Team:Baltimore US/Project

From 2010.igem.org

(Difference between revisions)
(Results)
m (Developing low-cost alternatives to existing enzymes: Taq polymerase Project Details)
 
(20 intermediate revisions not shown)
Line 1: Line 1:
-
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="80%" align="center"
+
[[Image:TitleBarBalti US.png | center]]
-
!align="center"|[[Team:Baltimore_US|Home]]
+
 
-
!align="center"|[[Team:Baltimore_US/Team|Team]]
+
{| style="background-color:#7998AD;" cellpadding="1" cellspacing="1" border="0" bordercolor="#fff" width="924px" align="center"
-
!align="center"|[http://igem.org/Team.cgi?year=2010&team_name=Baltimore_US Official Team Profile]
+
!align="center"|[[Team:Baltimore_US|<span style="color:white;">Home</span>]]
-
!align="center"|[[Team:Baltimore_US/Project|Project]]
+
!align="center"|[[Team:Baltimore_US/Team|<span style="color:white;">Team</span>]]
-
!align="center"|[[Team:Baltimore_US/Parts|Parts Submitted to the Registry]]
+
!align="center"|[http://igem.org/Team.cgi?year=2010&team_name=Baltimore_US <span style="color:white;">Official Team Profile</span>]
-
!align="center"|[[Team:Baltimore_US/Modeling|Modeling]]
+
!align="center"|[[Team:Baltimore_US/Project|<span style="color:white;">Project</span>]]
-
!align="center"|[[Team:Baltimore_US/Notebook|Notebook]]
+
!align="center"|[[Team:Baltimore_US/Parts|<span style="color:white;">Submitted Parts</span>]]
-
!align="center"|[[Team:Baltimore_US/MeetingTimes|Meeting/Lab Times This Week]]
+
!align="center"|[[Team:Baltimore_US/Modeling|<span style="color:white;">Modeling</span>]]
-
!align="center"|[[Team:Baltimore_US/Safety|Safety]]
+
!align="center"|[[Team:Baltimore_US/Notebook|<span style="color:white;">Notebook</span>]]
 +
!align="center"|[[Team:Baltimore_US/MeetingTimes|<span style="color:white;">Meeting/Lab Times</span>]]
 +
!align="center"|[[Team:Baltimore_US/Safety|<span style="color:white;">Safety</span>]]
|}
|}
-
 
+
{| style= "background-color:#FFFFF;" width="924px" align="center"
-
{|align="justify"
+
|
-
|'''Our local Maryland Synthetic Biology team came together to explore the techniques and hardware utilized. We've formed our iGEM team to inspire innovation with goal oriented time lines.'''
+
__NOTOC__
-
|[[Image:Baltimore_US_logo.png|200px|right|frame]]
+
-
|-
+
|
|
-
'''Possible Projects'''<br>
 
-
<br>
 
-
'''Project: DIY-Gem''' <br>
 
-
Creating the set of educational tools and learning resources to allow comprehension and accessibility to the core techniques associated with Synthetic Biology. We've discussed creating e.coli that can be added to the bb system that can actually produce the major enzymes used in these techniques so that beginner's can "grow their own", saving the $1 a ul that some of these can cost. We have the sequence for Pol1 (J)
 
-
for Taq Aquaticus, and can put it into e. coli, but it contains a Pst1 site dead in the center of it's sequence so we'd have to create a new sequence and test it's viability, prior to formatting it in the bb format. The Pfu polymerase from Pyroclase Fusarium is usually used with BB, as it has enhanced error protection mechanisms and can withstand higher temperature cycling. The patent on Pol1 has expired. Patents exist on Pst1, none on exist on EcoR1, Xbe and Spe, couldn't find patent or sequence information, need more research. Other implementation of the DIY-Bio structure involves the construction of inexpensive hardware that is utilized in the process of synthetic biology research, i.e. microgram scales, centrifuges, PCR thermocyclers, Gel Electrophoresis kits, Devices for volumetrics, histobots, DNA sequencers/synthesizers and enhanced microscopy equipment. Many of these hw pieces have already been hacked by various groups within the DIY-Bio communities, however our goal would be to create those pieces necessary for us to continue to experiment/collaborate past the end of the iGEM timeframe. <br>
 
