZEGF-R:1907</sub> = 2,18µL <br />
 +
<br />
 +
<p style="font-size:13px; color:#cc3300;">mVenus Z:</p>
 +
v<sub>Cerulean_VP1up_NLS</sub> = 4,04µL<br />
 +
v<sub>mVenus</sub> = 3,96 µL<br />
 +
<br />
 +
<p style="font-size:13px; color:#cc3300;">6xHisTag:</p>
 +
v<sub>Cerulean_VP1up_NLS</sub> = 0,2µL<br />
 +
v<sub>6xHisTag</sub> = 7,98µL <br />
 +
</ul>
 +
<br />
 +
<b>Next steps:</b> Picking clones of the trafo plates (containing Kanamycin) and perform the Mini-Prep. The obtaining constructs finally will be fused to the VP2/3 protein which results in the final construct for the VP1 targeting approach.
 +
<br/>
 +
<br/>
-
<li> Incubation: 1,5 h
+
====<p style="font-size:15px; background-color:#66bbff;"><b>3rd Repetition of Mini-Preps and test digestion for Loop insertion BioBricks</b></p>====
 +
<b>Investigator: Achim, Anna<br /></b>
-
*A 1% agarose gel was prepared for plasmid separation
+
Sequencing results of Loop insertion BioBricks from 02.09.10; the following clones looked well:
-
* Production of antibiotika-stock-solutions (10 x 1ml AMP)
+
*pSB1C3_587_KO_RGD_clone6.4<br>
 +
*PSB1C3_587_KO_His_clone9.4
-
* Midi Prep of pAAV-Helper: concentration. 732,6 µg/µl
 
-
 
-
 
-
 
-
Ligation of Oligos: RFC25 and pAAV-MCS.
 
-
 
-
* dilution of our Oligos RFC from 138,3 µg/µl 1:10 13,83 (71bp long)=> 0,64µl
 
-
* Vektor pAAV-MCS 23.3 µg/µl                                      => 8,36µl
 
-
* two plates are placed in the 37°C room
 
-
 
-
*Trafo has been performed following standard protocols
 
-
 
-
===39.Labortag 23.06.2010: Preparation of Viral Stock, Seeding cells===
 
-
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Design of Primer</u></p>
 
-
Achim, Hanna
 
-
 
-
In order to sequence the hGH (polyadenylation) sequence and in general the GOI (gene of interest :) ) primer were designed: [[File:Primer GOI+polyA pAAV iGEM-MCS mVenus YFP.pdf]]
 
-
<br>
 
-
These primer will be used in order to sequence P38 (pAAV_iGEM_mVenus-YFP) which delivered fluorescencing HT1080 cells - in comparison to the already sequenced P39 clone. Further on they can be used in general for sequencing any GOI. <br>
 
-
These oligos were ordered at sigma aldrich as E@sy Oligos.
 
-
<br>
 
-
P38 was send for sequencing with GATC_std_pTESp-1 primer: 12 µL P39 (180 ng/µL) + 18 µL H<sub>2</sub>O
 
<br>
<br>
 +
<p style="font-size:13px; color:#003399;"><b>Update</b>: 9 of the 14 ViralBricks looked well (sequencing results from 01. - 03.09.). Two new clones of the remaining constructs were prepared and test digested. </p>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of pKEX-VP1</u></p>
+
<b>Test digestion:</b>
-
Achim, Hanna, Adrian, Chris W.
+
-
<br>
+
-
Primer:  
+
-
* VP1 primer for pKEX forward: V = 3 µL + 27 µL H<sub>2</sub>O
+
-
* VP1 primer for pKEX reverse: V = 3 µL + 27 µL H<sub>2</sub>O
+
-
Vector:
+
-
* pKEX-VP1 (P27.2): c = 693 ng/µL, V = 3 µL + 27 µL H<sub>2</sub>O
+
<br>
<br>
 +
{| border="1"
 +
| components ||Volume for each sample /µl
 +
|-
 +
| DNA  || 10
 +
|-
 +
| BSA (10x) ||1,5
 +
|-
 +
| Buffer 4 (10x) ||1,5
 +
|-
 +
|Enzyme EcoRI HF ||0,5
 +
|-
 +
|Enzyme NotI HF ||0,5
 +
|-
 +
|H2O || 1
 +
|-
 +
|'''Total volume /µl'''||15
 +
|}
 +
<br />
 +
{| border="1"
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Thaw HT1080 and AAV-293 cells </u></p>
+
|align="left" | '''Components''' ||align="left"| '''453 BAP''' ||align="left"| '''453 Z34C'''||align="left"| '''587 Z34C'''||align="left"| '''587 KO Z34C'''||align="left"| '''587 KO Z34C SPACER'''
-
Achim, Hanna (guided by Sven)<br>
+
|-
-
Thawing of HT1080 and AAV-293 cells was performed following this protocol: [[Media:Freiburg10 Thawing cells.pdf]]
+
| align="left" | Clone||align="left"|1.5 + 1.6 ||align="left"|11.5 + 11.6 ||align="left"|12.5 + 12.6  ||align="left"|13.5 + 13.6||align="left"| 14.5 + 14.6
-
<br>
+
|-
 +
|}
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Picking clones of pAAV_RFC25 and inoculating 250 mL DYT with pAAV_iGEM_mVenus-YFP (P38) for Midi-Prep </u></p>
+
<br/>
-
Achim, Chris W., Hanna<br>
+
Incubation time: 1 h, Incubation temperature: 37°
-
Bacteria cultures are stored in 37°C room over night.
+
<br/>
-
<br>
+
-
Adrian, Sven
+
<b>Preparation of gel:</b><br/>
-
<gallery widths=500px heights=300px perrow=2 caption="Results of transduction, ~ 1% of the HT1080 showed expression of mVenus.">
+
1 g Agarose, 100 ml TAE (1%), 6 µl GELRED , at 115 Volt, running time: 45 minutes
-
File:YFP-Transduction-1.jpg|Bright light image 1
+
<br />
-
File:YFP-Transduction-2.jpg|Fluoresce microscopy image 1
+
<br/>
-
File:YFP-Transduction-3.jpg|Bright light image 1
+
[[File:3.9.10 AA.png|400px]]
-
File:YFP-Transduction-4.jpg|Fluoresce microscopy image 1
+
<br />
-
</gallery>
+
 +
<br/>
 +
<b>Expected fragment sizes /bp:</b> <br/>
 +
pSB1C3: 2051 bp<br/>
 +
BAP: ~150<br/>
 +
Z34C: ~ 200<br/>
 +
<br/>
 +
<p style="font-size:13px; color:#003399;"><b>Comment</b>: The following clones were sent for sequencing: 1.6, 12.6 ,13.6 and 14.5.<br/> To do: Retrafo of clone6.4 and clone9.4 and preparation of glycerol stocks. </p>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Preparation of viral stocks</u></p>
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Cloning of Cap into pAAV_RC_ins-rep: preparation for SDM</b></p>====
-
Johannes, Bea
+
<b>Investigator: Stefan </b>
-
Please fill in!!!
+
<p style="font-size:13px; color:red;"><b>Comment</b>: Cloning Cap into pAAV still does not work as planned. As another approach Cap can be cut using BsiWI and XcmI and performing a SDM in the part of Cap not cloned into pAAV. Primers are ordered and should arrive on monday to proceed.</p>
-
<br>
+
<br/>
-
Steril filtration of virus particles was performed (guided by Sven). Viral stocks are stored at -80°C.
+
'''Digestion:'''
-
===40.Labortag 24.06.2010: Labmeeting, Presentation/Update by Patrick and Adrian, Midi Prep of pAAV_iGEM_mVenus-YFP, Mini Prep pAAV_RFC25===
 
-
 
-
Delivery of:
 
-
<br>
 
-
 
-
Proteinkinase K (will be used for the degradation of the viral capsid prior to qPCR)
 
-
<br>
 
-
Benzonase (will be used fur viral stock preparation)
 
-
<br>
 
-
Primer for for ITR-Conversion to iGEM-Standart
 
-
 
-
 
-
*Presentations of Adrian and Patrick: [[File:Adrian.ppt]] [[File:Patrick.ppt‎]]
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Midi-Prep of pAAV_iGEM_mVenus-YFP</u></p> <br>
 
-
Investigators: Hanna, Chris W (Adrian inserted RNAse and Ethanol into Buffers)
 
-
* new kit from Qiagen was used
 
-
* 35 ml of the over-night culture was filled into a 50 mL falcon and centrifuged at '''5000 g''' at '''4°C''' for '''5 minutes'''.
 
-
* supernatant was discarded
 
-
* Midi-prep was performed according to manual of Qiagen
 
-
* final concentrations: 380,4 µg/µl
 
-
* Name of eppi: '''P44'''
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Mini Prep of P42 and P43 pAAV-RFC-25</u></p>
 
-
Investigator: Bea
 
-
* Mini-Prep was performed following standard protocols
 
-
* conc: P42: 321,5 µg/µl
 
-
* conc: P43: 310,1 µg/µl
 
-
<br>
 
-
====ITR modification via PCR====
 
-
*Primers for ITR modification were resuspended and labeled: left forward: o24, left reverse: o25, right forward: o26, right reverse: o27
 
-
 
-
====Work on pKEX backbones====
 
-
Volker
 
-
 
-
The sequencing data was evaluated and BLAST searches were carried out on NCBI to answer the question weather the sequence belongs to the backbone pKEX. This question could be answered positively. <br>
 
-
There are standard Primers from GATC that prime in the sequence. The three expression plasmids from PD Kleinschmidt will therefor be sequenced tomorrow.<br>
 
-
Additionnaly nine primers for sequences in the AAV Rep and Cap genes were disigned.
 
