http://2010.igem.org/wiki/index.php?title=Special:Contributions/Yaksoy&feed=atom&limit=50&target=Yaksoy&year=&month=2010.igem.org - User contributions [en]2024-03-28T09:58:34ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Macquarie_Australia/aboutusTeam:Macquarie Australia/aboutus2011-03-06T23:03:25Z<p>Yaksoy: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
#navigation{background-color:#000; }<br />
ul#navigation { list-style:none; align:left; padding-left:0;width:12em; }<br />
ul#navigation li {<br />
displa:inline;<br />
background-color: #A11F37;<br />
border-top: solid 1px #fff;<br />
text-align: left;<br />
margin: 0;<br />
align:left;<br />
<br />
}<br />
ul#navigation li a {<br />
display: block;<br />
text-decoration: none;<br />
padding: .25em;<br />
border-bottom: solid 1px #fff;<br />
border-right: solid 1px #fff;<br />
}<br />
#navigation a:link { color: #fff; }<br />
#navigation a:visited { color: #fff; }<br />
#navigation a:hover { color: #fff; }<br />
#navigation a:active { color: #000; }<br />
#navigation a:hover { background-color: #fff;color:#77787C; }<br />
#navigation{align:left;}<br />
#body{float:right;width:81%;padding-bottom:60px;text-align:justify;font-family:calibri,Arial, Helvetica, sans-serif;font-size:12;}<br />
#sidebar{float:left; width:15%; padding:0em;}<br />
#header{align:left;}<br />
#pic{float:right;}<br />
#pic img{height:185px;width:250px;}<br />
#instructions{ color: #80 00 00;text-align: center; font-weight: normal; font-size: medium; padding: 10px;}<br />
#box{text-align: center; font-weight: bold; font-size: large; color: #80 00 00; padding: 15px;}<br />
#cham{text-align:center; font-weight: normal; font-size: large; padding: 10px;}<br />
#container{padding-top:0;}<br />
<br />
body {background-color:#A11F37}<br />
</style><br />
</head><br />
<body><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/2010/0/07/Macquarie_Australia_logo.png" /><br />
<img src="https://static.igem.org/mediawiki/2010/9/9c/Chameleon.gif" /><br />
<br />
</div><br />
<div id="sidebar" ><br />
<ul id="navigation"><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia">Home</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Team">Team</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Project">Project</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Parts">Parts Submitted to the Registry</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Glossary">Glossary</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/humanpractice">Human practice</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook">Notebook 1: <i>Agrobacterium Tumefaciens</i><br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook2">Notebook 2: <i>Deinococcus Radiodurans</i> <br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook3">Notebook 3: Cloning <br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Protocols and Other Methods">Protocols and Other Methods</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Safety">Safety</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/aboutus">About Us</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/References">References</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Just for fun!">Just for fun!</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Acknowledgements">Acknowledgements</a></li><br />
<li><a href="https://igem.org/Team.cgi?year=2010">Official Team Profile</a></li><br />
</ul><br />
<br />
</div><br />
<div id="body"><br />
<h1>About us</h1><br />
<p><p><br />
<br />
<table><br />
<tr><br />
<td><image src="https://static.igem.org/mediawiki/2010/thumb/f/fc/Yagiz2.jpg/449px-Yagiz2.jpg" width="200" height="250"></td><br />
<td><br />
<h2> Yagiz Alp Aksoy</h2><br />
<br />
<br />
Yagiz is a senior student majoring in Biomolecular Sciences and he is the leader of<br />
Macquarie_Australia Team. Before starting his “adventures at Macquarie”, Yagiz studied Molecular<br />
Biology and Genetics for 2 years in Izmir Institute of Technology and spent a short semester in<br />
London International Youth and Science Forum as representative of Turkey. After transferring to<br />
Macquarie Uni. to continue his undergrad., the very first thing he did was to ask his future boss to<br />
participate to the iGEM 2008. His proposal was refused but he was offered to work as a research<br />
assistant instead. Since then, he undertook various research projects in EMMA Lab. and got himself<br />
ready for iGEM. In 2010, he eventually fulfilled his dream of participating to iGEM accompanied<br />
by wonderful teammates. Yagiz loves synthetic biology and genetic engineering, and he wants to<br />
pursue his PhD in a related area. Yagiz enjoys playing chess and practices Wing Chun Kung Fu. Yagiz<br />
can be contacted on yagiz.aksoy@mq.edu.au.<br />
</td><br />
</tr><br />
<tr><td><img src="https://static.igem.org/mediawiki/2010/e/e8/Hilal2.jpg" width="230" height="180"/></td><br />
<td><br />
<p><p><br />
<h2> Hilal Varinli </h2><br />
<br />
<br />
<br />
<br />
Hilal is in her final year of Bachelor of Biomolecular Science degree in Macquarie University. She came to Macquarie University as a transfer student after studying one year in Istanbul Technical University and another year in Universidad Politécnica de Valencia. Apart from her study, she works as a research assistant in the Department of Biological Sciences for the last two years. So far, she has participated in a number of molecular projects involving genetic typing of birds (Bell Miners, Noisy Miners, Brush Turkeys), and population genetics in marine and freshwater fish (Parma, Girella, Melanotaenia and Gambusia). She is interested in the area of metagenomics where she can have her hands on genes and proteins. Hilal Varinli can be contacted on hilal.varinli@students.mq.edu.au.<br />
</td><br />
</tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2010/thumb/6/61/Jo.jpg/450px-Jo.jpg" widht="250" height="280"/></td><br />
<br />
<td><br />
<p> <p><br />
<br />
<h2> Joanna Hare </h2><br />
<br />
<p> <p><br />
<br />
Joanna Hare - Joanna is an undergrad student finishing a Bachelor of Science majoring in Biomolecular Science. Joanna hopes to undertake an honours project next year and after that she plans to apply for a PhD to further her research skills. One day she would like to work in a research lab somewhere combining her key interest areas of genetics and molecular biology. Joanna can be contacted on joanna.hare@yahoo.com.au. <br />
<br />
<br />
</td><br />
</tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2010/thumb/f/fd/Olga.jpg/450px-Olga.jpg" width="200" height="250"/></td><br />
<td><br />
<br />
<h2> Olga Ibrahim </h2><br />
<br />
<p> <p><br />
Olga Ibrahim is currently studying a double degree at Macquarie University in Science and Education. She is looking forward to her future career and hopes to be an inspiring high school Chemistry teacher. Olga is enjoying the iGEM competition and has already taught her so many new skills from laboratory to teamwork skills. Olga loves to bring fun to the labs and is very excited to head to Jamboree in November 2010 for the iGEM competition! Olga Can be contacted on olga.ibrahim@students.mq.edu.au.<br />
<br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2010/thumb/b/b8/Sangeev2.jpg/450px-Sangeev2.jpg" width="200" height="250" /></td><br />
<br />
<td><br />
<br />
<h2> Sangeev Santhirasegaram </h2><br />