-
<br>
 
-
'''Project: Children of Men''' <br>
 
-
Bio-remediation oriented project to sequester/breakdown excessive estrogen levels that are currently responsible for turning the bass populations in Maryland tributaries into intersex species. Apparently 100% of the Male Bass populations are currently intersex meaning that they are carrying eggs due to the high-levels of hormone disruptors such as Estrogen that are not being cleaned by Maryland's current water treatment facilities. Researchers at Washington State have posited using Ammonia based microbials in bio-reactor systems to help break down estrogen, and there are supposedly BB parts that can be used as Estrogen Receptors. Failure to act, could conceivably lead to a sterile future for mankind, aka "The Children of Men" scenario from the science fiction film of same name. <br>
+
<!--- The Mission, Experiments --->
-
Similar Bio-remediation scenarios were presented to deal with excess Nitrogen fixation, Pfisteria Sensors and petroleum digestion in response to the Gulf tragedy. <br>
+
-
<br>
+
-
'''Project: ANN'''<br>
+
-
Artificial neural networks offer powerful tools for pattern recognition, discriminant analysis and machine learning.  Originally developed as a model of human cognitive activity, artificial neural networks have been adopted by
+
== DIY-GEM: a path towards low cost high throughput gene synthesis. ==
-
statistical modelers for their capacity to partition high-dimensional parameter spaces and "learn" to classify inputs through teaching and reinforcement. The massively parallel nature of artificial neural networks have provided motivation to implement them in-vitro rather than in-silico. Indeed, steps toward in vitro implementation have been taken by a number of previous iGEM teams. We hope to improve upon these efforts.
+
Synthetic biology research requires more cost effective approaches toward reagents and hardware accessibility. We are developing low-cost alternatives to existing hardware and enzymes in an attempt to expand participation in biological research and development. Our project expands the accessibility of Taq Polymerase by engineering it in a form compatible with BioBrick assembly. This allows use of the over-expressed enzyme from a crude bacterial extract in a PCR reaction at a fraction of the cost of highly purified commercial enzyme. In addition, we have developed inexpensive and easily assembled lab equipment such as a gel electrophoresis apparatus and a PCR thermal cycler. Enabling researchers to synthesize their own enzymes and having access to inexpensive tools will allow for increased participation among the DIY-bio community, stretch increasingly scarce educational funds, and allow rapid scale up of large scale gene synthesis projects."
-
In particular, we wish to provide tools for the construction of a multi-layer feed forward net with back-propagation of errorOwing to the parallel nature of the net, implementation must consist of the development of a single computational unit along with the processes by which units can be rationally composedSuch a project will require the completion of several subtasks.
+
==Developing low-cost alternatives to existing enzymes: ''Taq'' polymerase Project Details==
 +
We wished to insert Taq Polymerase into a standard BioBrick vectorIf this part should prove useful to other teams as an element of a rational design, we must ensure that no sites for the standard BioBrick restriction enzymes exist within the part itself, otherwise the part would shear upon assembly.   
-
The first item is the acceptance of input by the user.  We intend to employ cellular signaling mechanisms for communicating with the input layer.  Between network layers, we intend to employ the addressible conjugation method developed by Berkeley 2006.After input has been received by a node in a given layer of the net, it must be weighted, summed, and fed through a non-linear threshold function.  Weighting may be accompolished by molecular AND gates which limit the expression of the input protein to levels which may be governed by the concentrations of "weighting proteins" within the cell.  Summing and thresholding may then be naturally accomplished by cellular metabolism.  Output may be given to the user through the expression of fluorescent
 
-
proteins.  Lastly, back-propagation of error may be accomplished by separate channels of addressing plasmids which up- or down-regulate rates of conjugation in the previous layer.
 