-
'
 
-
<br>
 
-
 
-
===41.Labortag 25.06.2010: PCR of ITRs, Splitting HT1080 and AAV-293 cells, Seeding of HT1080 cells, Creating Virus Stock Economics, Medium check===
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Preparation for PCR of ITRs </u></p>
 
-
 
-
==== '''Digestion of pAAV_MCS (P9)''' ====
 
-
 
-
<li> experiment date: 25.06.2010
 
-
<li> name of investigator: Bea
 
-
<li> plasmid: name: pAAV_MCS number: P9 production date: 08.05.2010 origin: SH
 
-
<li> buffer used: 4 ; Restriction-enzymes used: Enzyme 1 (no. Lab:113) NgoMIV ; Enzyme 2 (no.Lab:120) AlwNI
 
-
<li> DNA concentration (vector): 267,9 ng/µL
 
-
<br>
 
-
In order to receive the best PCR-results, two digestion reactions/approaches have been performed. <br>
 
-
The first digestion was cut only with AlwNI, the second digestion was cut with AlwNI and NgomIV.<br>
 
-
<br>
 
{| border="1"
{| border="1"
-
| components  || align="right" |v(pAAV_MCS 1) /µl || align="right" |v(pAAV_MCS 2) /µl
+
| components  || align="right" |pMA_RepCap Vector_SDM_InsPvuII (P211) || align="right" |pAAV_RC_ins-rep (P250)  
-
|-
+
-
| DNA  ||  align="right" | 4||  align="right" | 4
+
|-
|-
-
| BSA (100x) ||  align="right" |none ||  align="right" | none
+
| DNA  ||  align="right" |7,9 ||  align="right" | 2,1
|-
|-
-
| Buffer 4 (10x)||  align="right" | 2||  align="right" | 2
+
| Buffer 2 (10x)||  align="right" |2 ||  align="right" | 2  
|-
|-
-
|Enzyme AlwNI (no.Lab: 120)||  align="right" |1 ||  align="right" | 1
+
|XcmI ||  align="right" |1 ||  align="right" |1
|-
|-
-
|Enzyme NgoMIV (no.Lab:113)||  align="right" | none ||  align="right" | 1
+
|BsiWI  ||  align="right" |1||  align="right" |1
|-
|-
-
|H<sub>2</sub>O||  align="right" | 13,0||  align="right" | 12,0
+
|H<sub>2</sub>O||  align="right" |8,1 ||  align="right" | 13,9
|-
|-
-
|'''Total volume (e.g. 15,20,25,30 µl)'''||  align="right" | '''20'''||  align="right" | '''20'''
+
|'''Total volume '''||  align="right" |20||  align="right" | 20
|}
|}
-
<br>
+
<br />
-
<li> Incubation:1,5h
+
<p style="font-size:13px; color:red;"><b>Comment</b>:Digestion was performed using two steps, first incubating for 1 hour at 37 °C, afterwards for 1,5 hours at 55 °C.</p><br />
-
<li> 1% agarose gel has been prepared. Running the gel at 110 V for 45 minutes.
+
<br />
-
<li> Loading plan: Marker (8 µL), pAAV_MCS 1 (24 µL), paav_MCS 2 (24 µL)
+
-
<br>
+
 +
'''Gel:''' <br />
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Splitting of HT1080 and AAV-293 cells, Seeding of HT1080 cells </u></p>
+
0,5 g Agarose,50 ml TAE (1%), 5 µl EtBr , at 115 Volt, running time: 50 minutes
-
Investigator: Hanna <br>
+
<br />
 +
<br />
-
'''HT1080:'''
+
<br />
-
* Cells showed 80 % confluence
+
<br />
-
* Cells were washed with PBS, detached with Trypsine
+
[[File:Freiburg10 pCerulean pMA pAAV.png|500px|]]
-
* 10 mL DMEM was added, cell suspension was centrifuged for '''5 minutes''' at 200 g.
+
<br />
-
* Supernatant was discarded, pellet was resuspended with 8 mL DMEM.
+
<br />
-
* '''Cells were counted: 47.5  µL Trypan blue (stains dead cells) and 2.5 µL cell suspension were mixed and applied onto a Neubauer counting chamber''' -> 2.2 x 20 x 10^-4 cells per mL
+
<br />
-
* Therefore 27 µL of the cellsuspension was added to each 3 mL DMEM in the 6-well plates. '''-> 2 6-well plates were prepared for transduction!'''
+
<br />
-
* Further on cells were splitted: 110 µL cell suspension was pipetted into 2 75T flasks each containing 20 mL DMEM and stored in the 37°C incubator.
+
<br />
-
<br>
+
-
'''AAV-293 cells:'''
+
'''Gelextraction:'''<br />
-
* Cells showed ~ 50% confluence
+
-
* Cells were splitted following the standard protocol.
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Creating Virus Stock Economics</u></p>
+
The gelextraction was performed according to the standard protocol. DNA concentration of the extracts:
-
Investigators: Adrian
+
* pMA_RepCap Vector_SDM_InsPvuII (P211): c= 6,26 ng/µl
 +
* pAAV_RC_ins-rep (P250): c= 13,72 ng/µl
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Medium check </u></p>
 
-
Investigator: Adrian
 
-
*three little culture bottles got prepared (H-DMEM, DMEM and PBS) and set into the incubator. In the following days they'll get checked for bacerial growth.<br>
 
-
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing results of pAAV_RFC25 </u></p>
 
-
investigators: Adrian, Bea, Hanna<br>
 
-
 
-
[[File:Freiburg10 SeqAnalysis pAAV RFC25 25 06 2010.jpg|900px|thumb|left|SpeI restriction site deletion in sequenced data (on bottom).]]
 
<br>
<br>
-
<p style="clear:both;">'''sequenced sample''': pAAV_RFC25 clone 2 (P43)</p>  
+
'''Quick Ligation:'''<br />
-
'''used primer''': GATC_std_pTeSp-1.ab1 <br>
+
<p style="font-size:13px; color:red;"><b>Comment</b>: XcmI produces only 1 base overhang, therefore Quickligase was used for ligation and incubation time increased.</p>
-
The alignment with the theoretical construct showed, that there's a exchange of one base in the RFC25-multiple cloning site. This substitution leads to the deletion of the SpeI restriction site. <br>
+
The Ligation was performed as following:<br />
-
Therefore we checked the order sheet (everything OK!).<br>
+
* Vector Volume: 4,59 µl
-
We sent the second clone (P42) for sequencing (Hanna).
+
* Insert Volume: 4,41 µl
-
* V(Plasmid) = 6.5 µL
+
-
* V(H<sub>2</sub>O) = 23.5 µL
+
-
* Primer: pTESP-1
+
<br>
<br>
-
<br>
+
* 10 µl QuickLigase buffer (2x)
 +
* 9 µl (Vector + Insert) mix
 +
* 1 µl QuickLigase
 +
<br> Incubating for 60 minutes.
-
====Annotation and studies of the AAV structure====
 
-
Investigator: Volker
 
-
 
-
The NGR- and the HPSG motif were annotated in the gene sequences according to [[Media: Freiburg10_Michelfelder Trepel 2009 AAV and Their Redirection to Cell-Type Specific Receptors.pdf|[Michelfelder & Trepe; 2009]]]
 
-
The pdb sequence were visualized with the programm [http://www.pymol.org| PyMOL] and the important motifs were highlighted.
 
-
 
-
<gallery widths=500px heights=300px perrow=2 caption="Impressions from PyMOL">
 
-
File:Freiburg10_The viral structure of AAV-2.png|thumb|left| The viral structure of AAV-2
 
-
File:Freiburg10_Sturcture of a single AAV-2 VP2 monomer.png|900px|thumb|left| Sturcture of a single AAV-2 VP2 monomer
 
-
File:Freiburg10_B-Factor indicating mobility in the crystal.png|900px|thumb|left| B-Factor indicating mobility in the crystal
 
-
File:Freiburg10_HPSG-binding-motif.png|900px|thumb|left| HPSG-binding-motif
 
-
File:Freiburg10_Residues of the HPSG-binding-motif zoom.png|900px|thumb|left| Residues of the HPSG-binding-motif
 
-
File:Freiburg10_NGR-motif.png|900px|thumb|left| The NGR-motif that is responsible for the integrin a5β1 binding
 
-
</gallery>
 
-
<br>
 
<br>
<br>
 +
'''Transformation:'''<br />
-
===42.Labortag 26.06.2010===
+
Trafo was performed according to the standard protocol (XL1b). The cells were plated on a agar plate with ampicilin.
<br>
<br>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Transduction of HT1080 cells</u></p>
 
