http://2010.igem.org/wiki/index.php?title=Special:Contributions/Thezi&feed=atom&limit=50&target=Thezi&year=&month=2010.igem.org - User contributions [en]2024-03-29T14:43:43ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-11-25T12:11:47Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from the MIT.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d7/ESBS-Strasbourg-Clpp.png" width="220px" height="316px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-clpx.png" width="217px" height="316px"><br />
</center><br />
<br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/ESBS-Strasbourg-PhyB.png" width="192px" height="316px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
<p><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[41]</a></i>. </span></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[45]</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and Tyszkiewicz</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt and colleges</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/c/c3/ESBS-Strasbourg-Phybdomain.png" width="148px" height="270px" align="left"><br />
<p>&nbsp;</p><br />
<p><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> in a novel background. </span></p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[15],[35]</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/82/ESBS-Strasbourg-ImageProteinfinal%2B.png" width="239px" height="168px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></p><br />
<br />
<br />
<br><br><br />
<br><br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[34]</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker et al.</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and colleges</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/87/ESBS-Strasbourg-System.png" width="192px" height="317px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">"Engineering synthetic adaptors and substrates for controlled ClpXP degradation" from Tania Baker and collegues (2009).</a></i></span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br> <br />
<br><br><br />
<br><br><br />
In this work Baker et al. probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[14]</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the DAS-degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but it remains inactive until light-induction. However, it is expected to stay active for the background of naturally SsrA-tagged proteins, creating no interference with the natural occurring proteins of E.coli.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in a ClpX-deficient E. Coli strain.<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[18]</a></i>.<br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-28T00:15:42Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Protein analysis</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap, easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[26]</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
A complex understanding of living cells requires methods to affect and control the activities of their constituent proteins at fine spatial and temporal resolutions. Measuring responses to precise perturbations, allows the testing and improvement of predictive models of cellular networks.<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[13]</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br><br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial applications. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br><br />
Natural oscillator circuits are autonomous orchestrating periodic inductions of specific target genes and are found in central and peripheral circadian clocks <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[38]</a></i>. Many physiological activities are coordinated by circadian pacemakers <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[43],[44]</a></i>, making them particular interesting. Synthetic oscillator circuits which mediate protein expression dynamics could provide new insights into protein networks of by simulating natural conditions. <br><br />
<br><br />
Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-28T00:14:19Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">A universal tool for protein analysis</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap, easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[26]</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
A complex understanding of living cells requires methods to affect and control the activities of their constituent proteins at fine spatial and temporal resolutions. Measuring responses to precise perturbations, allows the testing and improvement of predictive models of cellular networks.<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[13]</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br><br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial applications. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br><br />
Natural oscillator circuits are autonomous orchestrating periodic inductions of specific target genes and are found in central and peripheral circadian clocks <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[38]</a></i>. Many physiological activities are coordinated by circadian pacemakers <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[43],[44]</a></i>, making them particular interesting. Synthetic oscillator circuits which mediate protein expression dynamics could provide new insights into protein networks of by simulating natural conditions. <br><br />
<br><br />
Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-28T00:05:08Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap, easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[26]</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
A complex understanding of living cells requires methods to affect and control the activities of their constituent proteins at fine spatial and temporal resolutions. Measuring responses to precise perturbations, allows the testing and improvement of predictive models of cellular networks.<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[13]</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br><br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial applications. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br><br />
Natural oscillator circuits are autonomous orchestrating periodic inductions of specific target genes and are found in central and peripheral circadian clocks <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[38]</a></i>. Many physiological activities are coordinated by circadian pacemakers <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[43],[44]</a></i>, making them particular interesting. Synthetic oscillator circuits which mediate protein expression dynamics could provide new insights into protein networks of by simulating natural conditions. <br><br />
<br><br />
Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-28T00:01:14Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap, easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[26]</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
A complex understanding of living cells requires methods to affect and control the activities of their constituent proteins at fine spatial and temporal resolutions. Measuring responses to precise perturbations, allows the testing and improvement of predictive models of cellular networks.<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[13]</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br><br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial applications. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br><br />
Natural oscillator circuits are autonomous and self sustained, orchestrating periodic inductions of specific target genes and are found in central and peripheral circadian clocks <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[38]</a></i>. Many physiological activities are coordinated by circadian pacemakers <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[43],[44]</a></i>, making them particular interesting. Synthetic oscillator circuits which mediate protein expression dynamics could provide new insights into protein networks of by simulating natural conditions. <br><br />
<br><br />
Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-27T22:58:58Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from the MIT.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d7/ESBS-Strasbourg-Clpp.png" width="220px" height="316px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-clpx.png" width="217px" height="316px"><br />
</center><br />
<br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/ESBS-Strasbourg-PhyB.png" width="192px" height="316px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
<p><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[41]</a></i>. </span></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[45]</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and Tyszkiewicz</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt and colleges</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/c/c3/ESBS-Strasbourg-Phybdomain.png" width="148px" height="270px" align="left"><br />
<p>&nbsp;</p><br />
<p><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> in a novel background. </span></p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[15],[35]</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/82/ESBS-Strasbourg-ImageProteinfinal%2B.png" width="239px" height="168px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></p><br />
<br />
<br />
<br><br><br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[34]</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker et al.</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and colleges</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/87/ESBS-Strasbourg-System.png" width="192px" height="317px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">"Engineering synthetic adaptors and substrates for controlled ClpXP degradation" from Tanja Baker and collegues (2009).</a></i></span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br> <br />
<br><br><br />
<br><br><br />
In this work Baker et al. probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[14]</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the DAS-degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but it remains inactive until light-induction. However, it is expected to stay active for the background of naturally SsrA-tagged proteins, creating no interference with the natural occurring proteins of E.coli.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in a ClpX-deficient E. Coli strain.<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[18]</a></i>.<br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ReferenceTeam:ESBS-Strasbourg/Project/Reference2010-10-27T22:56:54Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br />
<div class="heading">References</div><br />
<div class="desc"><br />
<br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">References</div><br />
<br><br />
<ul><br />
<font><br />
<li><p ALIGN="LEFT"><br />
[1] Bae, G., G. Choi </span><br />
<span>(2009).&quot;Decoding of light signals by plant phytochromes and their interacting proteins.&quot; <u>Annu Rev Plant Biol </u><b>59</b>:281-311.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[2] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2009).&quot;Engineering synthetic adaptors and substrates for controlled ClpXP <br />
degradation.&quot; <u>J Biol Chem </u><b>284</b>(33): 21848-55.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[3] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2009). <br />
&quot;Structures of asymmetric ClpX hexamers reveal nucleotide-dependent motions in a <br />
AAA+ protein-unfolding machine.&quot; <u>Cell</u> <b>139</b>(4): 744-56.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[4] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2010). <br />
&quot;Control of substrate gating and translocation into ClpP by channel residues and <br />
ClpX binding.&quot; <u>J Mol Biol</u> <b>399</b>(5): 707-18.</span></p></li><br />
<li><p ALIGN="LEFT">[5] Baker, <br />
T. A., R. T. Sauer, et al. (2005). &quot;Versatile modes of peptide recognition by <br />
the AAA+ adaptor protein SspB.&quot; <u>Nat Struct Mol Biol</u> <b>12</b>(6): 520-5.</span></p></li><br />
<li><p ALIGN="LEFT">[6] Baker, <br />
T. A., R. T. Sauer, et al. (2005). &quot;Rebuilt AAA + motors reveal operating <br />
principles for ATP-fuelled machines.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>437</b>(7062): 1115-20.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[7] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2006). <br />
&quot;Engineering controllable protein degradation.&quot; <u>Mol Cell</u> <b>22</b>(5): <br />
701-7.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[8] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2007). <br />
&quot;Altered tethering of the SspB adaptor to the ClpXP protease causes changes in <br />
substrate delivery.&quot; <u>J Biol Chem</u> <b>282</b>(15): 11465-73.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[9] Deisseroth, K., F. Zhang, et al. </span><br />
<span>(2006). <br />
&quot;Channelrhodopsin-2 and optical control of excitable cells.&quot; <u>Nat Methods</u><br />
<b>3</b>(10): 785-92.</span></p></li><br />
<li><p ALIGN="LEFT">[10] <br />
Fussenegger, M., M. Tigges, et al. (2009). &quot;A tunable synthetic mammalian <br />
oscillator.&quot; <u>Nature</u> <b>457</b>(7227): 309-12.</span></p></li><br />
<li><p ALIGN="LEFT">[11] <br />
Goldberg, A. L. (2003). &quot;Protein degradation and protection against misfolded or <br />
damaged proteins.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>426</b>(6968): 895-9.</span></p></li><br />
<li><p ALIGN="LEFT">[12] <br />
Gregersen, N., C. B. Pedersen, et al.(2003). &quot;Misfolding, degradation, and aggregation of variant proteins. The molecular pathogenesis of short chain acyl-CoA dehydrogenase (SCAD) deficiency.&quot; <u>J Biol Chem</u> <b>278</b>(48): 47449-58.</span></p></li><br />
<li><p ALIGN="LEFT">[13] <br />
Grossman, A. D. and K. L. Griffith (2008). &quot;Inducible protein degradation in <br />
Bacillus subtilis using heterologous peptide tags and adaptor proteins to target <br />
substrates to the protease ClpXP.&quot; <u>Mol Microbiol</u> <b>70</b>(4): 1012-25.</span></p></li><br />
<li><p ALIGN="LEFT">[14] <br />
Houry, W. A., U. A. Wojtyra, et al. (2003). &quot;The N-terminal zinc binding domain <br />
of ClpX is a dimerization domain that modulates the chaperone function.&quot; <u>J <br />
Biol Chem</u> <b>278</b>(49): 48981-90.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[15] Hughes, J., F. T. Landgraf, et al. </span><br />
<span>(2001). <br />
&quot;Recombinant holophytochrome in Escherichia coli.&quot; <u>FEBS Lett</u> <b>508</b>(3): <br />
459-62.</span></p></li><br />
<li><p ALIGN="LEFT">[16] <br />
Isacoff, E. Y. and P. Gorostiza (2008). &quot;Optical switches for remote and <br />
noninvasive control of cell signaling.&quot; <u>Science</u> <b>322</b>(5900): 395-9.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[17] Kohchi, T., K. Mukougawa, et al. </span><br />
<span>(2006). <br />
&quot;Metabolic engineering to produce phytochromes with phytochromobilin, <br />
phycocyanobilin, or phycoerythrobilin chromophore in Escherichia coli.&quot; <u>FEBS <br />
Lett</u> <b>580</b>(5): 1333-8.</span></p></li><br />
<li><p ALIGN="LEFT">[18] <br />
Sauer, R.T., C.M. Farrell, et al. (2005). &quot;Cytoplasmic degradation of ssrA-tagged proteins.&quot; <u>Mol. Microbiol.</u> <b>57</b>(6): 1750-61.</span></p></li><br />
<li><p ALIGN="LEFT">[19] <br />
Lagarias, J. C. and G. A. Gambetta (2001). &quot;Genetic engineering of phytochrome <br />
biosynthesis in bacteria.&quot; <u>Proc Natl Acad Sci U S A</u> <b>98</b>(19): <br />
10566-71.</span></p></li><br />
<li><p ALIGN="LEFT">[20] <br />
Lagarias, J. C., N. C. Rockwell, et al. (2006). &quot;Phytochrome structure and <br />
&nbsp;signaling mechanisms.&quot; </span><u><br />
<span><br />
Annu Rev Plant Biol</span></u><span><br />
<b>57</b>: 837-58.</span></p></li><br />
<li><p ALIGN="LEFT">[21] <br />
Lagarias, J.C., M.T. McDowell (2002). &quot;Analysis and reconstitution of <br />
phytochromes.&quot; <u>Heme, Chlorophyll, and Bilins: Methods and Protocols</u>, <br />
293-309</span></p></li><br />
<li><p ALIGN="LEFT">[22] <br />
Maurizi, M. R., R. Grimaud, et al. (1998). &quot;Enzymatic and structural <br />