-
The above constitutes an ambitious program which may exceed the scope of the summer. We wish to focus our efforts upon techniques for parallel, asynchronous addressible conjugation, especially so as to permit input from multiple nodes in the previous layer and allow computation of multiple input instances through a single generation of cells.   
+
We examined the Taq [http://www.ncbi.nlm.nih.gov/nuccore/155128 sequence]and exported the SEQ into Plasma DNA. [http://research.med.helsinki.fi/plasmadna/ Plasma DNA] is free software from University of Helsinki which provides quick analysis of plasmid sequence information. In particular, we obtained a restriction map which identified potential EcoRI, Xbe1, Sbe1, or Pst1 sites within the coding sequenceHere we encountered our first difficulty.
-
|[[Image:Baltimore_US_team.png|200px]]
+
====Problem: a PstI restriction site within the coding sequence====
-
|-
+
At 1717nt, we discovered a restriction site for Pst1:
-
|
+
  ...CTGCAG...  PstI restriction site<br>
-
|align="center"|[[Team:Baltimore_US | Team Example]]
+
  ...GACGTC...  Complement<br>
-
|}
+
-
<!--- The Mission, Experiments --->
+
We attempted to eliminate the restriction site by employing a site-specific mutagenesis by overlap extension protocol (see [http://www.cshlpress.com/default.tpl?cart=1279686078181232350&fromlink=T&linkaction=full&linksortby=oop_title&--eqSKUdatarq=21 Sambrook, Joseph; Russell, David W. ; Molecular Cloning: A Laboratory Manual, 3rd Edition]).
 +
<br><br>
 +
We then used the Gene Designer 2.0 from [https://www.dna20.com/genedesigner2/ DNA2.0] to analyze the open reading frames and examine the codons within the PstI restriction site. We find that the first three code for leucine with CTG; we can substitute the final base pair to yield CTT without sacrificing functional integrity in the manufactured enzyme.<br>
-
== '''DIY-GEM: a path towards low cost high throughput gene synthesis.''' ==
+
====Primer Design====
-
<br>
+
We designed a primer pair in order to induce point-mutagenesis at the Pst1 restriction site, flanking the base pair to be altered by 14 nt:
-
Synthetic biology research requires more cost effective approaches toward reagents and hardware accessibility.  We are developing low-cost alternatives to existing hardware and enzymes in an attempt to expand participation in biological research and development.
+
-
Our project expands the accessibility of Taq Polymerase by engineering it in a form compatible with BioBrick assembly.  This allows use of the over-expressed enzyme from a crude bacterial extract in a PCR reaction at a fraction of the cost of highly purified commercial enzyme.  In addition, we have developed inexpensive and easily assembled lab equipment such as a gel electrophoresis apparatus and a PCR thermal cycler.
+
GTGGAGAAGATCCT(T)CAGTACCGGCGG<br>
 +
CACCTCTTCTAGGA(A)GTCATGGCCGCC<br>
-
Enabling researchers to synthesize their own enzymes and having access to inexpensive tools will allow for increased participation among the DIY-bio community, stretch increasingly scarce educational funds, and allow rapid scale up of large scale gene synthesis projects."
+
While we designed the point-mutagenesis primers, we took the opportunity to design and order the primers for the BioBrick Suffix and Prefix. We followed the examples laid out in the Registry of Standard Parts for designing the oligos needed to make a part.
-
<br>
+
Important considerations are melting point and CG concentration, as well as self-dimerizations and hairpins. We analyzed these primers using the [http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ OligoAnalyzer] from [http://www.idtdna.com/Home/Home.aspx IDT]. When analyzing PolI, only the coding seuence itself was used for sequence inquiry, not the BioBrick Suffix/Prefixes.<br>
-
'''== PoliColi Project Details=='''<br>
+
-
 