<br />
<p> <p><br />
<br />
Sangeev is in his final year as an undergraduate student at Macquarie University doing a Bachelor of Science majoring in Biomolecular Science. He has a background in Biology,Chemistry and Microbiology. Sangeev enjoys the experience he is gaining through iGEM and hopes it will assist him to gain a better understanding of some of the major scientific research which is occurring in Science today. Sangeev can be contacted on sangeev.santhirasegaram@students.mq.edu.au. <br />
</td><br />
</tr><br />
<br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/2010/6/65/Katie2.jpg" width="200" height="200" /></td><br />
<br />
<td><br />
<br />
<h2> Katherine Mackenzie </h2><br />
<br />
<p> <p><br />
<br />
Katie is an undergrad science student at Macquarie University who is studying proteomics and biotechnology. Katie hopes to go on to study honours and eventually a PhD. She is an advocate for the environment and is passionate about making a sustainable world for the future. In her spare time Katie loves to travel, she just spent 2 years travelling Europe and India. She is enjoying working with the iGEM team! Katie can be contacted on katherine.mackenzie@students.mq.edu.au.<br />
<br />
</td><br />
<br />
</tr><br />
</table><br />
<br />
<br />
<p><br />
<br />
<br />
</div><br />
</body><br />
</html></div>Yaksoyhttp://2010.igem.org/Team:Macquarie_AustraliaTeam:Macquarie Australia2010-10-28T02:45:22Z<p>Yaksoy: </p>
<hr />
<div><html><br />
<br />
<br />
<br />
<br />
<head><br />
<title>Macquarie University IGM</title><br />
<style type="text/css"><br />
#navigation{background-color:#A11F37; }<br />
ul#navigation { list-style:none; align:left; padding-left:0;width:12em; }<br />
ul#navigation li {<br />
display:inline;<br />
background-color: #A11F37;<br />
border-top: solid 1px #fff;<br />
text-align: left;<br />
margin: 0;<br />
align:left;<br />
<br />
}<br />
ul#navigation li a {<br />
display: block;<br />
text-decoration: none;<br />
padding: .25em;<br />
border-bottom: solid 1px #fff;<br />
border-right: solid 1px #fff;<br />
}<br />
<br />
#navigation a:link { color: #000; }<br />
#navigation a:visited { color: #fff; }<br />
#navigation a:hover { color: #000;}<br />
#navigation a:active { color: #000; }<br />
#navigation a:hover { background-color: #fff;color:#77787C; }<br />
#navigation{align:left;}<br />
#body{float:right;width:82%;padding-bottom:60px;font-face:calibri;text-align_center;}<br />
#sidebar{float:left; width:15%; padding:0em;}<br />
#header{align:left;}<br />
#pic{float:right;}<br />
#pic img{height:185px;width:250px;}<br />
#instructions{ color: #80 00 00;text-align: center; font-weight: normal; font-size: medium; padding: 10px;font-face:calibri;}<br />
#box{text-align: center; font-weight: bold; font-size: large; color: #80 00 00; padding: 15px;}<br />
#cham{text-align:center; font-weight: normal; font-size: large; padding: 10px;}<br />
#container{padding-top:0;}<br />
#youtube{float:left;width:15%}<br />
<br />
<br />
<br />
<br />
<br />
<br />
body {background-color:#A11F37; font-face:calibri;}<br />
</style><br />
</head><br />
<body><br />
<div id="container"><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/2010/0/07/Macquarie_Australia_logo.png" /><br />
<img src="https://static.igem.org/mediawiki/2010/9/9c/Chameleon.gif" /><br />
<div id="pic"><br />
<br />
<br />
<object width="480" height="385"><param name="movie" value="http://www.youtube.com/v/bVimaQdJlxw?fs=1&amp&autoplay=1;hl=en_US&amp;rel=0"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/bVimaQdJlxw?fs=1&amp&autoplay=1;hl=en_US&amp;rel=0" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="250" height="185"></embed></object><br />
</div><br />
</div><br />
<br />
<br />
<br />
<br />
<div id="sidebar" ><br />
<ul id="navigation"><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia">Home</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Team">Team</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Project">Project</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Parts">Parts Submitted to the Registry</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Glossary">Glossary</a></li><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/humanpractice">Human practice</a></li><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook">Notebook 1: <i>Agrobacterium Tumefaciens</i><br />
</a></li><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook2">Notebook 2: <i>Deinococcus Radiodurans</i> <br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook3">Notebook 3: Cloning<br />
<br />
</a></li><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Protocols and Other Methods">Protocols and Other Methods</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Safety">Safety</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/aboutus">About Us</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/References">References</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Just for fun!">Just for fun!</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Acknowledgements">Acknowledgements</a></li><br />
<li><a href="https://igem.org/Team.cgi?year=2010">Official Team Profile</a></li><br />
</ul><br />
<br />
</div><br />
<br />
<br />
<div id="body"><br />
<div id="box" ><br />
<br />
<h1><font color="#47484c">Welcome to the Macquarie University Team Wiki!</font></h1><br />
</div><br />
<br />
<br />
<div id="instructions"><br />
Engineering a Bacteriophytochrome switch – creating a controllable <i> E. coli </i><br />
<p><br />
<div id = "cham"><br />
<font color="#2554C7">c</font><br />
<font color="#387C44">h</font><br />
<font color="#2554C7">a</font><br />
<font color="#387C44">m</font><br />
<font color="#2554C7">e</font><br />
<font color="#387C44">l</font><br />
<font color="#2554C7">e</font><br />
<font color="#387C44">o</font><br />
<font color="#2554C7">n</font><p></div><br />
<font face="calibri"><br />
<br />
<h2><font color="#47484c">Welcome!!!</font></h2> <p><p> <p><p><br />
<br />
G’day and welcome to the Macquarie University iGEM homepage from the land down under!! <p>(Australia, that is…!). <p><p><br />
<br />
This is the first time we have entered the competition and four of our team members will be travelling to MIT. <p><p><br />
<br />
We are looking forward to meeting other groups from all around the world! We are all really excited to be lucky enough to participate in such a significant competition. <p><p><br />
<br />
We hope you find a lot of helpful information on our Wiki. Feel free to contact us by clicking on the “About Us” tab located on the bar on the left hand side of this page! If you are interested, you can also check out our facebook and twitter pages! <p><p><br />
<br />
<center><br />
<br />
<script src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script> <br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 4,<br />
interval: 6000,<br />
width: 250,<br />
height: 300,<br />
theme: {<br />
shell: {<br />
background: '#333333',<br />
color: '#ffffff'<br />
},<br />
tweets: {<br />
background: '#000000',<br />
color: '#ffffff',<br />
links: '#4aed05'<br />
}<br />
},<br />
features: {<br />
scrollbar: false,<br />
loop: false,<br />
live: false,<br />
hashtags: true,<br />
timestamp: true,<br />
avatars: false,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('Macquarie_iGEM').start(); <br />