similarities between the Escherichia coli ATP-dependent proteases, ClpXP and <br />
ClpAP.&quot; <u>J Biol Chem</u> <b>273</b>(20): 12476-81.</span></p></li><br />
<li><p ALIGN="LEFT">[23] <br />
Millar, A. J., O. Sorokina, et al. (2009). &quot;A switchable light-input, <br />
light-output system modelled and constructed in yeast.&quot; <u>J Biol Eng</u> <b>3</b>: <br />
15.</span></p></li><br />
<li><p ALIGN="LEFT">[24] <br />
Moffat, K. and A. Moglich (2010). &quot;Engineered photoreceptors as novel <br />
optogenetic tools.&quot; <u>Photochem Photobiol Sci</u> <b>9</b>(10): 1286-300.</span></p></li><br />
<li><p ALIGN="LEFT">[25] <br />
Moffat, K., A. Moglich, et al. (2010). &quot;Structure and function of plant photoreceptors.&quot; <u>Annu Rev Plant Biol</u> <b>61</b>: 21-47.</span></p></li><br />
<li><p ALIGN="LEFT">[26] <br />
Moroder, L. and C. Renner (2006). &quot;Azobenzene as conformational switch in model <br />
peptides.&quot; <u>Chembiochem</u> <b>7</b>(6): 868-78.</span></p></li><br />
<li><p ALIGN="LEFT">[27] <br />
Morrison, D. A. and S. Ahlawat (2009). &quot;ClpXP degrades SsrA-tagged proteins in <br />
Streptococcus pneumoniae.&quot; </span><u><br />
<span><br />
J Bacteriol</span></u><span><br />
<b>191</b>(8): 2894-8.</span></p></li><br />
<li><p ALIGN="LEFT">[28] Muir, <br />
T. W. and A. B. Tyszkiewicz (2008). &quot;Activation of protein splicing with light <br />
in yeast.&quot; <u>Nat Methods</u> <b>5</b>(4): 303-5.</span></p></li><br />
<li><p ALIGN="LEFT">[29] <br />
Quail, P. H. (2002). &quot;Phytochrome photosensory signalling networks.&quot; <u>Nat Rev <br />
Mol Cell Biol</u> <b>3</b>(2): 85-93.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[30] Quail, P. H., R. Khanna, et al. </span><br />
<span>(2004). &quot;A <br />
novel molecular recognition motif necessary for targeting photoactivated <br />
phytochrome signaling to specific basic helix-loop-helix transcription factors.&quot;<br />
<u>Plant Cell</u> <b>16</b>(11): 3033-44.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[31] Quail, P. H., E. Schafer, et al. </span><br />
<span>(2006). &quot;Photoactivated <br />
phytochrome induces rapid PIF3 phosphorylation prior to proteasome-mediated <br />
degradation.&quot; </span><u><br />
<span><br />
Mol Cell</span></u><span><br />
<b>23</b>(3): 439-46.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[32] Quail, P. H., S. Shimizu-Sato, et al. </span><br />
<span>(2002). &quot;A <br />
light-switchable gene promoter system.&quot; <u>Nat Biotechnol</u> <b>20</b>(10): <br />
1041-4.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[33] Quail PH., D. Wagner et al. (1996) &quot;Two small spatially distinct regions of phytochrome B are required for efficient signaling rates.&quot; <u>Plant Cell</u> <b>8</b>:859–71.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[34] Park Y., H. Song (2008) &quot;A degradation signal recognition in prokaryotes.&quot; <u>J. Synchrotron Rad</u><b>15</b>:246–249.</span></p></li><br />
<li><p ALIGN="LEFT">[35] <br />
Rosen, M. K., D. W. Leung, et al. (2008). &quot;Genetically encoded photoswitching of <br />
actin assembly through the Cdc42-WASP-Arp2/3 complex pathway.&quot; <u>Proc Natl Acad <br />
Sci U S A</u> <b>105</b>(35): 12797-802.</span></p></li><br />
<li><p ALIGN="LEFT"><span>[36] Schafer, E., T. Kunkel, et <br />
al. </span><br />
<span>(1993). <br />
&quot;In vitro formation of a photoreversible adduct of phycocyanobilin and tobacco <br />
apophytochrome B.&quot; <u>Eur J Biochem</u> <b>215</b>(3): 587-94.</span></p></li><br />
<li><p ALIGN="LEFT"><span>[37] Schaffner, K., C. Hill, et <br />
al. </span><br />
<span>(1994). <br />
&quot;Expression of phytochrome apoprotein from Avena sativa in Escherichia coli and <br />
formation of photoactive chromoproteins by assembly with phycocyanobilin.&quot; <u><br />
Eur J Biochem</u> <b>223</b>(1): 69-77.</span></p></li><br />
<li><p ALIGN="LEFT">[38] <br />
Sejnowski, T. J. and M. U. Gillette (2005). &quot;Physiology. Biological clocks <br />
coordinately keep life on time.&quot; </span><u><br />
<span><br />
Science</span></u><span><br />
<b>309</b>(5738): 1196-8.</span></p></li><br />
<li><p ALIGN="LEFT">[39] <br />
Sharrock, R. A. (2008). &quot;The phytochrome red/far-red photoreceptor superfamily.&quot;<br />
<u>Genome Biol</u> <b>9</b>(8): 230.</span></p></li><br />
<li><p ALIGN="LEFT">[40] Su, <br />
Z., H. Li, et al. (2010). &quot;A protease-based strategy for the controlled release <br />
of therapeutic peptides.&quot; <u>Angew Chem Int Ed Engl</u> <b>49</b>(29): 4930-3.</span></p></li><br />
<li><p ALIGN="LEFT">[41] <br />
Voigt, C. A., A. Levskaya, et al. (2005). &quot;Synthetic biology: engineering <br />
Escherichia coli to see light.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>438</b>(7067): 441-2.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[42] Voigt, C. A., A. Levskaya, et al. </span><br />
<span>(2009). <br />
&quot;Spatiotemporal control of cell signaling using a light-switchable protein <br />
interaction.&quot; <u>Nature</u> <b>461</b>(7266): 997-1001.</span></p></li><br />
<li><p ALIGN="LEFT">[43] <br />
Weaver, D. R. and S. M. Reppert (1997). &quot;Forward genetic approach strikes gold: <br />
cloning of a mammalian clock gene.&quot; </span><u><br />
<span><br />
Cell</span></u><span><br />
<b>89</b>(4): 487-90.</span></p></li><br />
<li><p ALIGN="LEFT">[44]<br />
</span><br />
<span>Weitz, C. J., K. F. <br />
Storch, et al. </span><br />
<span>(2002). <br />
&quot;Extensive and divergent circadian gene expression in liver and heart.&quot; <u><br />
Nature</u> <b>417</b>(6884): 78-83.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[45] Wu SH., JC. Lagarias JC. (2000) &quot;Defining the bilin lyase domain: lessons from the extended phytochrome superfamily.&quot; <u>Biochemistry</u><b>39</b>:13487–95.</span></p></li><br />
<li><p ALIGN="LEFT">[46]<br />
</span><br />
<span>Zuber, P. and Y. <br />
Zhang (2007). </span><br />
<span><br />
&quot;Requirement of the zinc-binding domain of ClpX for Spx proteolysis in Bacillus <br />
subtilis and effects of disulfide stress on ClpXP activity.&quot; </span><u><br />
<span><br />
J Bacteriol</span></u><span><br />
<b>189</b>(21): 7669-80.</span></p></li><br />
</ul><br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-27T22:53:48Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from the MIT.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d7/ESBS-Strasbourg-Clpp.png" width="220px" height="316px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-clpx.png" width="217px" height="316px"><br />
</center><br />
<br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/ESBS-Strasbourg-PhyB.png" width="192px" height="316px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
<p><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[41]</a></i> </span></p>.<br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[45]</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and Tyszkiewicz</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt and colleges</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/c/c3/ESBS-Strasbourg-Phybdomain.png" width="148px" height="270px" align="left"><br />
<p>&nbsp;</p><br />
<p><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> in a novel background. </span></p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[15],[35]</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/82/ESBS-Strasbourg-ImageProteinfinal%2B.png" width="239px" height="168px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></p><br />
<br />
<br />
<br><br><br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[34]</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker et al.</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and colleges</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/87/ESBS-Strasbourg-System.png" width="192px" height="317px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">"Engineering synthetic adaptors and substrates for controlled ClpXP degradation" from Tanja Baker and collegues (2009).</a></i></span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br> <br />
<br><br><br />
<br><br><br />