+
-
Thermus Aquaticus Polymerase I<br>
+
-
PolI<br>
+
-
J04639.1<br>
+
-
Gene Sequence via BLAST at NCBI - http://www.ncbi.nlm.nih.gov/nuccore/155128<br>
+
-
<br>
+
-
    1 AAGCTCAGAT CTACCTGCCT GAGGGCGTCC GGTTCCAGCT GGCCCTTCCC<br>
+
-
    51 GAGGGGGAGA GGGAGGCGTT TCTAAAAGCC CTTCAGGACG CTACCCGGGG<br>
+
-
  101 GCGGGTGGTG GAAGGGTAAC ATGAGGGGGA TGCTGCCCCT CTTTGAGCCC<br>
+
-
  151 AAGGGCCGGG TCCTCCTGGT GGACGGCCAC CACCTGGCCT ACCGCACCTT<br>
+
-
  201 CCACGCCCTG AAGGGCCTCA CCACCAGCCG GGGGGAGCCG GTGCAGGCGG<br>
+
-
  251 TCTACGGCTT CGCCAAGAGC CTCCTCAAGG CCCTCAAGGA GGACGGGGAC<br>
+
-
  301 GCGGTGATCG TGGTCTTTGA CGCCAAGGCC CCCTCCTTCC GCCACGAGGC<br>
+
-
  351 CTACGGGGGG TACAAGGCGG GCCGGGCCCC CACGCCGGAG GACTTTCCCC<br>
+
-
  401 GGCAACTCGC CCTCATCAAG GAGCTGGTGG ACCTCCTGGG GCTGGCGCGC<br>
+
-
  451 CTCGAGGTCC CGGGCTACGA GGCGGACGAC GTCCTGGCCA GCCTGGCCAA<br>
+
-
  501 GAAGGCGGAA AAGGAGGGCT ACGAGGTCCG CATCCTCACC GCCGACAAAG<br>
+
-
  551 ACCTTTACCA GCTCCTTTCC GACCGCATCC ACGTCCTCCA CCCCGAGGGG<br>
+
-
  601 TACCTCATCA CCCCGGCCTG GCTTTGGGAA AAGTACGGCC TGAGGCCCGA<br>
+
-
  651 CCAGTGGGCC GACTACCGGG CCCTGACCGG GGACGAGTCC GACAACCTTC<br>
+
-
  701 CCGGGGTCAA GGGCATCGGG GAGAAGACGG CGAGGAAGCT TCTGGAGGAG<br>
+
-
  751 TGGGGGAGCC TGGAAGCCCT CCTCAAGAAC CTGGACCGGC TGAAGCCCGC<br>
+
-
  801 CATCCGGGAG AAGATCCTGG CCCACATGGA CGATCTGAAG CTCTCCTGGG<br>
+
-
  851 ACCTGGCCAA GGTGCGCACC GACCTGCCCC TGGAGGTGGA CTTCGCCAAA<br>
+
-
  901 AGGCGGGAGC CCGACCGGGA GAGGCTTAGG GCCTTTCTGG AGAGGCTTGA<br>
+
-
  951 GTTTGGCAGC CTCCTCCACG AGTTCGGCCT TCTGGAAAGC CCCAAGGCCC<br>
+
-
  1001 TGGAGGAGGC CCCCTGGCCC CCGCCGGAAG GGGCCTTCGT GGGCTTTGTG<br>
+
-
  1051 CTTTCCCGCA AGGAGCCCAT GTGGGCCGAT CTTCTGGCCC TGGCCGCCGC<br>
+
-
  1101 CAGGGGGGGC CGGGTCCACC GGGCCCCCGA GCCTTATAAA GCCCTCAGGG<br>
+
-
  1151 ACCTGAAGGA GGCGCGGGGG CTTCTCGCCA AAGACCTGAG CGTTCTGGCC<br>
+
-
  1201 CTGAGGGAAG GCCTTGGCCT CCCGCCCGGC GACGACCCCA TGCTCCTCGC<br>
+
-
  1251 CTACCTCCTG GACCCTTCCA ACACCACCCC CGAGGGGGTG GCCCGGCGCT<br>
+
-
  1301 ACGGCGGGGA GTGGACGGAG GAGGCGGGGG AGCGGGCCGC CCTTTCCGAG<br>
+
-
  1351 AGGCTCTTCG CCAACCTGTG GGGGAGGCTT GAGGGGGAGG AGAGGCTCCT<br>
+
-
  1401 TTGGCTTTAC CGGGAGGTGG AGAGGCCCCT TTCCGCTGTC CTGGCCCACA<br>
+
-
  1451 TGGAGGCCAC GGGGGTGCGC CTGGACGTGG CCTATCTCAG GGCCTTGTCC<br>
+
-
  1501 CTGGAGGTGG CCGAGGAGAT CGCCCGCCTC GAGGCCGAGG TCTTCCGCCT<br>
+
-
  1551 GGCCGGCCAC CCCTTCAACC TCAACTCCCG GGACCAGCTG GAAAGGGTCC<br>
+
-