</script><br />
</center><br />
<br />
<center><br />
<br />
<br />
<br />
<iframe src="http://www.facebook.com/plugins/like.php?href=http%3A%2F%2Fexample.com%2Fpage%2Fto%2Flike&amp;layout=standard&amp;show_faces=true&amp;width=450&amp;action=like&amp;colorscheme=light&amp;height=80" scrolling="no" frameborder="0" style="border:none; overflow:hidden; width:450px; height:80px;" allowTransparency="true"></iframe> <p><br />
<br />
<p><br />
<br />
<br />
</center><br />
<br />
<h2><font color="#47484c">About Macquarie University</font></h2> <p><p><br />
<br />
<br />
Macquarie University, a welcoming community which is comprised of 31,000 students, with 8,800 international students from over 114 countries. <p><p><br />
<br />
Macquarie University is ranked as one of Australia’s top nine universities and one of the top 40 universities in the Asia-Pacific region. We are recognised for having an innovative curriculum, high-quality teaching and research, and unique campus environment.<br />
<br />
<p><p> Students that are involved in this community are all encouraged to develop qualities, skills and knowledge essential to their future success. <p><p><br />
Macquarie’s goal is to reach the top eight research-intensive universities in Australia and among the top 200 in the world by its 50th anniversary in 2014. <p><p><br />
<br />
<p><p><br />
<br />
Macquarie has recently established the Australian School of Advanced Medicine, advanced into high-technology engineering, and identified concentrations of research excellence (COREs), meaning the Macquarie concentrates on distinct research areas of the highest quality. <p><p>Macquarie also has doctoral research partnerships with 53 universities from 22 countries.<br />
<br />
<hr><br />
<p><br />
<br />
<a target='_blank' title='ImageShack - Image And Video Hosting' href='http://img12.imageshack.us/i/igem.png/'><img src='http://img12.imageshack.us/img12/7111/igem.png' border='0'/></a><br />
<br />
</a><br />
<br />
<center><h3><br />
'''<b>2010 iGEM Teams</b>'''<br></h3><br />
38 Teams From Europe<br><br />
37 Teams From the U.S.<br><br />
34 Teams From Asia<br><br />
10 Teams From Canada<br><br />
4 Teams From Latin America<br><br />
4 Teams From Australia<br><br />
1 Team From Africa<br><br />
</center> <br />
<br />
<br />
</font><br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
<br />
<div id="youtube"><br />
<br />
</div><br />
<br />
</body><br />
<br />
<br />
<br />
</html><br />
<br />
<br />
<br />
<!-- *** End of the alert box *** --><br />
<br />
<br />
<br />
<br />
<!--- The Mission, Experiments ---></div>Yaksoyhttp://2010.igem.org/Team:Macquarie_Australia/SafetyTeam:Macquarie Australia/Safety2010-10-27T03:51:25Z<p>Yaksoy: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
#navigation{background-color:#000; }<br />
ul#navigation { list-style:none; align:left; padding-left:0;width:12em; }<br />
ul#navigation li {<br />
displa:inline;<br />
background-color: #A11F37;<br />
border-top: solid 1px #fff;<br />
text-align: left;<br />
margin: 0;<br />
align:left;<br />
<br />
}<br />
ul#navigation li a {<br />
display: block;<br />
text-decoration: none;<br />
padding: .25em;<br />
border-bottom: solid 1px #fff;<br />
border-right: solid 1px #fff;<br />
}<br />
#navigation a:link { color: #fff; }<br />
#navigation a:visited { color: #fff; }<br />
#navigation a:hover { color: #fff; }<br />
#navigation a:active { color: #000; }<br />
#navigation a:hover { background-color: #fff;color:#77787C; }<br />
#navigation{align:left;}<br />
#body{float:right;width:81%;padding-bottom:60px;text-align:justify;font-family:calibri,Arial, Helvetica, sans-serif;font-size:12;}<br />
#sidebar{float:left; width:15%; padding:0em;}<br />
#header{align:left;}<br />
#pic{float:right;}<br />
#pic img{height:185px;width:250px;}<br />
#instructions{ color: #80 00 00;text-align: center; font-weight: normal; font-size: medium; padding: 10px;}<br />
#box{text-align: center; font-weight: bold; font-size: large; color: #80 00 00; padding: 15px;}<br />
#cham{text-align:center; font-weight: normal; font-size: large; padding: 10px;}<br />
#container{padding-top:0;}<br />
<br />
body {background-color:#A11F37}<br />
</style><br />
</head><br />
<body><br />
<br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/2010/0/07/Macquarie_Australia_logo.png" /><br />
<img src="https://static.igem.org/mediawiki/2010/9/9c/Chameleon.gif" /><br />
<br />
</div><br />
<div id="sidebar" ><br />
<ul id="navigation"><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia">Home</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Team">Team</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Project">Project</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Parts">Parts Submitted to the Registry</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Glossary">Glossary</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/human practice and “to help another iGEM team” titles">Human practice and helping another iGEM team</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook">Notebook 1: <i>Agrobacterium Tumefaciens</i><br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook2">Notebook 2: <i>Deinococcus Radiodurans</i> <br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook3">Notebook 3: Cloning <br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Protocols and Other Methods">Protocols and Other Methods</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Safety">Safety</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/aboutus">About Us</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/References">References</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Just for fun!">Just for fun!</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Acknowledgements">Acknowledgements</a></li><br />
<li><a href="https://igem.org/Team.cgi?year=2010">Official Team Profile</a></li><br />
</ul><br />
<br />
</div><br />
<div id="body"><br />
<h1><big>Biosafety page for Wiki... </h1></big><br />
<br />
<br />
<p> <p><br />
<br />
<h2> <b>1. Would any of your project ideas raise safety issues? </b><p> <p><p> </h2><br />
<br />
<br />
<br />
When working in any laboratory there are always risks involved that need to be taken into consideration. The Macquarie University 2010 iGEM team took precautionary measures designed to minimize the risks that could not only potentially affect individual researchers but also the public and the surrounding environment. <p><p><br />
<br />
Each individual team member completed a laboratory induction-training course and signed an acknowledgment to confirm that they had completed the course. The signed acknowledgement included safety measurements such as where any fire extinguishers and other safety equipment were located as well as the safe use of all machinery in the lab. <p><p><br />
<br />
<br />
Additionally, a seminar was provided by the Macquarie University Chemistry & Biomolecular Science Department’s Technical Manager of Chemical Safety officer – Jenny Minard, to explain Workplace Health and Safety. Topics including the safe storage and documentation of chemicals (such as MSDS’s and risk assessment forms) were discussed in detail. <p><p><br />
<br />
<br />
<br />
In the laboratory, we always use protective clothing such as lab coats and gloves when handling all bacterial cultures and DNA samples. The bacterial strains used in our experiments are considered non-hazardous and non-infectious and culture volumes were kept to a minimum so that any risk of spread was minimized. <p><p><br />