-
Investigator: Adrian
 
-
* Transduction of 2x6 wells was successfully done (14.25)
+
===110. labday 04.09.2010===
-
* one six well is transduced with 10µg the other with 30µg DNA amount (see HEK293 infection protokoll for further information)<br>
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273): Sequencing results of P381 and P385</b></p>====
-
(A is up)
+
-
{| border="1"
+
-
| stock solution  || align="right" |1:10 Dilution || align="right" |1:50 Dilution
+
-
|-
+
-
| 1:100 Dilution  ||  align="right" | 1:500 Dilution||  align="right" | control (500µl DMEM)
+
-
|-
+
-
|}
+
-
<br>
+
-
*the delution steps (1:10, 1:50, 1:100, 1:500) are placed upon the virus stocks in the -80°C freezer in 15 ml falcons.
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Did primers for sequencing GOI arrive?</u></p>
+
Investigator:Patrick
-
====Paper reading session====
+
Sequencing results of P381 & P385 Labelling: P381-CMV_rev & P385-CMV_rev:
-
Investigators: Igor, Anna, Patrick, Stefan and Volker
+
A wrong primer was used so there are no relevant sequence data yet.
 +
On sunday i will sent these clones again for sequencing. Primer: GATC_std_CMV-F
-
Several papers were read and infomation on cap-modifications were extracted.
+
[[Image:Freiburg10_Kopfkratzen.gif|thumb|400px|Ha ich war schneller als Bea beim "Kopfkratzen-setzen" *lol*]]
-
*Trasitions of seven Tyrosines (252, 272, 444, 500, 700, 704 and 730) to Phenylalanines as described in [[Media:Freibur10_Next_generation_of_adeno-associated_virus_2_vectors-_point_mutations_in_tyrosines_lead_to_high-efficiency_transduction_at_lower_doses.pdf|[Zhong et al. 2008]]]
+
'''Hiermit verspreche ich dass es noch jede Menge Kopfkratzer, Laboraufsichtswichtel und pinke Panter geben wird (Patrick)'''
-
*Transitions of two amino acids (R459D and N551D) leading to reduced sero prevalence as described in [[Media:Designer_Gene_Delivery_Vectors-_Molecular_Engineering_and_Evolution_of_Adeno-Associated_Viral_Vectors_for_Enhanced_Gene_Transfer.pdf|[Inchan Kwonand, David V. Schaffer]‎]]
+
-
[[File:Freiburg_Results from the journal club at the 26th june.png|900px|thumb|left|Proposed transitions Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F in red & R459D and N551D in green]]
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
<br>
+
-
===43.Labortag 28.06.2010: Checking HT1080 for YFP-Expression, Creating plan: urgent things to do===
+
<br><br><br><br>
-
<br>
+
<br><br><br><br>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Checking HT1080 for YFP-Expression </u></p>  
+
-
*Hannas 2*6 wells (24.6) transduced by (Adrian 25.6)
+
-
Investigator: Sven, Patrick, Adrian
+
-
<gallery widths=500px heights=300px perrow=2 caption="Results of transduction nr.2">
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Harvest viral particles, Transduction</b></p>====
-
File: Freiburg10_2Transd10µg_unverd_2_(c1).JPG|10µg_unverd_2_(c1).JPG 48h post transduction
+
-
File: Freiburg10_2Transd10µg_unverd_1_(c1).JPG|10µg_unverd_1_(c1).JPG 48h post transduction
+
-
File: Freiburg10_2Transd30µg_unverd_2_(c1).JPG|30µg_unverd_2_(c1).JPG 48h post transduction
+
-
File: Freiburg10_2Transd30µg_unverd_(c1).JPG  |30µg_unverd_(c1).JPG 48h post transduction
+
-
File: Freiburg10_2Transd30µg_unverd_4_(c1).JPG|30µg_unverd_4_(c1).JPG 48h post transduction
+
-
File: Freiburg10_2Transd30µg_unverd_3 (c1).JPG|30µg unverd 3 (c1).JPG 48h post transduction
+
-
File: Freiburg10_2Transd30µg_unverd_6_(c1).JPG|30µg_unverd_6_(c1).JPG 48h post transduction
+
-
File: Freiburg10_2Transd30µg_unverd_5_(c1).JPG|30µg_unverd_5_(c1).JPG 48h post transduction
+
 +
<b> Investigator:Kerstin, Adrian </b>
-
</gallery>
+
*Harvest viral paricles from one plate of transfection from 01.09.2010 (10 plates, same treatment (10µg of each plasmid P357, P263, P356))
-
* The transduced cells will be checked again (29.6.).
+
*Transduction:
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing results of P42</u></p>
+
#  1x 6-well: 0,5ml of virus from 01.09.2010 (testing R/C P326)
-
Hanna <br>
+
#  1x 6-well: 0,5ml of virus from 01.09.2010 (testing R/C P325)
-
Sequencing of pAAV_RFC25 (P42):
+
#  4x 6-well: 10x 0,5ml and 4x 1ml of virus from 01.09.2010 (stratagene R/C)
-
[[File:Freiburg10 P42.jpg]]
+
#  4x 6-well: 10x 0,5ml and 4x 1ml of virus from 04.09.2010 (10 plates same treatment)
-
Sequencing delivered, that there weren't any base exchanges or deletions in this clone. Therefore P43 was dismissed (Plasmid and glycerol stock). <br>
+
#  6x 6-well: 0,5ml of virus from 21.08.2010 (TKGMK; 18x pH 7,10 and 6x pH 7,12)
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Theoretical construction of our biobricks</u></p>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Theoretical cloning</u></p>
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Repetition of Hybridisation and Cloning for Loop insertion BioBricks</b></p>====
-
Investigators: Hanna, Adrian, Chris W, Patrick, Volker
+
-
Urgent Things to do:
+
<b>Investigator: Achim, Anna<br /></b>
-
*Modification CAP:
+
*Samples:
-
**HSPG -> 2 AS
+
1: 453_BAP
-
**Targeting (585,588...) -> 2 AS -> 1 or 2 restriction sites?! Investigator: Volker
+
-
** Seroprevalence -> 2 AS
+
-
** thyrosine for ubiquitination Y252F, Y272F, Y444F, Y500F, Y700F, Y704F and Y730F
+
-
**Primer: start codons
+
-
**EGF-Rezeptor: A431-Zellinie
+
-
***Affibody: order the Gensequence
+
-
***bispecific AK -> order Diabodys (are there any restriction sites?) Investigator: kristian???
+
-
<br>
+
-
*Ordering the ITRs Investigator: Hanna
+
-
**Stratagene: right and left
+
-
**wild-type
+
-
<br>
+
-
*Modification: REP Investigator: Volker
+
-
** 3 restriction sites -> site directed mutagenisis vs. synthetic? ->order (check which is the cheaper approach)
+
-
<br>
+
-
*HGH Investigator: Hanna
+
-
** restriction sites? -> are there any available biobricks?
+
-
**biobrick production
+
-
<br>
+
-
*Beta-globin: what is the function? -> cut out?
+
-
**where is the start and the end?
+
-
**restriction sites?
+
-
**biobrick production
+
-
<br>
+
-
*GMK-TK
+
-
**restriction sites: primer
+
-
**biobrick production
+
-
**ordering the SR39
+
-
<br>
+
-
*tumor specific promotors
+
-
**more Information!!!
+
-
** telomerase specific promoters!!!
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Continuation of ITR PCR</u></p>
+
-
Hanna, Chris W., Adrian <br>
+
-
* Analytic gel was run: 1.7 µL loading dye (6x) was added to 8.3 µL of each sample (left ITR: 5 µL DMSO + 10 µL DMSO; right ITR: 5 µL DMSO + 10 µL DMSO).
+
-
* 110 V, 35 minutes
+
-
* No ITr bands were detectable - just 2 weak "primer-bands"
+
-
Conclusion: PCR didn't work. Because of that new primers were designed and ordered (Achim), which are longer and posses therefore higher annealing temperatures.
+
<br>
<br>
 +
11: 453_Z34C<br>
 +
12: 587_Z34C<br>
 +
13: 587_KO_Z34C<br>
 +
14: 587_KO_Z34C_Spacer<br>
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>ITRs (theoretical)</u></p>
 
-
Adrian, Achim, Hanna <br>
 
-
* trs sequences (GTTGG) are present in both ITRs (Stratagene)!
 
-
* assumption: transcription despite of ITR-secondary structure - no single-strand nick at trs-sequence in transduced cells ?
 
<br>
<br>
 +
<p style="font-size:13px; color:#003399;"><b>Comment</b>: New approaches of the Hybridisation and Fill-in reactions were done because it didn't work the first time. A possible reason is that the klenow enzyme wasn't inactivated. In addition, the conditions for ligation will be improved. Also the ligation of 453_BAP was done again.</p>
-
===44.Labortag 29.06.2010: Discussionround 3, Seeding HEK293 cells for transfection and titering ===
+
<b>Digestion:</b>
-
 
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>DISCUSSIONROUND</u></p>
+
-
 
+
-
*Affibodys
+
-
**Investigator: Anna
+
-
***Affibodys are 6-7kD Proteins derived from Protein A/Z
+
-
***they are binding to domain 3 from IGFR
+
-
***13 AS are replaceable for changing the tropism
+
<br>
<br>
-
*Tyrosine Mutants
 
-
**Investigator: Adrian
 
-
***replacements are done in VP3! => Volker?!
 
-
***no multi-mutants are available (instead of single mutations many Y->F)
 
-
***best candidates are: Y730F and Y444F.
 
-
<br>
 
-
*Second strand DNA-synthesis in Transduced cells
 
-
**Investigator: Achim
 
-
*** Dual strand synthesis is the main limiting for transduction/transgen expression.
 