  1601 TCTTTGACGA GCTAGGGCTT CCCGCCATCG GCAAGACGGA GAAGACCGGC<br>
+
-
  1651 AAGCGCTCCA CCAGCGCCGC CGTCCTGGAG GCCCTCCGCG AGGCCCACCC<br>
+
-
  1701 CATCGTGGAG AAGATCCTGC AGTACCGGGA GCTCACCAAG CTGAAGAGCA<br>
+
-
  1751 CCTACATTGA CCCCTTGCCG GACCTCATCC ACCCCAGGAC GGGCCGCCTC<br>
+
-
  1801 CACACCCGCT TCAACCAGAC GGCCACGGCC ACGGGCAGGC TAAGTAGCTC<br>
+
-
  1851 CGATCCCAAC CTCCAGAACA TCCCCGTCCG CACCCCGCTT GGGCAGAGGA<br>
+
-
  1901 TCCGCCGGGC CTTCATCGCC GAGGAGGGGT GGCTATTGGT GGCCCTGGAC<br>
+
-
  1951 TATAGCCAGA TAGAGCTCAG GGTGCTGGCC CACCTCTCCG GCGACGAGAA<br>
+
-
  2001 CCTGATCCGG GTCTTCCAGG AGGGGCGGGA CATCCACACG GAGACCGCCA<br>
+
-
  2051 GCTGGATGTT CGGCGTCCCC CGGGAGGCCG TGGACCCCCT GATGCGCCGG<br>
+
-
  2101 GCGGCCAAGA CCATCAACTT CGGGGTCCTC TACGGCATGT CGGCCCACCG<br>
+
-
  2151 CCTCTCCCAG GAGCTAGCCA TCCCTTACGA GGAGGCCCAG GCCTTCATTG<br>
+
-
  2201 AGCGCTACTT TCAGAGCTTC CCCAAGGTGC GGGCCTGGAT TGAGAAGACC<br>
+
-
  2251 CTGGAGGAGG GCAGGAGGCG GGGGTACGTG GAGACCCTCT TCGGCCGCCG<br>
+
-
  2301 CCGCTACGTG CCAGACCTAG AGGCCCGGGT GAAGAGCGTG CGGGAGGCGG<br>
+
-
  2351 CCGAGCGCAT GGCCTTCAAC ATGCCCGTCC AGGGCACCGC CGCCGACCTC<br>
+
-
  2401 ATGAAGCTGG CTATGGTGAA GCTCTTCCCC AGGCTGGAGG AAATGGGGGC<br>
+
-
  2451 CAGGATGCTC CTTCAGGTCC ACGACGAGCT GGTCCTCGAG GCCCCAAAAG<br>
+
-
  2501 AGAGGGCGGA GGCCGTGGCC CGGCTGGCCA AGGAGGTCAT GGAGGGGGTG<br>
+
-
  2551 TATCCCCTGG CCGTGCCCCT GGAGGTGGAG GTGGGGATAG GGGAGGACTG<br>
+
-
  2601 GCTCTCCGCC AAGGAGTGAT ACCACC<br>
+
-
<br>
+
-
We took the above sequence from the provided link at BLAST and exported the SEQ into Plasma DNA. <br>
+
-
Plasma DNA is freeware from University of Helsinki which provides quick analysis of plasmid sequence information. http://research.med.helsinki.fi/plasmadna/<br>
+
-
<br>
+
-
When we cut and paste this dna sequence into plasmadna and look at the output window, we are given a visual output of various coding information. Such as restriction sites found within the code. To consider a construct viable for a BbPart
+
-
we'll need to make certain that the standard restriction enzymes used with the system won't sheer the dna making it incomplete code. Searching for EcoRI, Xbe1, Sbe1, Pst1 sites will show whether the code is viable in an untampered state.
+
-
<br>
+
-
'''Problem: PstI restriction site - Found @ 1717'''<br>
+
-
CTGCAG-PstI restriction site<br>
+
-
GACGTC-Complement<br>
+
-
<br>
+
-
'''Solution - Site-specific Mutagenesis by Overlap Extension'''<br>
+
-
<br>
+
-