In this work Baker et al. probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[15]</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the DAS-degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but it remains inactive until light-induction. However, it is expected to stay active for the background of naturally SsrA-tagged proteins, creating no interference with the natural occurring proteins of E.coli.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in a ClpX-deficient E. Coli strain.<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[14]</a></i>.<br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-27T22:53:19Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from the MIT.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d7/ESBS-Strasbourg-Clpp.png" width="220px" height="316px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-clpx.png" width="217px" height="316px"><br />
</center><br />
<br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/ESBS-Strasbourg-PhyB.png" width="192px" height="316px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
<p><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[41]</a></i> </span></p>.<br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[45]</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and Tyszkiewicz</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt and colleges</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/c/c3/ESBS-Strasbourg-Phybdomain.png" width="148px" height="270px" align="left"><br />
<p>&nbsp;</p><br />
<p><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> in a novel background. </span></p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[15],[35]</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/82/ESBS-Strasbourg-ImageProteinfinal%2B.png" width="239px" height="168px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></p><br />
<br />
<br />
<br><br><br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[34]</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker et al.</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and colleges</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/87/ESBS-Strasbourg-System.png" width="192px" height="317px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">"Engineering synthetic adaptors and substrates for controlled ClpXP degradation" from Tanja Baker and collegues (2009).</a></i></span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br> <br />
<br><br><br />
<br><br><br />
In this work Baker et al. probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[15]</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the DAS-degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but it remains inactive until light-induction. However, it is expected to stay active for the background of naturally SsrA-tagged proteins, creating no interference with the natural occurring proteins of E.coli.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in a ClpX-deficient E. Coli strain.<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli.<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[14]</a></i><br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-27T22:47:20Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from the MIT.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d7/ESBS-Strasbourg-Clpp.png" width="220px" height="316px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-clpx.png" width="217px" height="316px"><br />
</center><br />
<br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/ESBS-Strasbourg-PhyB.png" width="192px" height="316px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
<p><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[41]</a></i> </span></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[45]</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and Tyszkiewicz</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt and colleges</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/c/c3/ESBS-Strasbourg-Phybdomain.png" width="148px" height="270px" align="left"><br />
<p>&nbsp;</p><br />
<p><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt et al.</a></i> in a novel background. </span></p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[15],[35]</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/82/ESBS-Strasbourg-ImageProteinfinal%2B.png" width="239px" height="168px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></p><br />
<br />
<br />
<br><br><br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[34]</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker et al.</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and colleges</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/87/ESBS-Strasbourg-System.png" width="192px" height="317px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">"Engineering synthetic adaptors and substrates for controlled ClpXP degradation" from Tanja Baker and collegues (2009).</a></i></span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br> <br />
<br><br><br />
<br><br><br />
In this work Baker et al. probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[14]</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the DAS-degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but it remains inactive until light-induction. However, it is expected to stay active for the background of naturally SsrA-tagged proteins, creating no interference with the natural occurring proteins of E.coli.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in a ClpX-deficient E. Coli strain.<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli.<br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-27T22:38:25Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from the MIT.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d7/ESBS-Strasbourg-Clpp.png" width="220px" height="316px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-clpx.png" width="217px" height="316px"><br />
</center><br />
<br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[7]</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/ESBS-Strasbourg-PhyB.png" width="192px" height="316px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
<p><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[41]</a></i> </span></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[45]</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[1]</a></i>. Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[30]</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and Tyszkiewicz</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Voigt and colleges</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[42]</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/c/c3/ESBS-Strasbourg-Phybdomain.png" width="148px" height="270px" align="left"><br />
<p>&nbsp;</p><br />
<p><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[42]</a></i> in a novel background. </span></p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[15]</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/82/ESBS-Strasbourg-ImageProteinfinal%2B.png" width="239px" height="168px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></p><br />
<br />
<br />
<br><br><br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[34]</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/87/ESBS-Strasbourg-System.png" width="192px" height="317px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[2]</a></i></span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br> <br />
<br><br><br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[14]</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the DAS-degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but it remains inactive until light-induction. However, it is expected to stay active for the background of naturally SsrA-tagged proteins, creating no interference with the natural occurring proteins of E.coli.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in a ClpX-deficient E. Coli strain.<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-27T22:29:15Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<div class="heading"><br />
</div><br />
<div class="desc"><br />