-
 
-
<br>
 
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Seeding HT-cells for transfection and titering</u></p>
 
-
Investigators: Sven, Adrian, Bea
 
-
*The pellet was resolved in 4ml we had a 550.000 cells/ml
 
-
* 2x6 well dishes got prepared:
 
-
 
-
1. Plate I(A is up)
 
{| border="1"
{| border="1"
-
| 3x10^5 cells || align="right" |3x10^5 cells || align="right" |3x10^5 cells
+
| components ||Volume Vector 587  ||Volume Vector 453 || Sample 11  || Sample 12 || Sample 13 || Sample 14
|-
|-
-
| 3x10^5 cells || align="right" | 3x10^5 cells|| align="right" | 3x10^5 cells
+
| DNA || 3,7 || 3,7|| 6 || 6 || 6 || 6
|-
|-
-
|}
+
| BSA (10x) ||-|| -|| -|| -|| -|| -
-
 
+
|-
-
<br>
+
| Buffer 4 (10x) ||2|| 2 || 2|| 2|| 2|| 2
-
 
+
|-
-
2. Plate II (A is up)
+
|Enzyme 1° ||Bam || Ssp || Ssp || Bam || Bam || Bam
-
{| border="1"
+
-
| about 3x10^5 cells  || align="right" |only medium|| align="right" |only medium
+
|-
|-
-
| about 3x10^5 cells  || align="right" |only medium|| align="right" |only medium
+
|Enzyme 2° ||Pvu|| Sal|| Sal || Pvu || Pvu || Pvu
 +
|-
|-
 +
|H2O || 12,3 || 12,3 || 10 || 10 || 10 || 10
 +
|-
 +
|'''Total volume /µl'''||20
|}
|}
-
<br>
+
<br />
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Seeding HT1080-cells for transduction and qPCR</u></p>
+
° 1 µl each
-
Hanna  <br>
+
-
* Cell density was determined with trypan blue and counting chamber: 2 x 20 x 10^4 cells/mL
+
-
* wanted: 5 x 10^4 cells --> 125 µL cell suspension per well
+
-
* Cells were seeded into a 24-well-plate (row C and D!): 1.5 mL DMEM + 125 µL cell suspension per well
+
-
* cells were incubated for 1 hour at 37°C
+
-
<br>
+
-
Further on, cells were splitted: ~ 3 mL cell suspension was added to ~ 17 mL DMEM
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Transduction of HT1080 cells for qPCR</u></p>
+
<b>Preparation of gel:</b><br/>
-
Chris W. <br>
+
1 g Agarose, 100 ml TAE (1%), 6 µl GELRED , at 115 Volt, running time: 50 minutes
-
===45.Labortag 30.06.2010: Titering Procedure via qPCR, Transduction of 6well plates nr.4, (Seeding HEK293 for Transfection?), further Gene-Order-Investigation ===
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Repetition: Prepatation for SDM: cloning of Cap into pAAV</b></p>====
 +
Investigator: Stefan
 +
[[Image:Freiburg10_Kopfkratzen.gif|thumb|right|Schönen Abend dir noch]]
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Harvesting cells for qPCR</u></p>  
+
<p style="font-size:13px; color:red;"><b>Comment</b>: On yesterday's plates nothing grew. Because gelex and ligation products were stored in coldroom, new ligation and trafo approaches were performed. </p>
-
Investigators: Chris W, Hanna <br>
+
<br/>
-
Transduced HT1080 cells were harvested following Sven's standard protocol.
+
 +
<br />
 +
'''Ligation approaches:'''<br />
 +
* ligation with Quick Ligase (as performed yesterday)
 +
* ligation with T4 Ligase
 +
<br />
 +
<br />
 +
'''Transformation approaches:'''<br />
 +
* Quick Ligase (approach from yesterday):
 +
** 2 µl of ligation product
 +
** 4 µl of ligation product<br />
 +
<br />
 +
* Quick Ligase (new approach):
 +
** 2 µl of ligation product
 +
** 4 µl of ligation product<br />
 +
<br />
 +
* T4 Ligase:
 +
** 2 µl of ligation product
 +
** 4 µl of ligation product<br />
 +
<br />
 +
'''Transformation:'''<br />
 +
 +
Trafo of each approach was performed according to the standard protocol (XL1b). The cells were plated on a agar plate with ampicilin.
<br>
<br>
-
<p style="font-size:15px; font-weight: bold; color: blue;"><u>Transduction of 2 x 6well plates nr.4</u></p>  
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Ligation and trafo of the modified Cap insert , the Viral Bricks 1, 11, 12, 13 and 14</b></p>====
-
Investigators: Bea, Adrian...
+
-
*Master plan: Different Transduction Mechanisms
+
<b>Investigator: Volker<br /></b>
-
**rise the amount of transduced particels, instead of 500µl, 1000µl of the AAV-stock getting pipetted into each well.
+
-
**the second plate gets stimulated via UV-light to boost the expression of DNA-Repair mechanisms. This should enhance the second strand synthesis of our ssDNA-GOI => a rise of YFP Expression!
+
-
1. Plate I(A is up)
+
 
 +
<p style="font-size:15px; font-weight: bold; color: blue;">Ligation</p>
 +
<br />
{| border="1"
{| border="1"
-
| 3x10^5 cells  || align="right" |3x10^5 cells || align="right" |3x10^5 cells
+
 
 +
|'''Construct'''
 +
|'''Vector (µl)'''
 +
|'''Insert(µl)'''
|-
|-
-
| 3x10^5 cells  || align="right" | 3x10^5 cells||  align="right" | 3x10^5 cells
+
|'''ViralBrick 1 in 453'''
 +
| 7.91
 +
| 0.09
|-
|-
-
|}
+
|'''ViralBrick 11 in 453'''
-
Transduction:
+
| 6.17
-
<br>
+
| 1.83
-
 
+
-
{| border="1"
+
-
| 1000 µl of Viral Stock  DROPPED || align="right" |1000 µl of Viral Stock gently resuspended|| align="right" |1500 µl of Viral Stock hard resuspending
+
|-
|-
-
| 1000 µl of Viral Stock  DROPPED || align="right" | 1000 µl of Viral Stock gently resuspended||  align="right" | no Transduction
+
|'''ViralBrick 12 in 587'''
 +
| 6.15
 +
| 1.85
|-
|-
-
|}
+
|'''ViralBrick 13 in 587'''
-
 
+
| 5.3
-
 
+
| 2.7
-
<br>
+
-
 
+
-
2. Plate II (A is up)
+
-
{| border="1"
+
-
|  about 3x10^5 cells  || align="right" |only medium|| align="right" |only medium
+
|-
|-
-
| about 3x10^5 cells  || align="right" |only medium||  align="right" |only medium
+
|'''ViralBrick 14 in 587'''
 +
| 4.46
 +
| 3.54
|-
|-
-
|}
+
|'''p211 in pAAV-RC'''
-
<br>
+
| 5.52
-
Transduction:
+
| 3.54
-
<br>
+
-
{| border="1"
+
-
| 1500 µl of Viral Stock gently resuspended  || align="right" |no Transduction|| align="right" |no Transduction
+
|-
|-
-
| 1500 µl of Viral Stock gently resuspended  || align="right" |no Transduction||  align="right" |no Transduction
+
|'''p211 in pAAV-RC'''
 +
| 5.52
 +
| 3.54
|-
|-
|}
|}
 +
<br />
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>(Seeding HEK293 for Transfection?)</u></p>  
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Preparation of PBS Buffer</b></p>====
-
Investigators: ...
+
Investigator: Volker
 +
Two liters of PBS buffer were prepared for the column purification of the viral particles. The following protocol was used:
 +
*dissolve the following in 800ml ddH<sub>2</sub>O:
 +
**8g of NaCl
 +
**0.2g of KCl
 +
**1.44g of Na<sub>2</sub>HP0<sub>$</sub> (1.69 because of the crystal water in the reagent)
 +
**0.24 g of KH<sub>2</sub>PO<sub>4</sub>
 +
*adjust to pH 7.4
 +
*adjust to 1000ml
 +
*steril filtrate the solution
-
<p style="font-size:15px; font-weight: bold; color: blue;"><u>beta-globin intron</u></p>
+
===111. labday 05.09.2010===
-
Investigators: Adrian, Bea
+
-
<br>
+
-
We found some interesting literature which point out that introns have an influence on the eucaryotic gene expression on DNA and RNA level. Next steps are going to be the designing of the beta-globin intron and maybe further analysis of the other mentioned introns. Maybe two or three more introns can be ordered.
+
-
<br>
+
-
[[Media:Freiburg10_LeHir_et_al_How_introns_influence_and_enhance_eukaryotic_gene_expression_2003.pdf]]
+
-
<br>
+
-
[[Media:Freiburg10_Noe_et_al_An_intron_is_required_dro_dihydrofolate_reductase_protein_stability_2008.pdf]]
+
-
<br>
+
-
[[Media:Freiburg10_Mashadrizeh_et_al_A_systematic_study_of_the_function_of_the_human_beta-globin_introns_on_the_expression_of_the_human_coagulation_factor_in_cultured_Chinese_hamster_ovary_cells_2009.pdf‎]]
+
-
<br>
+
-
* [[Media:Chicken_beta-globin_insulator_overcomes_variegation_of_transgenes_in_Xenopus_embryos.pdf‎]]
+
-
<br>
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>hGH sequence</u></p>
+
-
Hanna 
+
-
* orientation in pAAV_MCS is reverse annotated... but in the same orientation as in human growth hormone I gene!
+
-
* Blast and alignment with other expression vectors and the human growth hormone I revealed that Stratagene annotated 1 bp too much
+
-
* "A common feature of mRNA in higher eukaryotes (but not in yeast) is the presence of the highly conserved sequence AAUAAA in the region from 11-30 nucleotides upstream of the site of poly(A) addition. (...) The signal is needed for both cleavage and polyadenylation." (Genes VIII, Lewin, P. 720)
+
-
* good news: There're no iGEM restriction sites in the sequence (RFC25)
+
-
* Conclusion: Instead of ordering the whole sequenc in iGEM standard it would be probably easier (and cheaper) to perform a PCR.
+
-
* '''Done''': Oligos were designed for PCR!
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>ITRs: new strategy</u></p>
+
====<p style="font-size:15px; background-color:#66bbff;"><b>Mini-prep of glycerol stock pMA_RepCap Vector_SDM_InsPvuII clone 1 (B182)</b></p>====
-
Hanna <br>
+
<b>Investigator: Stefan<br /></b>
-
Plan:
+
<br />
-
* Digest pAAV_MCS with AlwNI. Result: one large fragment containing the left ITR + a small fragment containing right ITR.
+
Glycerol stock: Because glycerol stock B182 was not mixed before putting into -80 °C freezer the cells died. Therefore a new glycerol stock was prepared and labled B302.  
-
* Digest both fragments with NotI and PstI.
+
-
* Hybridize oligos containing RFC10 restriction sites (designed by Hanna), ligate them via intermediate steps (ligating into a vector) with ITRs . Comment: One oligo posseses a blunt end - therefore "intermediate step-vector" needs to be digested with an enzyme producing a blunt site.
+
-
*''' Done:''' Oligos were designed. Need to be checked!
+
-
<br>
+
-
<p style="font-size:15px; font-weight: bold; color: fuchsia;"><u>Sequencing of pAAV_iGEM-mVenus-YFP</u></p>
+
Mini-Prep was performed according to the standard protocol. Two preps were prepared:
-
Hanna, Chris W. <br>
+
<br />
-
* 3 µL of O28, 29 and 30 each were mixed with 27 µL water -> primer fpr sequencing of GOI and of hGH sequence
+
<li>P363 = pMA_RepCap Vector_SDM_InsPvuII clone 1 (1) = 215,6 ng/µl
-
* 11.1 µL plasmid + 18.9 µL H<sub>2</sub>O
+
<li>P364 = pMA_RepCap Vector_SDM_InsPvuII clone 1 (2) = 230,5 ng/µl
-
<br>
+
<br />
-
<p style="font-size:15px; font-weight: bold; color: #014421;"><u>Investigation of the Kleinschmidt sequencing</u></p>
+
====<p style="font-size:15px; background-color:#ff00ff;"><b>Picking clones of pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker</b></p>====
-
Investigator: Volker
+
<b>Investigator: Hanna<br /></b>
-
[[File:Freiburg_VP3ex sequencing.png|800px|thumb|right|The CMV promoter sequence was found in front of the expression constructs of VP2 and VP3]]
+
<br/>
-
 