Sambrook, Joseph; Russell, David W. ; Molecular Cloning: A Laboratory Manual, 3rd Edition - (http://www.cshlpress.com/default.tpl?cart=1279686078181232350&fromlink=T&linkaction=full&linksortby=oop_title&--eqSKUdatarq=21)<br>
+
-
<br>
+
-
We then used the Gene Designer 2.0 freeware from DNA2.0 (https://www.dna20.com/genedesigner2/) - to analyze the Open Reading Frames. It shows us the Amino Acid codons that were being coded within that PstI Restrictions site. We find that the first three are coding for Leucine with CTG and can be changed at one point to CTT and still maintain Leucine's amino acid. The hope is that this will maintain functional integrity in the manufactured enzyme.<br>
+
-
<br>
+
-
'''Design 2 Primers'''<br>
+
-
(11-14 Bp around chosen mutation) with changed Amino Acid Bp's Targeting initial Leucine at G of CTG to CTT<br>
+
-
<br>
+
-
                * - Point mutation Original G in CTG of Leucine. Change of one base to CTT maintains Leucine integrity.
+
-
GTGGAGAAGATCCT(T)CAGTACCGGCGG<br>
+
-
CACCTCTTCTAGGA(A)GTCATGGCCGCC<br>
+
-
<br>
+
-
And while we're designing primers, besides the point mutation, we'll take the opportunity to design and order the primers for the Bb Suffix and Prefix. We'll follow the examples laid out in the Registry of Standard Parts, under Promoter Construction - 1. Designing the oligos needed to make a part.<br>
+
-
http://partsregistry.org/Help:Promoters/Construction<br>
+
-
<br>
+
-
Important considerations are Melting Point and percentage CG complements. Other considerations are dimerizations, that might cause primers to hairpin.<br>
+
-
We analyzed these primers using the OligoAnalyzer at IDT. When analyzing PolI Complements only were used for sequence inquiry, not the Bb Suffix/Prefixes.<br>
+
-
http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/<br>
+
-
<br>
+
-
'''PolI Coli Primers For Overlap Extension PCR'''<br>
+
<br>
<br>
-
'''PCR Reaction - 1'''<br>
+
====PolI Coli Primers For Overlap Extension PCR====
 +
'''PCR Reaction 1''' <br>
<br>
<br>
Bb Prefix + PolI (Fwd Complement) : (Forward complement will begin coding at 121 according to BLAST CDS information.)<br>
Bb Prefix + PolI (Fwd Complement) : (Forward complement will begin coding at 121 according to BLAST CDS information.)<br>
Line 209: Line 108:
<br>
<br>
'''Voila!!!''' Brand New Taq Polymerase Bb Part.<br>
'''Voila!!!''' Brand New Taq Polymerase Bb Part.<br>
-
=== Part 2 ===
 