<div class="heading">Synthetic Photoreceptors:</div><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes.<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i>.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i>.<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The pivotal reason for its great success is its generic nature that affords non-invasive and reversible control over neural processes with high spatiotemporal resolution <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i>. The new generation of recently engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; these wavelengths are well tolerated by biological systems and have a good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for these artificially designed systems based on the implementation of naturally occurring light-sensitive domains <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[28],[32],[35],[42]</a></i> or the use of semi-synthetic photoactive allosteric modulators <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[9],[16]</a></i>.<br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Engineered photoreceptors can be genetically encoded and expressed in the desired locationcan which leads to a broad range of applications in biological processes in vivo. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Levskaya et. al</a></i> demonstrated an application of such a tool to visualize cell shape at a high resolution <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[42]</a></i>.<br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i>. This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-27T22:27:22Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<div class="heading"><br />
</div><br />
<div class="desc"><br />
<div class="heading">Synthetic Photoreceptors:</div><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes.<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a>.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a>.<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The pivotal reason for its great success is its generic nature that affords non-invasive and reversible control over neural processes with high spatiotemporal resolution <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a>. The new generation of recently engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; these wavelengths are well tolerated by biological systems and have a good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for these artificially designed systems based on the implementation of naturally occurring light-sensitive domains <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[28],[32],[35],[42]</a> or the use of semi-synthetic photoactive allosteric modulators <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[9],[16]</a>.<br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Engineered photoreceptors can be genetically encoded and expressed in the desired locationcan which leads to a broad range of applications in biological processes in vivo. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Levskaya et. al</a></i> demonstrated an application of such a tool to visualize cell shape at a high resolution <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[42]</a></i>.<br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i>. This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-27T22:25:06Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<div class="heading"><br />
</div><br />
<div class="desc"><br />
<div class="heading">Synthetic Photoreceptors:</div><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes.<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a>.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a>.<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The pivotal reason for its great success is its generic nature that affords non-invasive and reversible control over neural processes with high spatiotemporal resolution<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a>. The new generation of recently engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; these wavelengths are well tolerated by biological systems and have a good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for these artificially designed systems based on the implementation of naturally occurring light-sensitive domains <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[28],[32],[35],[42]</a>. or the use of semi-synthetic photoactive allosteric modulators[9],[16]. <br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Engineered photoreceptors can be genetically encoded and expressed in the desired locationcan which leads to a broad range of applications in biological processes in vivo. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Levskaya et. al </a></i>demonstrated an application of such a tool to visualize cell shape at a high resolution.<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[42]</a></i><br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module.<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i> This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-27T22:08:31Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<div class="heading"><br />
</div><br />
<div class="desc"><br />
<div class="heading">Synthetic Photoreceptors:</div><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes.<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light.<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i>.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i>.<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The pivotal reason for its great success is its generic nature that affords non-invasive and reversible control over neural processes with high spatiotemporal resolution.[24] The new generation of recently engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; these wavelengths are well tolerated by biological systems and have a good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for these artificially designed systems based on the implementation of naturally occurring light-sensitive domain or the use of semi-synthetic photoactive allosteric modulators. <br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Engineered photoreceptors can be genetically encoded and expressed in the desired locationcan which leads to a broad range of applications in biological processes in vivo. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Levskaya et. al </a></i>demonstrated an application of such a tool to visualize cell shape at a high resolution.<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[42]</a></i><br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module.<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">[24]</a></i> This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ReferenceTeam:ESBS-Strasbourg/Project/Reference2010-10-27T21:38:08Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br />
<div class="heading">References</div><br />
<div class="desc"><br />
<br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">References</div><br />
<br><br />
<ul><br />
<font><br />
<li><p ALIGN="LEFT"><br />
[1] Bae, G., G. Choi </span><br />
<span>(2009).&quot;Decoding of light signals by plant phytochromes and their interacting proteins.&quot; <u>Annu Rev Plant Biol </u><b>59</b>:281-311.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[2] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2009).&quot;Engineering synthetic adaptors and substrates for controlled ClpXP <br />
degradation.&quot; <u>J Biol Chem </u><b>284</b>(33): 21848-55.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[3] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2009). <br />
&quot;Structures of asymmetric ClpX hexamers reveal nucleotide-dependent motions in a <br />
AAA+ protein-unfolding machine.&quot; <u>Cell</u> <b>139</b>(4): 744-56.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[4] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2010). <br />
&quot;Control of substrate gating and translocation into ClpP by channel residues and <br />
ClpX binding.&quot; <u>J Mol Biol</u> <b>399</b>(5): 707-18.</span></p></li><br />
<li><p ALIGN="LEFT">[5] Baker, <br />
T. A., R. T. Sauer, et al. (2005). &quot;Versatile modes of peptide recognition by <br />
the AAA+ adaptor protein SspB.&quot; <u>Nat Struct Mol Biol</u> <b>12</b>(6): 520-5.</span></p></li><br />
<li><p ALIGN="LEFT">[6] Baker, <br />
T. A., R. T. Sauer, et al. (2005). &quot;Rebuilt AAA + motors reveal operating <br />
principles for ATP-fuelled machines.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>437</b>(7062): 1115-20.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[7] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2006). <br />
