Team:ESBS-Strasbourg/Results/Biobricks

From 2010.igem.org

(Difference between revisions)
Line 643: Line 643:
<br>
<br>
<p><b>Conception:</b></p>
<p><b>Conception:</b></p>
-
The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 <a href="http://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009)</a>.<br>
+
The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 <a href="http://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a><br>
-
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.  
+
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.
 +
<br>
 +
<center>
 +
<img src="http://2010.igem.org/wiki/images/1/13/ESBS-Strasbourg-Gene.png" width="100px" height="42px" border="0">
 +
</center>
 +
<center>
 +
<i><font size="2">PIF3</font></i>
 +
</center>
 +
<br>
 +
The plasmid containing the PIF3-sequence was provided by <a href="http://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#kircher">the laboratory of Stephan Kircher</a>from the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.
 +
<br><br>
 +
<b>Forward primer (5’->3’): 51 bp</b>
 +
<br>
 +
<span>
 +
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b>ATGCCTCTGTTTGAGC</span></p>
 +
<br><br>
 +
<b>Reverse primer (5’->3’): 51 bp</b>
 +
<br>
 +
<span style="color: #1F497D">
 +
ctgcag</span><span color: #B8CCE4">cggccgc</span><span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>ATGATGATTCAACCATGGAAC</span></p>
 +
<br><br>
 +
In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).
 +
<br><br>
 +
<b>Primers for Pfu-mutagenese:</b>
 +
<br>
 +
<b>Forward primer (5’->3’) (24 bp)</b>
 +
<br>
 +
GCAAACTCT<span style="background: black">TC</span><span style="background: red">A</span><span style="background: black">AGA</span>GCTAGAGAG
 +
<br><br>
 +
<b>Reverse primer (5’->3’) (24 bp)</b>
 +
<br>
 +
CTCTCTAGC<span style="background: black">TCT</span><span style="background: red">T</span><span style="background: black">GA</span>AGAGTTTGC
-
 
-
 
-
...
 
<br>
<br>
</div>
</div>

Revision as of 19:30, 24 October 2010

{|

ESBS - Strasbourg



Biobricks

Parts Submitted to Registry


      

Part Number: Part Name: Plasmid/Resistance Status
BBa_K365000 Phytochrome Interacting Factor-3 (PIF3) pSB1C3 / Chloramphenicol Sequenced
BBa_K365001 Phytochrome Interacting Factor-6 (PIF6) pSB1C3 / Chloramphenicol Sequenced
BBa_K365002 Phytochrome B (aa 1-908) pSB1C3 / Chloramphenicol Sequenced
BBa_K365003 Phytochrome B (aa 1-642) pSB1C3 / Chloramphenicol Sequenced
BBa_K365004 ∆N-ClpX (aa 61-425) pSB1C3 / Chloramphenicol Sequenced
BBa_K365005 Linker (aa 20) pSB1C3 / Chloramphenicol Sequenced
BBa_K365006 LAA tag pSB1C3 / Chloramphenicol Sequenced
BBa_K365007 DAS tag pSB1C3 / Chloramphenicol Sequenced
BBa_K365008 Lambda tag pSB1C3 / Chloramphenicol Sequenced
BBa_K365009 GFP (super fold) pSB1C3 / Chloramphenicol Sequenced
BBa_K365010 PhyB642-(linker-∆NClpX)3 pSB1C3 / Chloramphenicol Sequenced
BBa_K365011 PhyB908-(linker-∆NClpX)3 pSB1C3 / Chloramphenicol Sequenced
BBa_K365012 Full-length ClpX pSB1C3 / Chloramphenicol Sequenced
BBa_K365013 ∆NClpX-linker-∆NClpX-linker-∆NClpX pSB1C3 / Chloramphenicol Sequenced
BBa_K365014 (linker-∆NClpX)3 pSB1C3 / Chloramphenicol Sequenced


Phytochrome Interacting Factor-3 (PIF3) - BBa_K365000


Background:

PIF3 is a downstream transcription factor in a well studied signalling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no-measurable binding affinity for the dark- or infrared-exposed Pr state.
In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX.

Conception:

The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 (Lim & Voigt, 2009.)
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.
PIF3

The plasmid containing the PIF3-sequence was provided by the laboratory of Stephan Kircherfrom the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.

Forward primer (5’->3’): 51 bp
GGATCCgaattcgcggccgcttctagatggccggcATGCCTCTGTTTGAGC



Reverse primer (5’->3’): 51 bp
ctgcagcggccgctactagtattaaccggtATGATGATTCAACCATGGAAC



In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).

Primers for Pfu-mutagenese:
Forward primer (5’->3’) (24 bp)
GCAAACTCTTCAAGAGCTAGAGAG

Reverse primer (5’->3’) (24 bp)
CTCTCTAGCTCTTGAAGAGTTTGC

Phytochrome Interacting Factor-6 (PIF6) - BBa_K365001


...

Phytochrome B (aa 1-908) - BBa_K365002


...

Phytochrome B (aa 1-642) - BBa_K365003


...

∆N-ClpX (aa 61-425) - BBa_K365004


...

Linker (aa 20) - BBa_K365005


...

LAA tag - BBa_K365006


...

DAS tag - BBa_K365007


...

Lambda tag - BBa_K365008


...

GFP (super fold) - BBa_K365009


...

PhyB642-(linker-∆NClpX)3 - BBa_K365010




...

PhyB908-(linker-∆NClpX)3 - BBa_K365011


...

Full-length ClpX - BBa_K365012


...

∆NClpX-linker-∆NClpX-linker-∆NClpX - BBa_K365013


...

(linker-∆NClpX)3 - BBa_K365014


...

16


...