-
 
-
=== The Experiments ===
 
-
 
-
We began the first few weeks meeting to orient ourselves with the structure of the Registry.
 
-
 
-
=== Part 3 ===
 
-
 
-
== Results ==
 
-
 
-
[[image:DIYelectrophoresis1.JPG|500px]]
 
-
 
-
[[image:DIYelectrophoresis2.JPG|500px]]
+
== Developing low-cost alternatives to existing hardware: Project Details and Results ==
 +
An unfortunate fact of reality is that precision lab equipment is very costly. Even simple devices such as an Electrophoresis or PCR have significant cost. To ameliorate this a portion of our project will involve designing biological tools that are easy to build and are economical.<br><br>
 +
[[Image:Baltimore US System.JPG|300px]]<br>
 +
Our design incorporates two devices, a PCR and an Electrophoresis. Both are controlled by the same control electronics and power supply. A basic overview of the design can be seen in the diagram above. This design allows precise control from a computer or manual control from the control panel on the control electronics. Additionally multiple Electrophoresis devices can be controlled simultaneously in parallel and any power supply suitable can be used to power the devices.
-
[[image:DIYelectrophoresis3.JPG|500px]]
+
[[Image:EP.jpg|300px]]<br>
 +
With regards to equipment, we have successfully constructed a very low-cost Gel Electrophoresis device and are currently working on the control software and control electronics. Additionally, we are working on getting a low-cost PCR thermocycler up and running as well.<br> [[Team:Baltimore_US/Notebook/EPInstructions|Instructions and Design files for building an Electrophoresis device]]

Latest revision as of 03:14, 28 October 2010

TitleBarBalti US.png
Home Team Official Team Profile Project Submitted Parts Modeling Notebook Meeting/Lab Times Safety


DIY-GEM: a path towards low cost high throughput gene synthesis.

Synthetic biology research requires more cost effective approaches toward reagents and hardware accessibility. We are developing low-cost alternatives to existing hardware and enzymes in an attempt to expand participation in biological research and development. Our project expands the accessibility of Taq Polymerase by engineering it in a form compatible with BioBrick assembly. This allows use of the over-expressed enzyme from a crude bacterial extract in a PCR reaction at a fraction of the cost of highly purified commercial enzyme. In addition, we have developed inexpensive and easily assembled lab equipment such as a gel electrophoresis apparatus and a PCR thermal cycler. Enabling researchers to synthesize their own enzymes and having access to inexpensive tools will allow for increased participation among the DIY-bio community, stretch increasingly scarce educational funds, and allow rapid scale up of large scale gene synthesis projects."

Developing low-cost alternatives to existing enzymes: Taq polymerase Project Details

We wished to insert Taq Polymerase into a standard BioBrick vector. If this part should prove useful to other teams as an element of a rational design, we must ensure that no sites for the standard BioBrick restriction enzymes exist within the part itself, otherwise the part would shear upon assembly.


We examined the Taq sequenceand exported the SEQ into Plasma DNA. Plasma DNA is free software from University of Helsinki which provides quick analysis of plasmid sequence information. In particular, we obtained a restriction map which identified potential EcoRI, Xbe1, Sbe1, or Pst1 sites within the coding sequence. Here we encountered our first difficulty.

Problem: a PstI restriction site within the coding sequence

At 1717nt, we discovered a restriction site for Pst1:

 ...CTGCAG...  PstI restriction site
...GACGTC... Complement

We attempted to eliminate the restriction site by employing a site-specific mutagenesis by overlap extension protocol (see Sambrook, Joseph; Russell, David W. ; Molecular Cloning: A Laboratory Manual, 3rd Edition).

We then used the Gene Designer 2.0 from DNA2.0 to analyze the open reading frames and examine the codons within the PstI restriction site. We find that the first three code for leucine with CTG; we can substitute the final base pair to yield CTT without sacrificing functional integrity in the manufactured enzyme.