+
2 clones of each construct (1. pCerulean_Zegfr:1907_ShortLinker, 2. pCerulean_Zegfr:1907_MiddleLinker, 3. pCerulean_Zegfr:1907_LongLinker, 4. pCerulean_Zegfr:1907_SEG and 5. pCerulean_CFP_MiddleLinker) were picked.
-
The sequencing of den unknown backbone pKEX revealed that the construct VP1ex from the DKFZ seemed not to contain a regulatory region for the expresion of the VP1 ORF, but in the backbonesequence there were some standard primers from GATC that could be used to sequence the insert of all expression constructs.<br><br>
+
<br/>
-
This sequencing was done at the 26.06.2010. The read into the construct VP1 showed a long homologous region with the ORF of VP1 where as the sequencing of VP2ex and VP3ex did not show a homologous region with the ORFs of VP2 and VP3. <br><br>
+
<br/>
-
The test weather primers of GATC bind to the unknown region gave a positive hit in both constructs with the primer GATC_std_CMV_f. This primer is specific for the sequence of the CMV promoter. After this indice the sequences VM_2 26.06. -pBR1.ab1 and VM_3 26.06. -pBR1.ab1 were aligned with the sequence of the CMV  promoter provieded in the stratagene kit in the plasmid pAAV-MCS. The majority of the sequence fitted well with CMV promoter as indicated in the image in purple. At the 5' end of the CMV promoter there were some missmatches in the alignment indicated in yellow.<br><br>
+
<b>To do tomorrow (6.9.):</b> Mini-Preps and Test digestion (with EcoRI and PstI).
-
The fact that VP2ex and VP3ex contained a CMV promoter element which was not included in VP1ex was unexpected. The sequencing with the standard primer GATC_std_CMV_f which binds at the 3' end of the CMV promoter and will probably sequence the ORF of VP2ex and VP3ex was ordered.<br><br>
+
===112. labday 06.09.2010===
 +
====<p style="font-size:15px; background-color:#66bbff;"><b>Production of Ampicilin and Chloramphenicol</b></p>====
 +
<b>Investigator: Jessica<br /></b>
 +
<br />
 +
* 10ml ethanol (70%) containing 1g Amp in 60µl aliquots
 +
* 10ml ethanol (70%) containing 0,25g Cm in 60 µl aliquots
<html>
<html>
</div>
</div>
</html>
</html>

Revision as of 11:32, 6 September 2010

Contents

September

107. labday 01.09.2010

Loop insertion BioBricks: Sequencing results

Investigator: Achim, Anna

Comment: Sequencing results of Loop insertion BioBricks from 31.08.10; the following clones were sent for sequencing:


  • 2: 453 BAP: No Insert

Freiburg10 453 bap.JPG

  • 3:453 His: Insert okay

Freiburg10 453 his.JPG

  • 5: 453 RGD: Mutation in 453 upstream region

Freiburg10 453 rgd.JPG

  • 7: 587 BAP: Mutation in Bap insert

Freiburg10 587 bap.JPG

  • 9:587 His: Insert okay

Freiburg10 587 his.JPG

  • 11:587 KO BAP : Insert okay

Freiburg10 587 KO bap.JPG

  • 13:587 KO empty : Insert okay

Freiburg10 587 KO empty.JPG

  • 16: 587 KO his: Mutation in 587 KO

Freiburg10 587 ko his.JPG

  • 17: 587 KO rgd: No insert

Freiburg10 587 KO rgd.JPG

  • 19 :587 RGD: Insert okay

Freiburg10 587 rgd.JPG

  • 25: 587 Z34C: Mutation in downstream 587 region

Freiburg10 587 z34c.JPG

Mini-Preps:

New Mini-Preps of the samples with no/mutated insert were prepared. The following clones were used:

Components 453 BAP 587 BAP 453 RGD 587 KO RGD 587 KO HIS 453 Z34C 587 Z34C 587 KO Z34C 587 KO Z34C SPACER
Clone1.3 + 1.4 2.3 + 2.4 4.3 + 4.4 6.3 + 6.4 9.3 + 9.4 11.3 + 11.412.2 + 12.4 13.2 + 13.4 14.3 + 14.4


Comment: Samples 1.3, 2.3, 4.3, 6.3, 9.3, 11.3, 12.2, 13.2, 14.3 were sent for sequencing. For sequencing results go to labday 02.09.10.

.

Design of primers for pAAV_RC

Investigator: Bea

Primers for different cloning strategies of the synthesized cap gene into pAAV_Rc have been designed.

  1. The first primers are mutagenesis primers which delete the KpnI recognition site at position 3968. These primers can (or should be used) be used if cloning with BspMI/BfuI (isochizomer) does not cut the pAAV_RC efficiently. Instead of using this enzyme we can use XcmI to subclone the cap gene with performing a site-directed mutagenesis afterwards with designed primers.
  2. The second idea is to design oligoduplexes (hybridized oligos) which contain the recognition site for BspMI. In Gormley et al (2002) the idea was to add oligodupexes with the recognition site for BspMI and therefore provide the "second recognition site" in trans.

Next step: Check primers and order them today! Designed primers are stored in my Workingfolder under paav_rc and a word document was created whcih can be found under Oligos --> primers for different strategies...

Sequencing results of pSB1C3_Zegfr:1907_Linker

Investigator: Hanna

Comment: Sequencing results looked all well. One bp was missing in the theoretical sequence of SEG suffix - but is correct in the actual sequence.


pSB1Cr_Zegfr:1907_LongLinker:
PSB1C3 Zegfr1907 LongLinker.JPG

pSB1Cr_Zegfr:1907_SEG:
PSB1C3 Zegfr1907 SEG.JPG

pSB1Cr_Zegfr:1907_MiddleLinker:
PSB1C3 Zegfr1907 MiddleLinker.JPG

pSB1Cr_Zegfr:1907_ShortLinker:
PSB1C3 Zegfr1907 ShortLinker.JPG

These constructs will be cloned into pCerulean for N-terminal fusion to VP2.
go to the top ;)

Trafo evalutaion and Inoculation

Investigator: Kira
The plate with transformed CD-biobrick contains around 40 colonies. 4 of them will be inoculated into LB and incubated @37 C over-night.
go to the top ;)

Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273)

Investigator: Patrick


The two Ligations were performed according to the standard protocol:
1 µl T4 DNA ligase, 1 µl 10x Buffer, 4,6 µl vector (P273), 3,34 µl Insert (P276, upper and lower band).
Incubation time: 50 minutes.

During the transformation i forgot to put the cells into the 37°C shaker so i incubated them afterwards again for 45 minutes at 37 °C on a shaker.

The mutual conles will be picked tomorrow to inoculate 10 ml DYT following a mini-prep on 03.09.2010

Transfection, Seeding AAV293 and HT1080

Investigator: Kerstin

  • Transfection: 10 plates, same treatment (10µg of RC (P357), pHelper (P356)and mVenus (P263), following the standard protocol)
  • Seeding HT1080 for transduction with virus from 21.08.2010 (10µg of RC, pHelper, TKGMK; pH=7,10)
  • Seeding AAV293 for transfection with plasmids without HgH or beta-globin (verifying functionality)

Cloning of ZEGFR:1907_Middle-Linker,ZEGFR:1907_Short-Linker, ZEGFR:1907_SEG-Linker and ZEGFR:1907_Long-Linker into pCerulean

Investigator: Stefan

Comment:


Digestion:

components Vector (P273) ZEGFR:1907_Middle-Linker (P290) ZEGFR:1907_Short-Linker (P292) ZEGFR:1907_SEG-Linker (P296) ZEGFR:1907_Long-Linker (P298)
DNA 3,8 8,8 10,2 9,2 8,7
BSA (10x) 2 2 2 2 2
Buffer 4 (10x)2 2 2 2 2
XbaI 1 1111
PstI 11111
H2O10,2 5,2 3,8 4,8 5,3
Total volume 20 20 20 20 20


0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED , at 115 Volt, running time: 50 minutes



Freiburg10 pCerulean affi linker.jpg




Gelextraction:

The gelextraction was performed according to the standard protocol. DNA concentration of the extracts:

  • P273: c= 3,1 ng/µl
  • P290: c= 3,2 ng/µl
  • P292: c= 1,8 ng/µl
  • P296: c= 3,0 ng/µl
  • P298: c= 3,2 ng/µl


T4 Ligation:

The Ligation was performed as following:

Comment: No sufficent vector concentration, therefore 5 µl of vector was used for every approach.