<br />
No harmful chemicals were required for use in these experiments. In particular, Ethidium bromide is not used to bind DNA for agarose gel visualization because of its carcinogenic properties. At Macquarie University, the use of ethidium bromide has instead been replaced with newer staining reagents such as GelRed. <p><p><br />
<br />
A Material Safety Data Sheet was completed for all chemicals and reagents used in the laboratory. All workspaces were kept clean to keep sterile conditions and bacterial waste material was auto-claved prior to disposal. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<p> <p><br />
<br />
<h2> <b> 2. Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? </b><p> <p> <p><p> </h2><br />
<br />
<br />
No, we do not consider the two cloned genes to be Biosafety hazards. The Bacteriophytochrome gene is a pigment-binding protein and the Heme Oxygenase gene is a metabolic enzyme. This means that we did not have to document any issues in the registry.<p><p><br />
<br />
<br />
<br />
<p> <p><br />
<br />
<b> <h2>3. Is there a local Biosafety group, committee, or review board at your institution? </b></h2> <p> <p> <p><p><br />
<br />
<br />
<br />
There is a local Biosafety committee at Macquarie University and all experiments which may involve biosafety risk and/or which involve cloning or transformation of organisms within the University need to obtain approval by the committee before proceeding. <p><p> <br />
<br />
The committee adheres to Australian Government’s legislation: <i> Gene Technology Regulations Act, 2000 </i>. The Biosafety committee granted approval for the 2010 Macquarie University iGEM project prior to commencement of in vivo methods such as cloning and expression (approval number REF: 5201001087EX). <p><p><br />
<br />
Additionally, as mentioned above the Chemistry & Biomolecular Science Department’s Technical Manager of Chemical Safety officer – Jenny Minard was made fully aware of all chemicals and reagents to be used in the experiment and her approval was obtained. <p><p><br />
<br />
<center> <b> For further reading on the <u>Macquarie University Biosafety Committee </u> please click on the links to the Macquarie University website: <p><p> </b><br />
<br />
Occupational Health & Safety – Biosafety: <p><p><br />
<u>http://web.science.mq.edu.au/intranet/ohs/hazsub/biosafety.htm#Biosafety </u> <p><p><br />
<br />
Biosafety Research Ethics – About the Biosafety committee: <p><p><br />
<u>http://www.research.mq.edu.au/for/researchers/how_to_obtain_ethics_approval/biosafety_research_ethics </u> <p><p><br />
<br />
<b> For further information on the <u>Australian legislation</u>, in particular the Gene Regulations Act please click on the following link: </b> <p><p><br />
<br />
Australian Government – Office of the Gene Technology Regulator <p><p><br />
<u>http://www.ogtr.gov.au/ </u><br />
</center><br />
<br />
<br />
<p><p><p><br />
<br />
<h2><b> 4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering? </h2><p> <p> </b> <p><p><br />
<br />
<br />
<br />
<br />
As the iGEM competition is getting more popular each year the number of parts to be submitted is growing. Better documentation and standardization of parts is required.<br />
<br />
<br />
<br />
<p><br />
<br />
<hr><h1><big> Suggestion for amended BiobrickTM instructions </hr></h1> <p></big><br />
<br />
<br />
<br />
<p> The instructions that can be accessed on http://partsregistry.org/<br />
Help:Spring_2010_DNA_distribution provide an explanation on how to use the linearised<br />
plasmid backbone. We found these instructions to be slightly confusing and a little misleading,<br />
particularly as it says "All you need to do is cut with EcoRI, PstI and DpnI to leave two ends ready<br />
to be ligated to a Biobrick™ part". Used in this way, it effectively incapacitates the ability to<br />
further use this BioBrick in an assembly process.</p><br />
<br />
<p><br />
The protocol given (http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones) is<br />
one that describes how to use these linearised backbones to assemble two parts together in a<br />
single ligation reaction. This is not the same as using the linearised backbone to insert a single<br />
Biobrick™ part into the linearised vector as implied in the usage instructions. </p><br />
<br />
<p>Below is a modification of this protocol to describe how to ligate in a single Biobrick part as well<br />
as renaming the use as previously described to make the usage clearer. </p><br />
<br />
<br />
<h3><u> Primers</u> </h3><br />
<br />
<p> gccgctgcagtccggcaaaaaaacg,SB-prep-3P </p> <br />
<p> atgaattccagaaatcatccttagcg,SB-prep-2Ea </p><br />
<br />
<p> Dilute to 30 pmol/ul </p><p><br />
<br />
<b> PCR </b><br />
<br />
<p>• 100 ul PCR supermix high fidelity</p><br />
<p>• 0.7 ul each primer</p><br />
<p>• 0.5 ul template DNA at 10 ng/ul (Note: Do not use a sample of linearized plasmid backbones</p><br />
<br />
(pcred) as a template.) <p><br />
<br />
cycle 94/30s; 36x(94/30s;55/30s;68/3:00 min); 68/10 min<br />
Ethanol precipitate (This step does not appear necessary)<br />
Digest with DpnI enzyme in 100 ul 2 ul DpnI<br />
Incubate 37/overnight hour; heat kill 80/20 min </p> <p><br />
<br />
<b>Cleanup </b><br />
<br />
<br />
<p><br />
<br />
<br />
<p>•Add 500 ul Qiagen buffer PB</p><br />
<br />
<p>•Spin through a column twice, discard flowthrough</p><br />
<p>•Wash 1x with 700 ul buffer PB</p><br />
<p>•Wash 2x with 760 ul buffer PE</p><br />
<p>•Discard liquid, spin dry at 17000g for 3 min</p><br />
<p>•Elute into a new tube twice with 50 ul of TE (100 ul total)</p><p><br />
<br />
<b> Quality Control </b> </p><p><br />
<br />
•Run 3 ul on a gel to verify the correct band and concentration and lack of side products </p><br />
<p>• Quantify concentration on a nanodrop. Expect around 10 ug from a 100 ul PCR reaction (100 ng/ul in 100 ul)</p><br />
<p> <b>Perform a ligation test</b><p></p><br />
<p>Test for both the EcoRI and PstI cutting and ligation efficiency</p><br />
<p>• Digest in a 15 ul final volume</p><br />
<p>•1 ul DNA (approximately 100 ng)</p><br />
<p>•1.5 ul NEB Buffer 2 (Not buffer 4; see E-Gel Buffer Compatibility)</p><br />
<p>•0.15 ul BSA</p><br />
<p>•0.5 ul either EcoRI-HF or PstI enzyme (not both!)</p><br />
<p>•12 ul water</p><br />
<p>•Digest 37/1 hour; 80/20 min</p><br />
<p>•Add 5 ul of a 4x ligation master mix</p><br />
<p>•Ligate 30 min at room temperature</p><br />
<p>•Heat kill the ligase 80/20 min</p><br />
<p>•run all 20 ul on a gel</p><br />
<p>•Compare intensity of the single and double length bands. Good product should show mostly double length bands.</p><br />
<br />
<br />
<p> <b> Ligation master mix </b></p><br />
<p>• 50 ul final</p><br />
<p>• 20 ul T4 DNA ligase buffer</p><br />
<p>•5 ul T4 DNA ligase</p><br />
<p>•25 ul water</p><br />
<br />
<p><b>Transformation test</b></p><p><br />
<p>•Transform 1 ul of the diluted final product into highly competent cells</p><br />
<p>•Control transform 10 pg of pUC19</p><br />
<p>•plate on the appropriate antibiotic and observe few colonies. Any colonies represent background to the three antibiotic assembly process</p><br />
<p>•Quantify the effective amount of remaining circular DNA able to transform </p><br />