&quot;Engineering controllable protein degradation.&quot; <u>Mol Cell</u> <b>22</b>(5): <br />
701-7.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[8] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2007). <br />
&quot;Altered tethering of the SspB adaptor to the ClpXP protease causes changes in <br />
substrate delivery.&quot; <u>J Biol Chem</u> <b>282</b>(15): 11465-73.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[9] Deisseroth, K., F. Zhang, et al. </span><br />
<span>(2006). <br />
&quot;Channelrhodopsin-2 and optical control of excitable cells.&quot; <u>Nat Methods</u><br />
<b>3</b>(10): 785-92.</span></p></li><br />
<li><p ALIGN="LEFT">[10] <br />
Fussenegger, M., M. Tigges, et al. (2009). &quot;A tunable synthetic mammalian <br />
oscillator.&quot; <u>Nature</u> <b>457</b>(7227): 309-12.</span></p></li><br />
<li><p ALIGN="LEFT">[11] <br />
Goldberg, A. L. (2003). &quot;Protein degradation and protection against misfolded or <br />
damaged proteins.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>426</b>(6968): 895-9.</span></p></li><br />
<li><p ALIGN="LEFT">[12] <br />
Gregersen, N., C. B. Pedersen, et al.(2003). &quot;Misfolding, degradation, and aggregation of variant proteins. The molecular pathogenesis of short chain acyl-CoA dehydrogenase (SCAD) deficiency.&quot; <u>J Biol Chem</u> <b>278</b>(48): 47449-58.</span></p></li><br />
<li><p ALIGN="LEFT">[13] <br />
Grossman, A. D. and K. L. Griffith (2008). &quot;Inducible protein degradation in <br />
Bacillus subtilis using heterologous peptide tags and adaptor proteins to target <br />
substrates to the protease ClpXP.&quot; <u>Mol Microbiol</u> <b>70</b>(4): 1012-25.</span></p></li><br />
<li><p ALIGN="LEFT">[14] <br />
Houry, W. A., U. A. Wojtyra, et al. (2003). &quot;The N-terminal zinc binding domain <br />
of ClpX is a dimerization domain that modulates the chaperone function.&quot; <u>J <br />
Biol Chem</u> <b>278</b>(49): 48981-90.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[15] Hughes, J., F. T. Landgraf, et al. </span><br />
<span>(2001). <br />
&quot;Recombinant holophytochrome in Escherichia coli.&quot; <u>FEBS Lett</u> <b>508</b>(3): <br />
459-62.</span></p></li><br />
<li><p ALIGN="LEFT">[16] <br />
Isacoff, E. Y. and P. Gorostiza (2008). &quot;Optical switches for remote and <br />
noninvasive control of cell signaling.&quot; <u>Science</u> <b>322</b>(5900): 395-9.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[17] Kohchi, T., K. Mukougawa, et al. </span><br />
<span>(2006). <br />
&quot;Metabolic engineering to produce phytochromes with phytochromobilin, <br />
phycocyanobilin, or phycoerythrobilin chromophore in Escherichia coli.&quot; <u>FEBS <br />
Lett</u> <b>580</b>(5): 1333-8.</span></p></li><br />
<li><p ALIGN="LEFT">[18] <br />
Kohchi, T., K. Mukougawa, et al. (2006). &quot;Metabolic engineering to produce <br />
phytochromes with phytochromobilin, phycocyanobilin, or phycoerythrobilin <br />
chromophore in Escherichia coli.&quot; <u>FEBS Lett</u> <b>580</b>(5): 1333-8.</span></p></li><br />
<li><p ALIGN="LEFT">[19] <br />
Lagarias, J. C. and G. A. Gambetta (2001). &quot;Genetic engineering of phytochrome <br />
biosynthesis in bacteria.&quot; <u>Proc Natl Acad Sci U S A</u> <b>98</b>(19): <br />
10566-71.</span></p></li><br />
<li><p ALIGN="LEFT">[20] <br />
Lagarias, J. C., N. C. Rockwell, et al. (2006). &quot;Phytochrome structure and <br />
&nbsp;signaling mechanisms.&quot; </span><u><br />
<span><br />
Annu Rev Plant Biol</span></u><span><br />
<b>57</b>: 837-58.</span></p></li><br />
<li><p ALIGN="LEFT">[21] <br />
Lagarias, J.C., M.T. McDowell (2002). &quot;Analysis and reconstitution of <br />
phytochromes.&quot; <u>Heme, Chlorophyll, and Bilins: Methods and Protocols</u>, <br />
293-309</span></p></li><br />
<li><p ALIGN="LEFT">[22] <br />
Maurizi, M. R., R. Grimaud, et al. (1998). &quot;Enzymatic and structural <br />
similarities between the Escherichia coli ATP-dependent proteases, ClpXP and <br />
ClpAP.&quot; <u>J Biol Chem</u> <b>273</b>(20): 12476-81.</span></p></li><br />
<li><p ALIGN="LEFT">[23] <br />
Millar, A. J., O. Sorokina, et al. (2009). &quot;A switchable light-input, <br />
light-output system modelled and constructed in yeast.&quot; <u>J Biol Eng</u> <b>3</b>: <br />
15.</span></p></li><br />
<li><p ALIGN="LEFT">[24] <br />
Moffat, K. and A. Moglich (2010). &quot;Engineered photoreceptors as novel <br />
optogenetic tools.&quot; <u>Photochem Photobiol Sci</u> <b>9</b>(10): 1286-300.</span></p></li><br />
<li><p ALIGN="LEFT">[25] <br />
Moffat, K., A. Moglich, et al. (2010). &quot;Structure and function of plant photoreceptors.&quot; <u>Annu Rev Plant Biol</u> <b>61</b>: 21-47.</span></p></li><br />
<li><p ALIGN="LEFT">[26] <br />
Moroder, L. and C. Renner (2006). &quot;Azobenzene as conformational switch in model <br />
peptides.&quot; <u>Chembiochem</u> <b>7</b>(6): 868-78.</span></p></li><br />
<li><p ALIGN="LEFT">[27] <br />
Morrison, D. A. and S. Ahlawat (2009). &quot;ClpXP degrades SsrA-tagged proteins in <br />
Streptococcus pneumoniae.&quot; </span><u><br />
<span><br />
J Bacteriol</span></u><span><br />
<b>191</b>(8): 2894-8.</span></p></li><br />
<li><p ALIGN="LEFT">[28] Muir, <br />
T. W. and A. B. Tyszkiewicz (2008). &quot;Activation of protein splicing with light <br />
in yeast.&quot; <u>Nat Methods</u> <b>5</b>(4): 303-5.</span></p></li><br />
<li><p ALIGN="LEFT">[29] <br />
Quail, P. H. (2002). &quot;Phytochrome photosensory signalling networks.&quot; <u>Nat Rev <br />
Mol Cell Biol</u> <b>3</b>(2): 85-93.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[30] Quail, P. H., R. Khanna, et al. </span><br />
<span>(2004). &quot;A <br />
novel molecular recognition motif necessary for targeting photoactivated <br />
phytochrome signaling to specific basic helix-loop-helix transcription factors.&quot;<br />
<u>Plant Cell</u> <b>16</b>(11): 3033-44.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[31] Quail, P. H., E. Schafer, et al. </span><br />
<span>(2006). &quot;Photoactivated <br />
phytochrome induces rapid PIF3 phosphorylation prior to proteasome-mediated <br />
degradation.&quot; </span><u><br />
<span><br />
Mol Cell</span></u><span><br />
<b>23</b>(3): 439-46.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[32] Quail, P. H., S. Shimizu-Sato, et al. </span><br />
<span>(2002). &quot;A <br />
light-switchable gene promoter system.&quot; <u>Nat Biotechnol</u> <b>20</b>(10): <br />
1041-4.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[33] Quail PH., D. Wagner et al. (1996) &quot;Two small spatially distinct regions of phytochrome B are required for efficient signaling rates.&quot; <u>Plant Cell</u> <b>8</b>:859–71.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[34] Park Y., H. Song (2008) &quot;A degradation signal recognition in prokaryotes.&quot; <u>J. Synchrotron Rad</u><b>15</b>:246–249.</span></p></li><br />
<li><p ALIGN="LEFT">[35] <br />
Rosen, M. K., D. W. Leung, et al. (2008). &quot;Genetically encoded photoswitching of <br />
actin assembly through the Cdc42-WASP-Arp2/3 complex pathway.&quot; <u>Proc Natl Acad <br />
Sci U S A</u> <b>105</b>(35): 12797-802.</span></p></li><br />
<li><p ALIGN="LEFT"><span>[36] Schafer, E., T. Kunkel, et <br />
al. </span><br />
<span>(1993). <br />
&quot;In vitro formation of a photoreversible adduct of phycocyanobilin and tobacco <br />
apophytochrome B.&quot; <u>Eur J Biochem</u> <b>215</b>(3): 587-94.</span></p></li><br />
<li><p ALIGN="LEFT"><span>[37] Schaffner, K., C. Hill, et <br />
al. </span><br />
<span>(1994). <br />
&quot;Expression of phytochrome apoprotein from Avena sativa in Escherichia coli and <br />
formation of photoactive chromoproteins by assembly with phycocyanobilin.&quot; <u><br />
Eur J Biochem</u> <b>223</b>(1): 69-77.</span></p></li><br />
<li><p ALIGN="LEFT">[38] <br />
Sejnowski, T. J. and M. U. Gillette (2005). &quot;Physiology. Biological clocks <br />
coordinately keep life on time.&quot; </span><u><br />
<span><br />
Science</span></u><span><br />
<b>309</b>(5738): 1196-8.</span></p></li><br />
<li><p ALIGN="LEFT">[39] <br />
Sharrock, R. A. (2008). &quot;The phytochrome red/far-red photoreceptor superfamily.&quot;<br />