  • Vector Volume: 5 µl
  • Insert Volume: 3 µl


  • 1µl T4-Ligase buffer (10x)
  • 8µl (Vector + Insert) mix
  • 1µl T4-Ligase


Incubating for 40 minutes.


Transformation:

Trafo was performed according to the standard protocol (BL21). The cells were plated on a agar plate with chloramphenicol


108. labday 02.09.2010

Sequencing of loop insertions BioBricks: 2nd round

Investigator: Achim, Anna

We analyzed the new sequencing results and found two correct sequences:

  • 587 BAP clone 2.3
  • 453 RGD clone 4.3

The other samples didn't contain any inserts or had wrong insertions. Apparently, the vector tends to religate easily. A possible reason for the religation of the incompatible ends is the overnight ligation at 18°C. We sent preps of the remaining 7 ligations for sequencing and will prep new clones or repeat the ligation tomorrow, depending on the new sequences.

Comment: Clones 1.4, 6.4, 9.4, 11.4, 12.4, 13.4, 14.4 were sent for sequencing. For sequencing results go to labday 03.09.10.

.

Mini-preps of pSB1C3_SV40 and pCerulean_VP1_NLS

Investigator: Bea (Chris L)

Mini-Prep was performed according to the standard protocol

  • P363 = pSB1C3_SV40 clone 1 = 277,70 ng/µl
  • P364 = pSB1C3_SV40 clone 2 = 265,01 ng/µl
  • P365 = pCerulean_VP1up_NLS (1) clone 1 = 473,14 ng/µl
  • P366 = pCerulean_VP1up_NLS (1) clone 2 = 455,88 ng/µl
  • P367 = pCerulean_VP1up_NLS (1) clone 3 = 482,86 ng/µl
  • P368 = pCerulean_VP1up_NLS (2) clone 1 = 438,52 ng/µl
  • P369 = pCerulean_VP1up_NLS (2) clone 2 = 478,00 ng/µl
  • P370 = pCerulean_VP1up_NLS (2) clone 3 = 419,00 ng/µl
    Construct were digested with XbaI and PstI for 45 minutes at 37°C. The loading plan on the 1% agarose gel looks like this:

    _M_ ___ _363_ ___ _364_ _365_ _366_ _367_ _368_ _369_ _370_ ___

    Results: P365 was sent for sequencing because test digestion looks goos. In contrast to the SV40 appraoch. This needs to be repeated tomorrow.
    • Plasmid: pCerulean_VP1up_NLS
    • Plasmid number: P365
    • Tube name: SB1
    • Primer used: CMV-F

    Mini-Prep and test digestion of pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker

    Investigator: Hanna

    Comment: Zegfr:1907 (Affibody) and the His-Tag which was coupled to the middle linker were cloned into pCerulean. 3 clones of each construct were picked yesterday.


    Plasmid Mini-Prep

    • new vector name: pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker


    Glycerol Stocks
    1. pCerulean_Zegfr:1907

    Clone 1 Clone 2 Clone 3
    Bacteria strain XL1b XL1b XL1b
    Plasmidname pCerulean_Zegfr:1907 pCerulean_Zegfr:1907 pCerulean_Zegfr:1907
    Date 2.9.10 2.9.10 2.9.10
    given glycerol-stock no. B275 B276 B277
    given plasmid no. P371 P372 P373


    2. pCerulean_6xHis_MiddleLinker

    Clone 1 Clone 2 Clone 3
    Bacteria strain XL1b XL1b XL1b
    Plasmidname pCerulean_6xHis_MiddleLinker pCerulean_6xHis_MiddleLinker pCerulean_6xHis_MiddleLinker
    Date 2.9.10 2.9.10 2.9.10
    given glycerol-stock no. B278 B279 B280
    given plasmid no. P374 P375 P376


    Test digestion

    • buffer used: 4; Restriction-enzymes used: Enzyme 1 PstI-HF ; Enzyme 2 EcoRI-HF
    • Plasmid
      • Given Plasmid-Number: 371; DNA concentration: 381.3 ng/µL;
      • Given Plasmid-Number: 372; DNA concentration: 377.5 ng/µL;
      • Given Plasmid-Number: 373; DNA concentration: 409.7 ng/µL;
      • Given Plasmid-Number: 374; DNA concentration: 404.2 ng/µL;
      • Given Plasmid-Number: 375; DNA concentration: 366.1 ng/µL;
      • Given Plasmid-Number: 376; DNA concentration: 375.0 ng/µL;


    Comments::)

    Pipetting scheme for each test digestion:

    Components Volume/µL
    DNA 2.7
    BSA (10x) 1
    Buffer no. 4 (10x) 1
    EcoRI-HF 0.5
    PstI-HF 0.5
    H2O 4.3
    Total volume 10


    • Incubation: 55 minutes


    Agarose-Gel:


    0.875 g Agarose, 50 mL TAE (1.75 %), 3 µL EthBr, at 115 Volt, running time: 35 minutes

    Sample Sample/µl] Loading dye (6x)/µl Expected size
    pCerulean_Zegfr:1907 clone 1 10 µl 2 µl 231 bp
    pCerulean_Zegfr:1907 clone 2 10 µl 2 µl 231 bp
    pCerulean_Zegfr:1907 clone 3 10 µl 2 µl 231 bp
    pCerulean_6xHis_MiddleLinker clone 1 10 µl 2 µl 105 bp
    pCerulean_6xHis_MiddleLinker clone 2 10 µl 2 µl 105 bp
    pCerulean_6xHis_MiddleLinker clone 3 10 µl 2 µl 105 bp


    • Marker: GeneRuler ladder mix
    Marker /µL Sample P371 /µl Sample P372 /µl Sample P373 /µl Sample P374 /µl Sample P375 /µl Sample P376 /µl
    Lane 5 12 12 12 12 12 12


    Comments: Test digestion looked well:

    Freiburg10 pCerulean Zegfr1907andpCerulean 6xHis ML.png
    Clone 1 of each construct were sent for sequencing (P371 and P374 = HW1 and HW2). Used primer: GATC_std_CMV-F.

    Midi-Prep of pSB1C3_lITR_CMV_mVenus_hGH_rITR clone1 & pSB1C3_lITR_CMV_beta-globin_mVenus_rITR clone1

    Investigators: Chris W.

    Midi-Preps of pSB1C3_lITR_CMV_mVenus_hGH_rITR clone1=P377 and pSB1C3_lITR_CMV_beta-globin_mVenus_rITR clone1=P378

    The Midi-Preps were performed according to the standard protocol yielding the following concentrations:

    plasmid-no. P377P378
    concentration (ng/µl)325,04 561,15


    Mini-Prep and test digestion of the CD biobricks

    Investigator: Kira

    Mistake.png
    Ohne Worte *lach*

    Wh did you digest with eco and ndeI?? is there a spechía reasonn for it?? if the coonstruct was in the rfc standard could digest it with the igem standard enzymes??

    components sample /µl
    DNA 2,5
    BSA (100x) 0
    Buffer ___4_ (10x) 1,5
    Enzyme NdeI (no.Lab:___) 0,5
    Enzyme EcoRI (no.Lab:___)0,5
    H2O10
    Total volume (e.g. 15,20,25,30 µl) |15
  • Incubation: 1 h

    Freiburg10 test digestion of CD.jpg

    Sample 1 was sent for sequencing

    109. labday 03.09.2010

    Miniprep and test digestion of pSB1C3_lITR_pTERT_ßglobin_mVenus_hGH_rITR

    Investigator: Achim

    Comment: The test digestion did not show the expected fragments of 2000 and 2500 bp. the photo was exposed too long to see distinct bands. Digestion will be repeated.

    AA1.png

    Sequencing results

    Investigator: Hanna

    Comment: pCerulean_Zegfr:1907 and pCerulean_6xHis_MiddleLinker were cloned and sent for sequencing yesterday.

    1. pCerulean_Zegfr:1907: Sequencing looked well.
    Freiburg10 pCerulean Zegfr1907 seq.JPG

    2. pCerulean_6xHis_MiddleLinker: Sequencing looked also well. Freiburg10 pCeruelan 6xHis MiddleLinker seq.JPG

    Cloning of pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker

    Investigator: Hanna

    Comment: For N-terminal fusion to VP2, the Affibody - fused to different kinds of linkers - will be cloned into the expression plasmid pCerulean. For imaging CFP, which was fused to the middle linker, will be cloned into pCerulean.



    Practical Cloning:

    • plasmid:
      • Vector: name: pCerulean number: P273
      • Insert: name: pSB1C3_Zegfr:1907_LongLinker (P298), pSB1C3_Zegfr:1907_MiddleLinker (P290), pSB1C3_Zegfr:1907_SEG (P296), pSB1C3_Zegfr:1907_ShortLinker (P292), pSB1C3_CFP_MiddleLinker (P276)
    • new vector name: pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker
    • buffer used: 4 ; Restriction-enzymes used: Enzyme 1 EcoRI-HF ; Enzyme 2 PstI-HF
    • DNA concentration (vector): 419.5 ng/µL ; DNA concentration (insert): P298 229.7 ng/µL, P290 227.4 ng/µl; P296 218.7 ng/µL; P292 196.6 ng/µL; P276 207.7 ng/µL


    Comments: No.