<br />
<br />
<h3> <u>Bulk production</u> </h3><p><br />
<br />
<p>•PCR with PCR supermix high fidelity</p><br />
add 19 ul primer SB-prep-2Eb</p><br />
<p>•add 19 ul primer SB-prep-3P</p><br />
<p>•add 1 ul 10 ng/ul template DNA</p><br />
<p>•aliquot 100ul/well in 96 well plate</p><br />
<p>•cycle 1 min/94C 40x(30s 94; 30s 58; 3min 68) 10 min/68 hold 4C</p><br />
<br />
<p><b>purify Promega SV96 pcr cleanup </b></p><br />
<br />
<br />
<p>•Add 100 ul pcr cleanup buffer using 8 well pipet, mix</p><br />
<p>•transfer to cleanup plate, allow to sit 1 min, vacuum dry</p><br />
<p>•wash 3x with 200 ul 80% ethanol, vacuum after each</p><br />
<p>•remove from the wash manual, blot on paper towels, reinstall in wash manifold</p><br />
<p>•dry 4 min on vacuum</p><br />
<p>•transfer to collection manifold</p><br />
<p>•elute with 2x 50 ul TE buffer</p><br />
<p>• Measure concentration on nanodrop, adjust to 25 ng/ul with TE</p><br />
<br />
<p><h3>Use for assembly of two biobrick parts</p></h3><br />
<br />
<p>•Prepare 2x Enzyme master mix (25 ul)</p><br />
<p>•5.0 ul NEB Buffer 4</p><br />
<p>•0.5 ul NEB BSA</p><br />
<p>•0.5 ul EcoRI-HF</p><br />
<p>•0.5 ul PstI</p><br />
<br />
<p>•0.5 ul DpnI</p><br />
<p>•18 ul water</p><br />
<p>•flick mix, spin down</p><br />
<br />
<p><b> Digest construction plasmid </b></p></b><br />
<br />
</b><p>•Add 4 ul prepared construction plasmid (25 ng/ul)</p><br />
<p>•Add 4 ul 2x Enzyme mix</p><br />
<p>•digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid</p><br />
<br />
<p><b> Ligation</p></b></b><br />
</b><p>•Add 2ul of digested construction plasmid (25 ng)</p><br />
<p>•Add equimolar amount of EcoRI-HF SpeI digested fragment which will stay at 5' end of Biobrick assembly (< 3 ul)</p><br />
<br />
<p>•Add equimolar amount of XbaI PstI digested fragment which will stay at 5' end of Biobrick assembly (< 3 ul)</p><br />
<p>•Add 1 ul NEB T4 DNA ligase buffer</p><br />
<p>•Add 0.5 ul T4 DNA ligase</p><br />
<p>•Add water to 10 ul if necessary</p><br />
<p>•ligate 16C/30 min, heat kill 80C/20 min</p><br />
<p>•transform with 1-2 ul of product</p><br />
<br />
<br />
<h3>Use for insertion of a single BioBrick part or composite part from a non-registry plasmid into linearized iGEM plasmid</h3><p><br />
<br />
<p>•Prepare 2x Enzyme master mix (25 ul)</p><br />
<p>•5.0 ul NEB Buffer 4</p><br />
<p>•0.5 ul NEB BSA</p><br />
<p>•0.5 ul EcoRI</p><br />
<p>•0.5 ul PstI</p><br />
<p>•0.5 ul DpnI</p><br />
<p>•18 ul water</p><br />
<p>•flick mix, spin down</p><br />
<br />
<br />
<br />
<b><b>Digest construction plasmid</b></p></b><br />
</b><p>•Add 4 ul prepared construction plasmid (25 ng/ul)</p><br />
<p>•Add 4 ul 2x Enzyme mix</p><br />
<p>•digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid</p><br />
<br />
<p><b> Ligation</b></p></b><br />
<p>•Add 2ul of digested construction plasmid (25 ng)</p><br />
<p>•Add equimolar amount of gel purified EcoRI and PstI digested Biobrick part (< 3 ul)</p><br />
<p>•Add 1 ul NEB T4 DNA ligase buffer<br />
<p>•Add 0.5 ul T4 DNA ligase<br />
<p>•Add water to 10 ul if necessary<br />
<p>•ligate 16C/30 min, heat kill 80C/20 min<br />
<p>•transform with 1-2 ul of product<br />
<br />
</div><br />
</body><br />
</html></div>Yaksoyhttp://2010.igem.org/Team:Macquarie_Australia/SafetyTeam:Macquarie Australia/Safety2010-10-27T03:49:01Z<p>Yaksoy: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
#navigation{background-color:#000; }<br />
ul#navigation { list-style:none; align:left; padding-left:0;width:12em; }<br />
ul#navigation li {<br />
displa:inline;<br />
background-color: #A11F37;<br />
border-top: solid 1px #fff;<br />
text-align: left;<br />
margin: 0;<br />
align:left;<br />
<br />
}<br />
ul#navigation li a {<br />
display: block;<br />
text-decoration: none;<br />
padding: .25em;<br />
border-bottom: solid 1px #fff;<br />
border-right: solid 1px #fff;<br />
}<br />
#navigation a:link { color: #fff; }<br />
#navigation a:visited { color: #fff; }<br />
#navigation a:hover { color: #fff; }<br />
#navigation a:active { color: #000; }<br />
#navigation a:hover { background-color: #fff;color:#77787C; }<br />
#navigation{align:left;}<br />
#body{float:right;width:81%;padding-bottom:60px;text-align:justify;font-family:calibri,Arial, Helvetica, sans-serif;font-size:12;}<br />
#sidebar{float:left; width:15%; padding:0em;}<br />
#header{align:left;}<br />
#pic{float:right;}<br />
#pic img{height:185px;width:250px;}<br />
#instructions{ color: #80 00 00;text-align: center; font-weight: normal; font-size: medium; padding: 10px;}<br />
#box{text-align: center; font-weight: bold; font-size: large; color: #80 00 00; padding: 15px;}<br />
#cham{text-align:center; font-weight: normal; font-size: large; padding: 10px;}<br />
#container{padding-top:0;}<br />
<br />
body {background-color:#A11F37}<br />
</style><br />
</head><br />
<body><br />
<br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/2010/0/07/Macquarie_Australia_logo.png" /><br />
<img src="https://static.igem.org/mediawiki/2010/9/9c/Chameleon.gif" /><br />
<br />
</div><br />
<div id="sidebar" ><br />
<ul id="navigation"><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia">Home</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Team">Team</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Project">Project</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Parts">Parts Submitted to the Registry</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Glossary">Glossary</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/human practice and “to help another iGEM team” titles">Human practice and helping another iGEM team</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook">Notebook 1: <i>Agrobacterium Tumefaciens</i><br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook2">Notebook 2: <i>Deinococcus Radiodurans</i> <br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook3">Notebook 3: Cloning <br />
</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Protocols and Other Methods">Protocols and Other Methods</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Safety">Safety</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/aboutus">About Us</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/References">References</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Just for fun!">Just for fun!</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Acknowledgements">Acknowledgements</a></li><br />
<li><a href="https://igem.org/Team.cgi?year=2010">Official Team Profile</a></li><br />
</ul><br />
<br />
</div><br />
<div id="body"><br />
<h1><big>Biosafety page for Wiki... </h1></big><br />
<br />
<br />
<p> <p><br />
<br />
<h2> <b>1. Would any of your project ideas raise safety issues? </b><p> <p><p> </h2><br />
<br />
<br />
<br />
When working in any laboratory there are always risks involved that need to be taken into consideration. The Macquarie University 2010 iGEM team took precautionary measures designed to minimize the risks that could not only potentially affect individual researchers but also the public and the surrounding environment. <p><p><br />
<br />
Each individual team member completed a laboratory induction-training course and signed an acknowledgment to confirm that they had completed the course. The signed acknowledgement included safety measurements such as where any fire extinguishers and other safety equipment were located as well as the safe use of all machinery in the lab. <p><p><br />