<u>Genome Biol</u> <b>9</b>(8): 230.</span></p></li><br />
<li><p ALIGN="LEFT">[40] Su, <br />
Z., H. Li, et al. (2010). &quot;A protease-based strategy for the controlled release <br />
of therapeutic peptides.&quot; <u>Angew Chem Int Ed Engl</u> <b>49</b>(29): 4930-3.</span></p></li><br />
<li><p ALIGN="LEFT">[41] <br />
Voigt, C. A., A. Levskaya, et al. (2005). &quot;Synthetic biology: engineering <br />
Escherichia coli to see light.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>438</b>(7067): 441-2.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[42] Voigt, C. A., A. Levskaya, et al. </span><br />
<span>(2009). <br />
&quot;Spatiotemporal control of cell signaling using a light-switchable protein <br />
interaction.&quot; <u>Nature</u> <b>461</b>(7266): 997-1001.</span></p></li><br />
<li><p ALIGN="LEFT">[43] <br />
Weaver, D. R. and S. M. Reppert (1997). &quot;Forward genetic approach strikes gold: <br />
cloning of a mammalian clock gene.&quot; </span><u><br />
<span><br />
Cell</span></u><span><br />
<b>89</b>(4): 487-90.</span></p></li><br />
<li><p ALIGN="LEFT">[44]<br />
</span><br />
<span>Weitz, C. J., K. F. <br />
Storch, et al. </span><br />
<span>(2002). <br />
&quot;Extensive and divergent circadian gene expression in liver and heart.&quot; <u><br />
Nature</u> <b>417</b>(6884): 78-83.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[45] Wu SH., JC. Lagarias JC. (2000) &quot;Defining the bilin lyase domain: lessons from the extended phytochrome superfamily.&quot; <u>Biochemistry</u><b>39</b>:13487–95.</span></p></li><br />
<li><p ALIGN="LEFT">[46]<br />
</span><br />
<span>Zuber, P. and Y. <br />
Zhang (2007). </span><br />
<span><br />
&quot;Requirement of the zinc-binding domain of ClpX for Spx proteolysis in Bacillus <br />
subtilis and effects of disulfide stress on ClpXP activity.&quot; </span><u><br />
<span><br />
J Bacteriol</span></u><span><br />
<b>189</b>(21): 7669-80.</span></p></li><br />
</ul><br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ReferenceTeam:ESBS-Strasbourg/Project/Reference2010-10-27T21:32:00Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br />
<div class="heading">References</div><br />
<div class="desc"><br />
<br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">References</div><br />
<br><br />
<ul><br />
<font><br />
<li><p ALIGN="LEFT"><br />
[1] Bae, G., G. Choi </span><br />
<span>(2009).&quot;Decoding of light signals by plant phytochromes and their interacting proteins.&quot; <u>Annu Rev Plant Biol </u><b>59</b>:281-311.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[2] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2009).&quot;Engineering synthetic adaptors and substrates for controlled ClpXP <br />
degradation.&quot; <u>J Biol Chem </u><b>284</b>(33): 21848-55.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[3] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2009). <br />
&quot;Structures of asymmetric ClpX hexamers reveal nucleotide-dependent motions in a <br />
AAA+ protein-unfolding machine.&quot; <u>Cell</u> <b>139</b>(4): 744-56.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[4] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2010). <br />
&quot;Control of substrate gating and translocation into ClpP by channel residues and <br />
ClpX binding.&quot; <u>J Mol Biol</u> <b>399</b>(5): 707-18.</span></p></li><br />
<li><p ALIGN="LEFT">[5] Baker, <br />
T. A., R. T. Sauer, et al. (2005). &quot;Versatile modes of peptide recognition by <br />
the AAA+ adaptor protein SspB.&quot; <u>Nat Struct Mol Biol</u> <b>12</b>(6): 520-5.</span></p></li><br />
<li><p ALIGN="LEFT">[6] Baker, <br />
T. A., R. T. Sauer, et al. (2005). &quot;Rebuilt AAA + motors reveal operating <br />
principles for ATP-fuelled machines.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>437</b>(7062): 1115-20.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[7] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2006). <br />
&quot;Engineering controllable protein degradation.&quot; <u>Mol Cell</u> <b>22</b>(5): <br />
701-7.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[8] Baker, T. A., R. T. Sauer, et al. </span><br />
<span>(2007). <br />
&quot;Altered tethering of the SspB adaptor to the ClpXP protease causes changes in <br />
substrate delivery.&quot; <u>J Biol Chem</u> <b>282</b>(15): 11465-73.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[9] Deisseroth, K., F. Zhang, et al. </span><br />
<span>(2006). <br />
&quot;Channelrhodopsin-2 and optical control of excitable cells.&quot; <u>Nat Methods</u><br />
<b>3</b>(10): 785-92.</span></p></li><br />
<li><p ALIGN="LEFT">[10] <br />
Fussenegger, M., M. Tigges, et al. (2009). &quot;A tunable synthetic mammalian <br />
oscillator.&quot; <u>Nature</u> <b>457</b>(7227): 309-12.</span></p></li><br />
<li><p ALIGN="LEFT">[11] <br />
Goldberg, A. L. (2003). &quot;Protein degradation and protection against misfolded or <br />
damaged proteins.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>426</b>(6968): 895-9.</span></p></li><br />
<span>[12] Gregersen, N., C. B. <br />
Pedersen, et al. </span><br />
<span>(2003). <br />
&quot;Misfolding, degradation, and aggregation of variant proteins. The molecular <br />
pathogenesis of short chain acyl-CoA dehydrogenase (SCAD) deficiency.&quot; <u>J Biol <br />
Chem</u> <b>278</b>(48): 47449-58.</span></p></li><br />
<li><p ALIGN="LEFT">[13] <br />
Grossman, A. D. and K. L. Griffith (2008). &quot;Inducible protein degradation in <br />
Bacillus subtilis using heterologous peptide tags and adaptor proteins to target <br />
substrates to the protease ClpXP.&quot; <u>Mol Microbiol</u> <b>70</b>(4): 1012-25.</span></p></li><br />
<li><p ALIGN="LEFT">[14] <br />
Houry, W. A., U. A. Wojtyra, et al. (2003). &quot;The N-terminal zinc binding domain <br />
of ClpX is a dimerization domain that modulates the chaperone function.&quot; <u>J <br />
Biol Chem</u> <b>278</b>(49): 48981-90.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[15] Hughes, J., F. T. Landgraf, et al. </span><br />
<span>(2001). <br />
&quot;Recombinant holophytochrome in Escherichia coli.&quot; <u>FEBS Lett</u> <b>508</b>(3): <br />
459-62.</span></p></li><br />
<li><p ALIGN="LEFT">[16] <br />
Isacoff, E. Y. and P. Gorostiza (2008). &quot;Optical switches for remote and <br />
noninvasive control of cell signaling.&quot; <u>Science</u> <b>322</b>(5900): 395-9.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[17] Kohchi, T., K. Mukougawa, et al. </span><br />
<span>(2006). <br />
&quot;Metabolic engineering to produce phytochromes with phytochromobilin, <br />
phycocyanobilin, or phycoerythrobilin chromophore in Escherichia coli.&quot; <u>FEBS <br />
Lett</u> <b>580</b>(5): 1333-8.</span></p></li><br />
<li><p ALIGN="LEFT">[18] <br />
Kohchi, T., K. Mukougawa, et al. (2006). &quot;Metabolic engineering to produce <br />
phytochromes with phytochromobilin, phycocyanobilin, or phycoerythrobilin <br />
chromophore in Escherichia coli.&quot; <u>FEBS Lett</u> <b>580</b>(5): 1333-8.</span></p></li><br />
<li><p ALIGN="LEFT">[19] <br />
Lagarias, J. C. and G. A. Gambetta (2001). &quot;Genetic engineering of phytochrome <br />
biosynthesis in bacteria.&quot; <u>Proc Natl Acad Sci U S A</u> <b>98</b>(19): <br />
10566-71.</span></p></li><br />
<li><p ALIGN="LEFT">[20] <br />
Lagarias, J. C., N. C. Rockwell, et al. (2006). &quot;Phytochrome structure and <br />
&nbsp;signaling mechanisms.&quot; </span><u><br />
<span><br />
Annu Rev Plant Biol</span></u><span><br />
<b>57</b>: 837-58.</span></p></li><br />
<li><p ALIGN="LEFT">[21] <br />
Lagarias, J.C., M.T. McDowell (2002). &quot;Analysis and reconstitution of <br />
phytochromes.&quot; <u>Heme, Chlorophyll, and Bilins: Methods and Protocols</u>, <br />
293-309</span></p></li><br />
<li><p ALIGN="LEFT">[22] <br />
Maurizi, M. R., R. Grimaud, et al. (1998). &quot;Enzymatic and structural <br />
similarities between the Escherichia coli ATP-dependent proteases, ClpXP and <br />
ClpAP.&quot; <u>J Biol Chem</u> <b>273</b>(20): 12476-81.</span></p></li><br />
<li><p ALIGN="LEFT">[23] <br />
Millar, A. J., O. Sorokina, et al. (2009). &quot;A switchable light-input, <br />
light-output system modelled and constructed in yeast.&quot; <u>J Biol Eng</u> <b>3</b>: <br />