    Digestion

    components volume of pCerulean /µl volume of Zegfr:1907_MiddleLinker /µl volume of CFP_MiddleLinker /µL
    DNA 8.3 7.6 4.8
    BSA (10x) - - -
    Buffer 4 (10x) 2 2 2
    Enzyme 1 EcoRI-HF 1 1 1
    Enzyme 2 PstI-HF 1 1 1
    H2O 7.7 8.4 11.2
    Total volume 20 20 20
    • Incubation: 1.5 h



    Agarose-Gel:


    0.8 g Agarose, 50 TAE (1.5 %), 5 µL EthBr, at 70 Volt, running time: ~ 1 hour

    Sample Sample/µl] Loading dye (6x)/µl Expected size 1
    P273 20 µl 4 µl 3922 bp
    P298 20 µl 4 µl 273 bp
    P290 20 µl 4 µl 261 bp
    P296 20 µl 4 µl 345 bp
    P292 20 µl 4 µl 249 bp
    P276 20 µl 4 µl 801 bp


    • Marker: GeneRuler ladder mix
    Marker Sample P273 /µl Sample P276 /µl Sample P290 /µl Sample P292 /µl Sample P296 /µl Sample P298 /µl
    Lane 5 24 24 24 24 24 24



    Gel extraction


    Gel measurement:

    Sample Volume Concentration
    P273 20 115.45 ng/µL
    P276 20 9.91 ng/µL
    P298 20 5.07 ng/µL
    P296 20 9.03 ng/µL
    P290 20 10.31 ng/µL
    P292 20 20.78 ng/µL




    Ligation


    1. PCerulean_Zegfr:1907_LongLinker

    P298 P273
    Volume/µl 6.61 1.39


    2. PCerulean_Zegfr:1907_MiddleLinker

    P290 P273
    Volume/µl 5.53 2.47


    3. PCerulean_Zegfr:1907_SEG

    P296 P273
    Volume/µl 6.17 1.83


    4. PCerulean_Zegfr:1907_ShortLinker

    P292 P273
    Volume/µl 4.11 3.89


    5. PCerulean_CFP_MiddleLinker

    P276 P273
    Volume/µl 7.02 0.98


    Trafo


    Trafo was performed following the standard protocol. Used cells: XL1b, DNA amount: 2.5 µL of each ligation reaction. Plates were stored @ 37°C room over night.

    Harvest viral particles, Seeding HT1080 cells

    Investigator: Adrian, Kerstin

    • Harvest viral particles of Transfection from 31.08.2010 (six approaches: 10µg of RC (2x P326 and 2x P325 and 2x Stratagene), pHelper and GOI (P262))
    • Seeding HT1080 cells

    Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273)

    Investigator: Patrick


    The Miniprep was performed according to the standard protocol. Labelling:

    • P381: pCerulean_middlelinker clone 1 upper band : 526,0 ng/µl
    • P382: pCerulean_middlelinker clone 2 upper band : 522,0 ng/µl
    • P383: pCerulean_middlelinker clone 3 upper band : 463,0 ng/µl
    • P384: pCerulean_middlelinker clone 1 lower band : 465,0 ng/µl
    • P385: pCerulean_middlelinker clone 2 lower band : 500,0 ng/µl
    • P386: pCerulean_middlelinker clone 3 lower band : 524,0 ng/µl
    Öhm Patrick: Hier ist der Grund, warum das Experiment "wiederholt" wurde: Falsche Beschrieftung hier, als auch in der Excel Tabelle ;) "Finde den Fehler!" :P


    see also http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/index.php/August_2010#Cloning_CFP_middlelinker_.28from_pSB1C3_CFP_middlelinker.2C_P276.29_into_pCerulean_.28P273.29

    ;-) bitte ausfüllen

    Testdigestion: 7 µl DNA sample, 1 µl Buffer 4 (10x), 1 µl BSA, 0,5 µl Xba, 0,5 µl PstI-HF
    Expected size of the fragments: 786 & 2053bp
    There seems to be something wrong.

    Freiburg10 pat20100903.jpg

    Sent for sequencing: P381 & P385 Labelling: P381-CMV_rev & P385-CMV_rev
    Used primer: O21 : CMV_reverse_qPCR

    Cloning of pSB1C3_leftITR_pTert and pSB1C3_mGMK with pSB1C3_leftITR_CMV

    Investigator: Chris L.

    • Vector: name: pSB1C3_leftITR_pTERT clone 1 P256 c=179,2 ng/µl
    • Vector: name: pSB1C3_leftITR_CMV P188 c=231,6 ng/µl
    • Insert: name: pSB1C3_mGMK P195 c=258,6 ng/µl
    • new vector name: pSB1C3_leftITR_CMV_GMK
    • new vector name: pSB1C3_leftITR_pTERT_GMK
    • buffer used: 4 ; Restriction-enzymes used: Enzyme 1 PstI ; Enzyme 2 SpeI ; Enzyme 3 XbaI


    components P195 P256 /µl P188 /µl
    DNA 7,7 11,2 8,6
    BSA (10x) 2 2 2
    Buffer 4 (10x)2 2 2
    Enzyme SpeI 1 1 0
    Enzyme XbaI 0 0 1
    Enzyme PstI 1 1 1
    H2O 6,3 2,8 5,4
    Total volume (e.g. 15,20,25,30 µl) 2020 20


    0,5 g Agarose,50 ml TAE (1%), 3 µl GELRED , at 130 Volt, running time:45

    Results:
    Freiburg10 pSB1C3 lITR pTERT and pSB1C3 lITR CMV with GMK Insert.jpg

    • c(Insert)= 15,37 ng/µl; size: 627 bp
    • c(Vector)= 50,84 ng/µl; size: 2869 bp
    • c(Vector)= 75,64 ng/µl; size: 2672 bp


    • Ligation of PCR products and vector:

    For the Ligation 1µl T4 buffer (10x) and 1µl T4 ligase were used. Incubation time: 45 min

    pSB1C3_leftITR_CMV + GMK /µl pSB1C3_leftITR_pTERT + GMK
    Vector 5,48 6,21
    Insert 2,52 1,79


    • Transformation:

    The transformation was done following the standard protocol using XL1 blue cells.

    Sequence analysis of pCerulean_VP1up

    Investigator: Bea

    The assembled pCerulean_VP1up which serves as the first construct in the VP1 insertion cloning assembly was sent for sequencing.

    • Plasmid used: P365
    • Primer used: CMV-F
    • Tube name: SB1
    • Folder (Geneious): N-terminal Targeting --> pCerulean_VP1up_NLS


    Freiburg 10 SeqAnalysis of pCerulean VP1up NLS 03.09.2010.jpg


    pCerulean_VP1up_NLS_Targeting molecule

    Investigator: Bea

    Comment: For preparing the next step in the VP1 insertion, different targeting molecules will be fused to the construct pCerulean_VP1up_NLS.

    1. The first construct is the Affibody ZEGF-R:1907 which was already cloned into the standard iGEM plasmid and can be sued for target tumor cells overexpressing the EGF receptor.
    2. The second construct is the mVenus (Yellow fluorescent protein) which can be used for imaging experiments
    3. Another motif will be the His-tag. Since the His-tag is very small, the oligos will be hybridized and directly ligated into the pCerulean backbone.


    Digestion of vector:

    • Plasmid used: pCerulean_VP1up_NLS (P365) c=470 ng/µL
    • Add BSA
    • AgeI-HF and SpeI-HF were used


    Protocol of the digestion of the vector:

    Components vpCerulean_VP1up_NLS/µL
    DNA 3
    BSA (100x) 2,5
    Buffer no. 4 (10x) 2,5
    Enzyme 1 AgeI 1
    Enzyme 2 SpeI HF 1
    H2O 15
    Total volume 25


    • Incubation of the sample at 37°C
    • Incubation for 120 minutes


    The Targeting molecules were digested with different enzmyes than the vector for providing the ability to assemble the different constructs together without creating new restriction site but to delete them. This works by fusing NgoMIv and AgeI together.

    Digestion of the targeting molecules

    • Plasmids used:
      1. pSB1C3_zEGF-R:1907 (P284) c=146 ng/µL
      2. pGA14_mVenus(P60) c=280 ng/µL
    • Add BSA
    • NgoMIV and SpeI-HF were used


    Components vZEGFR (P284)/µL vpGA_mVenus (P60)/µL
    DNA 13 µl 7 µl
    BSA (10x) 2,5 µl 2,5 µl
    Buffer no. 4 (10x) 2,5 µl 2,5 µl
    Enzyme 1 NgoMIV- 1,0 µl 1,0 µl
    Enzyme 2 AgeI HF 1,0 µl 1,0 µl
    H2O 15 µl 15 µl
    Total volume 25 25
    • Incubation of the sample at 37°C
    • Incubation for 90 minutes


    After incubation the samples were loaded on a 1% agarose gel. The obtained gel (after running the gel for 15 minutes) can be seen below.

    Freiburg10 pCerulean VP1up NLS TargetingMolecule.jpg


    Results: The boxes mark fragments which ere cut out of the gel. The left lane (pCerulean) looks a bit strange, because Marker was added after the digestion reaction instead of Loading dye.

    Parallel, for assembling the His-Tag to the construct pCerulean_VP1up_NLS, oligos for the His-Tag in the RFC25 standard (provided by Gerrit) were hybridized and can directly be ligated in the digested vector. This strategy was used because of the smal size of the His-Tag which cannot be separated easily by the agarose gel.


    Hybridization of the His-Oligos

    • 10µL oligo1 (1:10)
    • 10µL oligo2 (1:10)
    • 4µL 100mM Tris-Cl pH 8
    • 10µL 5mM MgCl2
    • 8µL H2O

    The used programm for the hybridization:

    • 99°C 7´
    • 99°C 1´
    • -1°C R=0,3°/s
    • Goto 2 rep 74
    • Hold 4°C


    After the gel extraction of a T4 ligation was performed.

      Affibody ZEGF-R:1907:

      vCerulean_VP1up_NLS = 5,82µL
      vZEGF-R:1907 = 2,18µL

      mVenus Z:

      vCerulean_VP1up_NLS = 4,04µL
      vmVenus = 3,96 µL

      6xHisTag:

      vCerulean_VP1up_NLS = 0,2µL
      v6xHisTag = 7,98µL


    Next steps: Picking clones of the trafo plates (containing Kanamycin) and perform the Mini-Prep. The obtaining constructs finally will be fused to the VP2/3 protein which results in the final construct for the VP1 targeting approach.