<br />
<br />
Additionally, a seminar was provided by the Macquarie University Chemistry & Biomolecular Science Department’s Technical Manager of Chemical Safety officer – Jenny Minard, to explain Workplace Health and Safety. Topics including the safe storage and documentation of chemicals (such as MSDS’s and risk assessment forms) were discussed in detail. <p><p><br />
<br />
<br />
<br />
In the laboratory, we always use protective clothing such as lab coats and gloves when handling all bacterial cultures and DNA samples. The bacterial strains used in our experiments are considered non-hazardous and non-infectious and culture volumes were kept to a minimum so that any risk of spread was minimized. <p><p><br />
<br />
No harmful chemicals were required for use in these experiments. In particular, Ethidium bromide is not used to bind DNA for agarose gel visualization because of its carcinogenic properties. At Macquarie University, the use of ethidium bromide has instead been replaced with newer staining reagents such as GelRed. <p><p><br />
<br />
A Material Safety Data Sheet was completed for all chemicals and reagents used in the laboratory. All workspaces were kept clean to keep sterile conditions and bacterial waste material was auto-claved prior to disposal. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<p> <p><br />
<br />
<h2> <b> 2. Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? </b><p> <p> <p><p> </h2><br />
<br />
<br />
No, we do not consider the two cloned genes to be Biosafety hazards. The Bacteriophytochrome gene is a pigment-binding protein and the Heme Oxygenase gene is a metabolic enzyme. This means that we did not have to document any issues in the registry.<p><p><br />
<br />
<br />
<br />
<p> <p><br />
<br />
<b> <h2>3. Is there a local Biosafety group, committee, or review board at your institution? </b></h2> <p> <p> <p><p><br />
<br />
<br />
<br />
There is a local Biosafety committee at Macquarie University and all experiments which may involve biosafety risk and/or which involve cloning or transformation of organisms within the University need to obtain approval by the committee before proceeding. <p><p> <br />
<br />
The committee adheres to Australian Government’s legislation: <i> Gene Technology Regulations Act, 2000 </i>. The Biosafety committee granted approval for the 2010 Macquarie University iGEM project prior to commencement of in vivo methods such as cloning and expression (approval number REF: 5201001087EX). <p><p><br />
<br />
Additionally, as mentioned above the Chemistry & Biomolecular Science Department’s Technical Manager of Chemical Safety officer – Jenny Minard was made fully aware of all chemicals and reagents to be used in the experiment and her approval was obtained. <p><p><br />
<br />
<center> <b> For further reading on the <u>Macquarie University Biosafety Committee </u> please click on the links to the Macquarie University website: <p><p> </b><br />
<br />
Occupational Health & Safety – Biosafety: <p><p><br />
<u>http://web.science.mq.edu.au/intranet/ohs/hazsub/biosafety.htm#Biosafety </u> <p><p><br />
<br />
Biosafety Research Ethics – About the Biosafety committee: <p><p><br />
<u>http://www.research.mq.edu.au/for/researchers/how_to_obtain_ethics_approval/biosafety_research_ethics </u> <p><p><br />
<br />
<b> For further information on the <u>Australian legislation</u>, in particular the Gene Regulations Act please click on the following link: </b> <p><p><br />
<br />
Australian Government – Office of the Gene Technology Regulator <p><p><br />
<u>http://www.ogtr.gov.au/ </u><br />
</center><br />
<br />
<br />
<p><p><p><br />
<br />
<h2><b> 4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering? </h2><p> <p> </b> <p><p><br />
<br />
<br />
<br />
<br />
As the iGEM competition is getting more popular each year the number of parts to be submitted is growing. Better documentation and standardization of parts is required.<br />
<br />
<br />
<br />
<p><br />
<br />
<hr><h1><big> Suggestion for amended BiobrickTM instructions </hr></h1> <p></big><br />
<br />
<br />
<br />
<p> The instructions that can be accessed on http://partsregistry.org/<br />
Help:Spring_2010_DNA_distribution provide an explanation on how to use the linearised<br />
plasmid backbone. We found these instructions to be slightly confusing and a little misleading,<br />
particularly as it says "All you need to do is cut with EcoRI, PstI and DpnI to leave two ends ready<br />
to be ligated to a Biobrick™ part". Used in this way, it effectively incapacitates the ability to<br />
further use this BioBrick in an assembly process.</p><br />
<br />
<p><br />
The protocol given (http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones) is<br />
one that describes how to use these linearised backbones to assemble two parts together in a<br />
single ligation reaction. This is not the same as using the linearised backbone to insert a single<br />
Biobrick™ part into the linearised vector as implied in the usage instructions. </p><br />
<br />
<p>Below is a modification of this protocol to describe how to ligate in a single Biobrick part as well<br />
as renaming the use as previously described to make the usage clearer. </p><br />
<br />
<br />
<h3><u> Primers</u> </h3><br />
<br />
<p> gccgctgcagtccggcaaaaaaacg,SB-prep-3P </p> <br />
<p> atgaattccagaaatcatccttagcg,SB-prep-2Ea </p><br />
<br />
<p> Dilute to 30 pmol/ul </p><p><br />
<br />
<b> PCR </b><br />
<br />
<p>• 100 ul PCR supermix high fidelity</p><br />
<p>• 0.7 ul each primer</p><br />
<p>• 0.5 ul template DNA at 10 ng/ul (Note: Do not use a sample of linearized plasmid backbones</p><br />
<br />
(pcred) as a template.) <p><br />
<br />
cycle 94/30s; 36x(94/30s;55/30s;68/3:00 min); 68/10 min<br />
Ethanol precipitate (This step does not appear necessary)<br />
Digest with DpnI enzyme in 100 ul 2 ul DpnI<br />
Incubate 37/overnight hour; heat kill 80/20 min </p> <p><br />
<br />
<b>Cleanup </b><br />
<br />
<br />
<p><br />
<br />
<br />
<p>•Add 500 ul Qiagen buffer PB</p><br />
<br />
<p>•Spin through a column twice, discard flowthrough</p><br />
<p>•Wash 1x with 700 ul buffer PB</p><br />
<p>•Wash 2x with 760 ul buffer PE</p><br />
<p>•Discard liquid, spin dry at 17000g for 3 min</p><br />
<p>•Elute into a new tube twice with 50 ul of TE (100 ul total)</p><p><br />
<br />
<b> Quality Control </b> </p><p><br />
<br />
•Run 3 ul on a gel to verify the correct band and concentration and lack of side products </p><br />
<p>• Quantify concentration on a nanodrop. Expect around 10 ug from a 100 ul PCR reaction (100 ng/ul in 100 ul)</p><br />
<p> <b>Perform a ligation test</b><p></p><br />
<p>Test for both the EcoRI and PstI cutting and ligation efficiency</p><br />
<p>• Digest in a 15 ul final volume</p><br />
<p>•1 ul DNA (approximately 100 ng)</p><br />
<p>•1.5 ul NEB Buffer 2 (Not buffer 4; see E-Gel Buffer Compatibility)</p><br />
<p>•0.15 ul BSA</p><br />
<p>•0.5 ul either EcoRI-HF or PstI enzyme (not both!)</p><br />
<p>•12 ul water</p><br />
<p>•Digest 37/1 hour; 80/20 min</p><br />
<p>•Add 5 ul of a 4x ligation master mix</p><br />
<p>•Ligate 30 min at room temperature</p><br />
<p>•Heat kill the ligase 80/20 min</p><br />
<p>•run all 20 ul on a gel</p><br />