Primer Design

We designed a primer pair in order to induce point-mutagenesis at the Pst1 restriction site, flanking the base pair to be altered by 14 nt:

GTGGAGAAGATCCT(T)CAGTACCGGCGG
CACCTCTTCTAGGA(A)GTCATGGCCGCC

While we designed the point-mutagenesis primers, we took the opportunity to design and order the primers for the BioBrick Suffix and Prefix. We followed the examples laid out in the Registry of Standard Parts for designing the oligos needed to make a part. Important considerations are melting point and CG concentration, as well as self-dimerizations and hairpins. We analyzed these primers using the OligoAnalyzer from IDT. When analyzing PolI, only the coding seuence itself was used for sequence inquiry, not the BioBrick Suffix/Prefixes.

PolI Coli Primers For Overlap Extension PCR

PCR Reaction 1

Bb Prefix + PolI (Fwd Complement) : (Forward complement will begin coding at 121 according to BLAST CDS information.)
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG-ATGCTGCCCCTCTTTGAGCC
60.5 c ; 56.5 % GC Concetration

TAQ Rm
CTCCCGGTACTGAAGGATCTTCTCCAC
61.5 c ; 55.6 % GC Concentration

PCR Reaction - 2

TAQ Fm
GTGGAGAAGATCCTTCAGTACCGGGAG
61.5 c; 55.6 % GC

Bb Suffix + PolI (Reverse Complement) : (Reverse complement will end coding at 2619 according to Blast CDS information.
GTTTCTTCCTGCAGCGGCCGCTACTAGTA-TCACTCCTTGGCGGAGAGCC
61.8 c; 65 % GC

PCR Reaction - 3
Bb Prefix & Suffix Primers

Resuspend in 100 uL of H2O
Run PCR w 1/100 dilutions for PCR (5-10 uL per PCR reaction)

NEXT
- Create Full Bb Prmr w Plasmid combining new part using

BBa_R0010 - Promoter (LacI)
BBa_B0034 - Strong RBS
NEW PART - PolI Bb Format
BBa_B0015 - Double Terminator
Psb1_?_3 - Plasmid of Interest with Chosen Resistance : http://partsregistry.org/Plasmid_backbones



BBa_R0010 + BBa_B0034 = New part LacI Promoter + Strong RBS

Cut BBa_R0010 w/EcoRI & SpeI
Cut BBa_B0034 w/XbeI & PstI

Combine in Chloramphenecol Resistant Plasmid (cut w/EcoRI & PstI) - Because

---
New Part + BBa_B0015 = New Part

Cut New Part w/EcoRI & SpeI
Cut BBa_B0015 w/XbeI & PstI

Combine in Chloramphenecol Resistant Plasmid (cut w/EcoRI & PstI)




Cut 1st Combined Part w/EcoRI & SpeI
Cut 2nd Combined Part w/XbeI & PstI

Combine in Ampecillan/Kanamyacin Resistan Plasmid (cut w/EcoRI & PstI)

Voila!!! Brand New Taq Polymerase Bb Part.

Developing low-cost alternatives to existing hardware: Project Details and Results

An unfortunate fact of reality is that precision lab equipment is very costly. Even simple devices such as an Electrophoresis or PCR have significant cost. To ameliorate this a portion of our project will involve designing biological tools that are easy to build and are economical.

Baltimore US System.JPG
Our design incorporates two devices, a PCR and an Electrophoresis. Both are controlled by the same control electronics and power supply. A basic overview of the design can be seen in the diagram above. This design allows precise control from a computer or manual control from the control panel on the control electronics. Additionally multiple Electrophoresis devices can be controlled simultaneously in parallel and any power supply suitable can be used to power the devices.

EP.jpg
With regards to equipment, we have successfully constructed a very low-cost Gel Electrophoresis device and are currently working on the control software and control electronics. Additionally, we are working on getting a low-cost PCR thermocycler up and running as well.
Instructions and Design files for building an Electrophoresis device