    3rd Repetition of Mini-Preps and test digestion for Loop insertion BioBricks

    Investigator: Achim, Anna

    Sequencing results of Loop insertion BioBricks from 02.09.10; the following clones looked well:

    • pSB1C3_587_KO_RGD_clone6.4
    • PSB1C3_587_KO_His_clone9.4


    Update: 9 of the 14 ViralBricks looked well (sequencing results from 01. - 03.09.). Two new clones of the remaining constructs were prepared and test digested.

    Test digestion:

    components Volume for each sample /µl
    DNA 10
    BSA (10x) 1,5
    Buffer 4 (10x) 1,5
    Enzyme EcoRI HF 0,5
    Enzyme NotI HF 0,5
    H2O 1
    Total volume /µl15


    Components 453 BAP 453 Z34C 587 Z34C 587 KO Z34C 587 KO Z34C SPACER
    Clone1.5 + 1.6 11.5 + 11.6 12.5 + 12.6 13.5 + 13.6 14.5 + 14.6


    Incubation time: 1 h, Incubation temperature: 37°

    Preparation of gel:
    1 g Agarose, 100 ml TAE (1%), 6 µl GELRED , at 115 Volt, running time: 45 minutes

    3.9.10 AA.png


    Expected fragment sizes /bp:
    pSB1C3: 2051 bp
    BAP: ~150
    Z34C: ~ 200

    Comment: The following clones were sent for sequencing: 1.6, 12.6 ,13.6 and 14.5.
    To do: Retrafo of clone6.4 and clone9.4 and preparation of glycerol stocks.

    Cloning of Cap into pAAV_RC_ins-rep: preparation for SDM

    Investigator: Stefan

    Comment: Cloning Cap into pAAV still does not work as planned. As another approach Cap can be cut using BsiWI and XcmI and performing a SDM in the part of Cap not cloned into pAAV. Primers are ordered and should arrive on monday to proceed.


    Digestion:

    components pMA_RepCap Vector_SDM_InsPvuII (P211) pAAV_RC_ins-rep (P250)
    DNA 7,9 2,1
    Buffer 2 (10x)2 2
    XcmI 1 1
    BsiWI 11
    H2O8,1 13,9
    Total volume 20 20


    Comment:Digestion was performed using two steps, first incubating for 1 hour at 37 °C, afterwards for 1,5 hours at 55 °C.



    Gel:

    0,5 g Agarose,50 ml TAE (1%), 5 µl EtBr , at 115 Volt, running time: 50 minutes



    Freiburg10 pCerulean pMA pAAV.png




    Gelextraction:

    The gelextraction was performed according to the standard protocol. DNA concentration of the extracts:

    • pMA_RepCap Vector_SDM_InsPvuII (P211): c= 6,26 ng/µl
    • pAAV_RC_ins-rep (P250): c= 13,72 ng/µl


    Quick Ligation:

    Comment: XcmI produces only 1 base overhang, therefore Quickligase was used for ligation and incubation time increased.

    The Ligation was performed as following:

    • Vector Volume: 4,59 µl
    • Insert Volume: 4,41 µl


    • 10 µl QuickLigase buffer (2x)
    • 9 µl (Vector + Insert) mix
    • 1 µl QuickLigase


    Incubating for 60 minutes.


    Transformation:

    Trafo was performed according to the standard protocol (XL1b). The cells were plated on a agar plate with ampicilin.

    110. labday 04.09.2010

    Continuation: Cloning CFP_middlelinker (from pSB1C3_CFP_middlelinker, P276) into pCerulean (P273): Sequencing results of P381 and P385

    Investigator:Patrick

    Sequencing results of P381 & P385 Labelling: P381-CMV_rev & P385-CMV_rev: A wrong primer was used so there are no relevant sequence data yet. On sunday i will sent these clones again for sequencing. Primer: GATC_std_CMV-F

    Ha ich war schneller als Bea beim "Kopfkratzen-setzen" *lol*

    Hiermit verspreche ich dass es noch jede Menge Kopfkratzer, Laboraufsichtswichtel und pinke Panter geben wird (Patrick)









    Harvest viral particles, Transduction

    Investigator:Kerstin, Adrian

    • Harvest viral paricles from one plate of transfection from 01.09.2010 (10 plates, same treatment (10µg of each plasmid P357, P263, P356))
    • Transduction:
    1. 1x 6-well: 0,5ml of virus from 01.09.2010 (testing R/C P326)
    2. 1x 6-well: 0,5ml of virus from 01.09.2010 (testing R/C P325)
    3. 4x 6-well: 10x 0,5ml and 4x 1ml of virus from 01.09.2010 (stratagene R/C)
    4. 4x 6-well: 10x 0,5ml and 4x 1ml of virus from 04.09.2010 (10 plates same treatment)
    5. 6x 6-well: 0,5ml of virus from 21.08.2010 (TKGMK; 18x pH 7,10 and 6x pH 7,12)

    Repetition of Hybridisation and Cloning for Loop insertion BioBricks

    Investigator: Achim, Anna

    • Samples:

    1: 453_BAP
    11: 453_Z34C
    12: 587_Z34C
    13: 587_KO_Z34C
    14: 587_KO_Z34C_Spacer


    Comment: New approaches of the Hybridisation and Fill-in reactions were done because it didn't work the first time. A possible reason is that the klenow enzyme wasn't inactivated. In addition, the conditions for ligation will be improved. Also the ligation of 453_BAP was done again.

    Digestion:

    components Volume Vector 587 Volume Vector 453 Sample 11 Sample 12 Sample 13 Sample 14
    DNA 3,7 3,7 6 6 6 6
    BSA (10x) - - - - - -
    Buffer 4 (10x) 2 2 2 2 2 2
    Enzyme 1° Bam Ssp Ssp Bam Bam Bam
    Enzyme 2° Pvu Sal Sal Pvu Pvu Pvu
    H2O 12,3 12,3 10 10 10 10
    Total volume /µl20


    ° 1 µl each

    Preparation of gel:
    1 g Agarose, 100 ml TAE (1%), 6 µl GELRED , at 115 Volt, running time: 50 minutes

    Repetition: Prepatation for SDM: cloning of Cap into pAAV

    Investigator: Stefan

    Schönen Abend dir noch

    Comment: On yesterday's plates nothing grew. Because gelex and ligation products were stored in coldroom, new ligation and trafo approaches were performed.



    Ligation approaches:

    • ligation with Quick Ligase (as performed yesterday)
    • ligation with T4 Ligase



    Transformation approaches:

    • Quick Ligase (approach from yesterday):
      • 2 µl of ligation product
      • 4 µl of ligation product


    • Quick Ligase (new approach):
      • 2 µl of ligation product
      • 4 µl of ligation product


    • T4 Ligase:
      • 2 µl of ligation product
      • 4 µl of ligation product


    Transformation:

    Trafo of each approach was performed according to the standard protocol (XL1b). The cells were plated on a agar plate with ampicilin.

    Ligation and trafo of the modified Cap insert , the Viral Bricks 1, 11, 12, 13 and 14

    Investigator: Volker


    Ligation


    Construct Vector (µl) Insert(µl)
    ViralBrick 1 in 453 7.91 0.09
    ViralBrick 11 in 453 6.17 1.83
    ViralBrick 12 in 587 6.15 1.85
    ViralBrick 13 in 587 5.3 2.7
    ViralBrick 14 in 587 4.46 3.54
    p211 in pAAV-RC 5.52 3.54
    p211 in pAAV-RC 5.52 3.54



    Preparation of PBS Buffer

    Investigator: Volker

    Two liters of PBS buffer were prepared for the column purification of the viral particles. The following protocol was used:

    • dissolve the following in 800ml ddH2O:
      • 8g of NaCl
      • 0.2g of KCl
      • 1.44g of Na2HP0$ (1.69 because of the crystal water in the reagent)
      • 0.24 g of KH2PO4
    • adjust to pH 7.4
    • adjust to 1000ml
    • steril filtrate the solution

    111. labday 05.09.2010

    Mini-prep of glycerol stock pMA_RepCap Vector_SDM_InsPvuII clone 1 (B182)

    Investigator: Stefan
    Glycerol stock: Because glycerol stock B182 was not mixed before putting into -80 °C freezer the cells died. Therefore a new glycerol stock was prepared and labled B302.

    Mini-Prep was performed according to the standard protocol. Two preps were prepared:

  • P363 = pMA_RepCap Vector_SDM_InsPvuII clone 1 (1) = 215,6 ng/µl
  • P364 = pMA_RepCap Vector_SDM_InsPvuII clone 1 (2) = 230,5 ng/µl

    Picking clones of pCerulean_Zegfr:1907_"Linker" and pCerulean_CFP_MiddleLinker

    Investigator: Hanna
    2 clones of each construct (1. pCerulean_Zegfr:1907_ShortLinker, 2. pCerulean_Zegfr:1907_MiddleLinker, 3. pCerulean_Zegfr:1907_LongLinker, 4. pCerulean_Zegfr:1907_SEG and 5. pCerulean_CFP_MiddleLinker) were picked.

    To do tomorrow (6.9.): Mini-Preps and Test digestion (with EcoRI and PstI).

    112. labday 06.09.2010

    Production of Ampicilin and Chloramphenicol

    Investigator: Jessica

    • 10ml ethanol (70%) containing 1g Amp in 60µl aliquots
    • 10ml ethanol (70%) containing 0,25g Cm in 60 µl aliquots

    • Retrieved from "http://2010.igem.org/Team:Freiburg_Bioware/testpage"