<p>•Compare intensity of the single and double length bands. Good product should show mostly double length bands.</p><br />
<br />
<br />
<p> <b> Ligation master mix </b></p><br />
<p>• 50 ul final</p><br />
<p>• 20 ul T4 DNA ligase buffer</p><br />
<p>•5 ul T4 DNA ligase</p><br />
<p>•25 ul water</p><br />
<br />
<p><b>Transformation test</b></p><p><br />
<p>•Transform 1 ul of the diluted final product into highly competent cells</p><br />
<p>•Control transform 10 pg of pUC19</p><br />
<p>•plate on the appropriate antibiotic and observe few colonies. Any colonies represent background to the three antibiotic assembly process</p><br />
<p>•Quantify the effective amount of remaining circular DNA able to transform </p><br />
<br />
<br />
<h3> <u>Bulk production</u> </h3><p><br />
<br />
<p>•PCR with PCR supermix high fidelity</p><br />
add 19 ul primer SB-prep-2Eb</p><br />
<p>•add 19 ul primer SB-prep-3P</p><br />
<p>•add 1 ul 10 ng/ul template DNA</p><br />
<p>•aliquot 100ul/well in 96 well plate</p><br />
<p>•cycle 1 min/94C 40x(30s 94; 30s 58; 3min 68) 10 min/68 hold 4C</p><br />
<br />
<p><b>purify Promega SV96 pcr cleanup </b></p><br />
<br />
<br />
<p>•Add 100 ul pcr cleanup buffer using 8 well pipet, mix</p><br />
<p>•transfer to cleanup plate, allow to sit 1 min, vacuum dry</p><br />
<p>•wash 3x with 200 ul 80% ethanol, vacuum after each</p><br />
<p>•remove from the wash manual, blot on paper towels, reinstall in wash manifold</p><br />
<p>•dry 4 min on vacuum</p><br />
<p>•transfer to collection manifold</p><br />
<p>•elute with 2x 50 ul TE buffer</p><br />
<p>• Measure concentration on nanodrop, adjust to 25 ng/ul with TE</p><br />
<br />
<p><h3>Use for assembly of two biobrick parts</p></h3><br />
<br />
<p>•Prepare 2x Enzyme master mix (25 ul)</p><br />
<p>•5.0 ul NEB Buffer 4</p><br />
<p>•0.5 ul NEB BSA</p><br />
<p>•0.5 ul EcoRI-HF</p><br />
<p>•0.5 ul PstI</p><br />
<br />
<p>•0.5 ul DpnI</p><br />
<p>•18 ul water</p><br />
<p>•flick mix, spin down</p><br />
<br />
<p><b> Digest construction plasmid </b></p></b><br />
<br />
</b><p>•Add 4 ul prepared construction plasmid (25 ng/ul)</p><br />
<p>•Add 4 ul 2x Enzyme mix</p><br />
<p>•digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid</p><br />
<br />
<p><b> Ligation</p></b></b><br />
</b><p>•Add 2ul of digested construction plasmid (25 ng)</p><br />
<p>•Add equimolar amount of EcoRI-HF SpeI digested fragment which will stay at 5' end of Biobrick assembly (< 3 ul)</p><br />
<br />
<p>•Add equimolar amount of XbaI PstI digested fragment which will stay at 5' end of Biobrick assembly (< 3 ul)</p><br />
<p>•Add 1 ul NEB T4 DNA ligase buffer</p><br />
<p>•Add 0.5 ul T4 DNA ligase</p><br />
<p>•Add water to 10 ul if necessary</p><br />
<p>•ligate 16C/30 min, heat kill 80C/20 min</p><br />
<p>•transform with 1-2 ul of product</p><br />
<br />
<br />
<h3>Use for insertion of a single BioBrick part or composite into the plasmid</h3><p><br />
<br />
<p>•Prepare 2x Enzyme master mix (25 ul)</p><br />
<p>•5.0 ul NEB Buffer 4</p><br />
<p>•0.5 ul NEB BSA</p><br />
<p>•0.5 ul EcoRI</p><br />
<p>•0.5 ul PstI</p><br />
<p>•0.5 ul DpnI</p><br />
<p>•18 ul water</p><br />
<p>•flick mix, spin down</p><br />
<br />
<br />
<br />
<b><b>Digest construction plasmid</b></p></b><br />
</b><p>•Add 4 ul prepared construction plasmid (25 ng/ul)</p><br />
<p>•Add 4 ul 2x Enzyme mix</p><br />
<p>•digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid</p><br />
<br />
<p><b> Ligation</b></p></b><br />
<p>•Add 2ul of digested construction plasmid (25 ng)</p><br />
<p>•Add equimolar amount of gel purified EcoRI and PstI digested Biobrick part (< 3 ul)</p><br />
<p>•Add 1 ul NEB T4 DNA ligase buffer<br />
<p>•Add 0.5 ul T4 DNA ligase<br />
<p>•Add water to 10 ul if necessary<br />
<p>•ligate 16C/30 min, heat kill 80C/20 min<br />
<p>•transform with 1-2 ul of product<br />
<br />
</div><br />
</body><br />
</html></div>Yaksoyhttp://2010.igem.org/Team:Macquarie_Australia/aboutusTeam:Macquarie Australia/aboutus2010-10-18T12:09:45Z<p>Yaksoy: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
#navigation{background-color:#000; }<br />
ul#navigation { list-style:none; align:left; padding-left:0;width:12em; }<br />
ul#navigation li {<br />
displa:inline;<br />
background-color: #A11F37;<br />
border-top: solid 1px #fff;<br />
text-align: left;<br />
margin: 0;<br />
align:left;<br />
<br />
}<br />
ul#navigation li a {<br />
display: block;<br />
text-decoration: none;<br />
padding: .25em;<br />
border-bottom: solid 1px #fff;<br />
border-right: solid 1px #fff;<br />
}<br />
a:link, a:visited { color: #fff; }<br />
a:hover, a:active { color: #000; }<br />
a:hover { background-color: #fff; }<br />
#navigation{align:left;}<br />
#body{float:right;width:81%;padding-bottom:60px;text-align:justify;font-family:calibri,Arial, Helvetica, sans-serif;font-size:12;}<br />
#sidebar{float:left; width:15%; padding:0em;}<br />
#header{align:left;}<br />
#pic{float:right;}<br />
#pic img{height:185px;width:250px;}<br />
#instructions{ color: #80 00 00;text-align: center; font-weight: normal; font-size: medium; padding: 10px;}<br />
#box{text-align: center; font-weight: bold; font-size: large; color: #80 00 00; padding: 15px;}<br />
#cham{text-align:center; font-weight: normal; font-size: large; padding: 10px;}<br />
#container{padding-top:0;}<br />
<br />
body {background-color:#A11F37}<br />
</style><br />
</head><br />
<body><br />
<div id="header"><br />
<img src="https://static.igem.org/mediawiki/2010/0/07/Macquarie_Australia_logo.png" /><br />
<img src="https://static.igem.org/mediawiki/2010/9/9c/Chameleon.gif" /><br />
<br />
</div><br />
<div id="sidebar" ><br />
<ul id="navigation"><br />
<br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia">Home</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Team">Team</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Project">Project</li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Parts">Parts Submitted to the Registry</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Glossary">Glossary</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Notebook">Notebook</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Safety">Safety</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/aboutus">About Us</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/References">References</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Just for fun!">Just for fun!</a></li><br />
<li><a href="https://2010.igem.org/Team:Macquarie_Australia/Acknowledgements">Acknowledgements</a></li><br />
<li><a href="https://igem.org/Team.cgi?year=2010">Official Team Profile</a></li><br />
</ul><br />
<br />
</div><br />
<div id="body"><br />
<h1>About us</h1><br />
<p><p><br />
<br />
<br />
<br />
<h2> Yagiz Alp Aksoy</h2><br />
<br />
<br />
Yagiz is a senior undergraduate student majoring in Biomolecular Sciences and he is the leader of<br />
Macquarie_Australia Team. Before starting his “adventures at Macquarie”, Yagiz studied Molecular<br />
Biology and Genetics for 2 years in Izmir Institute of Technology and spent a short semester in<br />
London International Youth and Science Forum as representative of Turkey. After transferring to<br />
Macquarie Uni. to continue his undergrad., the very first thing he did was to ask his future boss to<br />
participate to the iGEM 2008. His proposal was refused but he was offered to work as a research<br />
assistant instead. Since then, he undertook various research projects in EMMA Lab. and got himself<br />
ready for iGEM. In 2010, he eventually fulfilled his dream of participating to iGEM accompanied<br />
by wonderful teammates. Yagiz loves synthetic biology and genetic engineering, and he wants to<br />
pursue his PhD in a related area. Yagiz enjoys playing chess and practices Wing Chun Kung Fu. Yagiz<br />
can be contacted on yagiz.aksoy@mq.edu.au.<br />
<p><p><br />
<h2> Hilal Varinli </h2><br />
<br />
<br />
<br />
<br />
Hilal is in her final year of Bachelor of Biomolecular Science degree in Macquarie University. She came to Macquarie University as a transfer student after studying one year in Istanbul Technical University and another year in Universidad Politécnica de Valencia. Apart from her study, she works as a research assistant in the Department of Biological Sciences for the last two years. So far, she has participated in a number of molecular projects involving genetic typing of birds (Bell Miners, Noisy Miners, Brush Turkeys), and population genetics in marine and freshwater fish (Parma, Girella, Melanotaenia and Gambusia). She is interested in the area of metagenomics where she can have her hands on genes and proteins. Hilal Varinli can be contacted on hilal.varinli@students.mq.edu.au.<br />
<br />
<p> <p><br />
<br />
<h2> Joanna Hare </h2><br />
<br />
<p> <p><br />
<br />
Joanna Hare - Joanna is an undergrad student finishing a Bachelor of Science majoring in Biomolecular Science. Joanna hopes to undertake an honours project next year and after that she plans to apply for a PhD to further her research skills. One day she would like to work in a research lab somewhere combining her key interest areas of genetics and molecular biology. Joanna can be contacted on joanna.hare@yahoo.com.au. <br />
<br />
<br />
<br />
<br />
<br />
<p> <p> <br />
<br />
<p> <p><br />
<br />
<h2> Olga Ibrahim </h2><br />
<br />
<p> <p><br />
Olga Ibrahim is currently studying a double degree at Macquarie University in Science and Education. She is looking forward to her future career and hopes to be an inspiring high school Chemistry teacher. Olga is enjoying the iGEM competition and has already taught her so many new skills from laboratory to teamwork skills. Olga loves to bring fun to the labs and is very excited to head to Jamboree in November 2010 for the iGEM competition! Olga Can be contacted on olga.ibrahim@students.mq.edu.au.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p> <p><br />
<br />
<p> <p><br />
<br />
<br />
<h2> Sangeev Santhirasegaram </h2><br />
<br />
<p> <p><br />
<br />
Sangeev is in his final year as an undergraduate student at Macquarie University doing a Bachelor of Science majoring in Biomolecular Science. He has a background in Biology,Chemistry and Microbiology. Sangeev enjoys the experience he is gaining through iGEM and hopes it will assist him to gain a better understanding of some of the major scientific research which is occurring in Science today. Sangeev can be contacted on sangeev.santhirasegaram@students.mq.edu.au. <br />
<br />
<br />
<br />
<br />
<br />
<p> <p><br />
<br />
<p> <p><br />
<br />
<h2> Katherine Mackenzie </h2><br />
<br />
<p> <p><br />
<br />
Katie is an undergrad science student at Macquarie University who is studying proteomics and biotechnology. Katie hopes to go on to study honours and eventually a PhD. She is an advocate for the environment and is passionate about making a sustainable world for the future. In her spare time Katie loves to travel, she just spent 2 years travelling Europe and India. She is enjoying working with the iGEM team! Katie can be contacted on katherine.mackenzie@students.mq.edu.au.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<br />
<br />
</div><br />
</body><br />
</html></div>Yaksoyhttp://2010.igem.org/File:Macquarie_Australia_logo.pngFile:Macquarie Australia logo.png2010-07-16T14:41:58Z<p>Yaksoy: </p>
<hr />
<div></div>Yaksoyhttp://2010.igem.org/Team:Macquarie_Australia/ProjectTeam:Macquarie Australia/Project2010-07-16T14:40:53Z<p>Yaksoy: /* Overall project */</p>
<hr />
<div><!-- *** What falls between these lines is the Alert Box! You can remove it from your pages once you have read and understood the alert *** --><br />
<br />
<html><br />
<div id="box" style="width: 700px; margin-left: 137px; padding: 5px; border: 3px solid #000; background-color: #fe2b33;"><br />
<div id="template" style="text-align: center; font-weight: bold; font-size: large; color: #f6f6f6; padding: 5px;"><br />
This is a template page. READ THESE INSTRUCTIONS.<br />
</div><br />
<div id="instructions" style="text-align: center; font-weight: normal; font-size: small; color: #f6f6f6; padding: 5px;"><br />
You are provided with this team page template with which to start the iGEM season. You may choose to personalize it to fit your team but keep the same "look." Or you may choose to take your team wiki to a different level and design your own wiki. You can find some examples <a href="https://2008.igem.org/Help:Template/Examples">HERE</a>.<br />
</div><br />
<div id="warning" style="text-align: center; font-weight: bold; font-size: small; color: #f6f6f6; padding: 5px;"><br />
You <strong>MUST</strong> have a team description page, a project abstract, a complete project description, a lab notebook, and a safety page. PLEASE keep all of your pages within your teams namespace. <br />
</div><br />
</div><br />
</html><br />
<br />
<!-- *** End of the alert box *** --><br />
<br />
{|align="justify"<br />
|You can write a background of your team here. Give us a background of your team, the members, etc. Or tell us more about something of your choosing.<br />
|[[Image:Macquarie_Australia_logo.png|200px|right|frame]]<br />
|-<br />
|<br />
''Tell us more about your project. Give us background. Use this is the abstract of your project. Be descriptive but concise (1-2 paragraphs)''<br />
|[[Image:Macquarie_Australia_team.png|right|frame|Your team picture]]<br />
|-<br />
|<br />
|align="center"|[[Team:Macquarie_Australia | Team Example]]<br />
|}<br />
<br />
<!--- The Mission, Experiments ---><br />
<br />
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"<br />
!align="center"|[[Team:Macquarie_Australia|Home]]<br />
!align="center"|[[Team:Macquarie_Australia/Team|Team]]<br />
!align="center"|[https://igem.org/Team.cgi?year=2010&team_name=Macquarie_Australia Official Team Profile]<br />
!align="center"|[[Team:Macquarie_Australia/Project|Project]]<br />
!align="center"|[[Team:Macquarie_Australia/Parts|Parts Submitted to the Registry]]<br />
!align="center"|[[Team:Macquarie_Australia/Modeling|Modeling]]<br />
!align="center"|[[Team:Macquarie_Australia/Notebook|Notebook]]<br />
!align="center"|[[Team:Macquarie_Australia/Safety|Safety]]<br />
|}<br />
<br />
<br />
<br />
<br />
== '''Overall project''' ==<br />
<br />
The aim of our project is to introduce ''D. radiodurans'' phytochrome to E. Coli which can be potentially used as a light switch. Comparison and analysis of the phosphorylated peptides in recombinant E. Coli is also considered.<br />
<br />
== Project Details==<br />
<br />
<br />
<br />
<br />
<br />
=== Part 2 ===<br />
<br />
<br />
<br />
<br />
<br />
=== The Experiments ===<br />
<br />
<br />
<br />
<br />
=== Part 3 ===<br />
<br />
<br />
<br />
<br />
== Results ==</div>Yaksoy