15.</span></p></li><br />
<li><p ALIGN="LEFT">[24] <br />
Moffat, K. and A. Moglich (2010). &quot;Engineered photoreceptors as novel <br />
optogenetic tools.&quot; <u>Photochem Photobiol Sci</u> <b>9</b>(10): 1286-300.</span></p></li><br />
<span>[25] Moffat, K., A. Moglich, et <br />
al. </span><br />
<span>(2010). <br />
&quot;Structure and function of plant photoreceptors.&quot; <u>Annu Rev Plant Biol</u> <b><br />
61</b>: 21-47.</span></p></li><br />
<li><p ALIGN="LEFT">[26] <br />
Moroder, L. and C. Renner (2006). &quot;Azobenzene as conformational switch in model <br />
peptides.&quot; <u>Chembiochem</u> <b>7</b>(6): 868-78.</span></p></li><br />
<li><p ALIGN="LEFT">[27] <br />
Morrison, D. A. and S. Ahlawat (2009). &quot;ClpXP degrades SsrA-tagged proteins in <br />
Streptococcus pneumoniae.&quot; </span><u><br />
<span><br />
J Bacteriol</span></u><span><br />
<b>191</b>(8): 2894-8.</span></p></li><br />
<li><p ALIGN="LEFT">[28] Muir, <br />
T. W. and A. B. Tyszkiewicz (2008). &quot;Activation of protein splicing with light <br />
in yeast.&quot; <u>Nat Methods</u> <b>5</b>(4): 303-5.</span></p></li><br />
<li><p ALIGN="LEFT">[29] <br />
Quail, P. H. (2002). &quot;Phytochrome photosensory signalling networks.&quot; <u>Nat Rev <br />
Mol Cell Biol</u> <b>3</b>(2): 85-93.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[30] Quail, P. H., R. Khanna, et al. </span><br />
<span>(2004). &quot;A <br />
novel molecular recognition motif necessary for targeting photoactivated <br />
phytochrome signaling to specific basic helix-loop-helix transcription factors.&quot;<br />
<u>Plant Cell</u> <b>16</b>(11): 3033-44.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[31] Quail, P. H., E. Schafer, et al. </span><br />
<span>(2006). &quot;Photoactivated <br />
phytochrome induces rapid PIF3 phosphorylation prior to proteasome-mediated <br />
degradation.&quot; </span><u><br />
<span><br />
Mol Cell</span></u><span><br />
<b>23</b>(3): 439-46.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[32] Quail, P. H., S. Shimizu-Sato, et al. </span><br />
<span>(2002). &quot;A <br />
light-switchable gene promoter system.&quot; <u>Nat Biotechnol</u> <b>20</b>(10): <br />
1041-4.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[33] Quail PH., D. Wagner et al. (1996) &quot;Two small spatially distinct regions of phytochrome B are required for efficient signaling rates.&quot; <u>Plant Cell</u> <b>8</b>:859–71.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[34] Park Y., H. Song (2008) &quot;A degradation signal recognition in prokaryotes.&quot; <u>J. Synchrotron Rad</u><b>15</b>:246–249.</span></p></li><br />
<li><p ALIGN="LEFT">[35] <br />
Rosen, M. K., D. W. Leung, et al. (2008). &quot;Genetically encoded photoswitching of <br />
actin assembly through the Cdc42-WASP-Arp2/3 complex pathway.&quot; <u>Proc Natl Acad <br />
Sci U S A</u> <b>105</b>(35): 12797-802.</span></p></li><br />
<li><p ALIGN="LEFT"><span>[36] Schafer, E., T. Kunkel, et <br />
al. </span><br />
<span>(1993). <br />
&quot;In vitro formation of a photoreversible adduct of phycocyanobilin and tobacco <br />
apophytochrome B.&quot; <u>Eur J Biochem</u> <b>215</b>(3): 587-94.</span></p></li><br />
<li><p ALIGN="LEFT"><span>[37] Schaffner, K., C. Hill, et <br />
al. </span><br />
<span>(1994). <br />
&quot;Expression of phytochrome apoprotein from Avena sativa in Escherichia coli and <br />
formation of photoactive chromoproteins by assembly with phycocyanobilin.&quot; <u><br />
Eur J Biochem</u> <b>223</b>(1): 69-77.</span></p></li><br />
<li><p ALIGN="LEFT">[38] <br />
Sejnowski, T. J. and M. U. Gillette (2005). &quot;Physiology. Biological clocks <br />
coordinately keep life on time.&quot; </span><u><br />
<span><br />
Science</span></u><span><br />
<b>309</b>(5738): 1196-8.</span></p></li><br />
<li><p ALIGN="LEFT">[39] <br />
Sharrock, R. A. (2008). &quot;The phytochrome red/far-red photoreceptor superfamily.&quot;<br />
<u>Genome Biol</u> <b>9</b>(8): 230.</span></p></li><br />
<li><p ALIGN="LEFT">[40] Su, <br />
Z., H. Li, et al. (2010). &quot;A protease-based strategy for the controlled release <br />
of therapeutic peptides.&quot; <u>Angew Chem Int Ed Engl</u> <b>49</b>(29): 4930-3.</span></p></li><br />
<li><p ALIGN="LEFT">[41] <br />
Voigt, C. A., A. Levskaya, et al. (2005). &quot;Synthetic biology: engineering <br />
Escherichia coli to see light.&quot; </span><u><br />
<span><br />
Nature</span></u><span><br />
<b>438</b>(7067): 441-2.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[42] Voigt, C. A., A. Levskaya, et al. </span><br />
<span>(2009). <br />
&quot;Spatiotemporal control of cell signaling using a light-switchable protein <br />
interaction.&quot; <u>Nature</u> <b>461</b>(7266): 997-1001.</span></p></li><br />
<li><p ALIGN="LEFT">[43] <br />
Weaver, D. R. and S. M. Reppert (1997). &quot;Forward genetic approach strikes gold: <br />
cloning of a mammalian clock gene.&quot; </span><u><br />
<span><br />
Cell</span></u><span><br />
<b>89</b>(4): 487-90.</span></p></li><br />
<li><p ALIGN="LEFT">[44]<br />
</span><br />
<span>Weitz, C. J., K. F. <br />
Storch, et al. </span><br />
<span>(2002). <br />
&quot;Extensive and divergent circadian gene expression in liver and heart.&quot; <u><br />
Nature</u> <b>417</b>(6884): 78-83.</span></p></li><br />
<li><p ALIGN="LEFT"><br />
[45] Wu SH., JC. Lagarias JC. (2000) &quot;Defining the bilin lyase domain: lessons from the extended phytochrome superfamily.&quot; <u>Biochemistry</u><b>39</b>:13487–95.</span></p></li><br />
<li><p ALIGN="LEFT">[46]<br />
</span><br />
<span>Zuber, P. and Y. <br />
Zhang (2007). </span><br />
<span><br />
&quot;Requirement of the zinc-binding domain of ClpX for Spx proteolysis in Bacillus <br />
subtilis and effects of disulfide stress on ClpXP activity.&quot; </span><u><br />
<span><br />
J Bacteriol</span></u><span><br />
<b>189</b>(21): 7669-80.</span></p></li><br />
</ul><br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/TeamTeam:ESBS-Strasbourg/Team2010-10-27T18:47:21Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice#safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/f/fa/ESBS-Strasbourg-Blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=65 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">THE TEAM</div><br />
<div class="desc"><br />
<a href="#under"><b>Undergraduates</b></a><br><br />
<ul><br />
<li><a href="#camille">Camille Bernard</a></li><br />
<li><a href="#fabian">Fabian Stiefel</a></li><br />
<li><a href="#georgio">Georgio Kourjian</a></li><br />
<li><a href="#jens">Jens-Sebastian Kalchschmidt</a></li><br />
<li><a href="#morgane">Morgane Griesbeck</a></li><br />
<li><a href="#pierre">Pierre Dillard</a></li><br />
<li><a href="#raphael">Raphaël Doineau</a></li><br />
<li><a href="#renaud">Renaud Renault</a></li><br />
<li><a href="#sebastien">Sebastien Pigeot</a></li><br />
<li><a href="#thea">Thea Ziegler</a></li><br />
<li><a href="#yohann">Yohann Lacotte</a></li><br />
<li><a href="#yves">Yves Gendrault</a></li><br />
</ul><br />
<br><br />
<a href="#advisors"><b>Advisors</b></a><br><br />
<ul><br />
<li><a href="#jacques">Pr. Jacques Haiech</a></li><br />
</ul><br />
<br><br />
<a href="#instructors"><b>Instructors</b></a><br><br />
<ul><br />
<li><a href="#maria">Dr. Maria Zeniou</a></li><br />
<li><a href="#christophe">Pr. Christophe Lallement</a></li><br />
<li><a href="#morgan">Dr. Morgan Madec</a></li><br />
</ul><br />
<br><br />
<br />
<a href="#uni"><b>Our Universities</b></a><br><br />
<ul><br />
<li><a href="#bs">ESBS - Biotech School</a></li><br />
<li><a href="#uni">University of Strasbourg</a></li><br />
</ul><br />
<br><br />
<a href="#collaboration"><b>Collaboration</b></a><br><br />
<br><br />
<br />
<br />
<br />
</td><br />
<td width="10" rowspan=65 bgcolor="#800000"><br />
</div><br />
<br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" height="420"><br />
<div class="heading"><br />
OUR TEAM<br />
</div><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/8/81/ESBS_Strasboug_wiki.JPG" width="500" height="375"><br />
</center><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#800000" height="10"><br />
</td><br />
</tr><br />
<br />
<div id="windowbox" style="position:fixed; top:50%; left:20px; width:11%;"><br />
<span style="color:ivory;"><br />
&nbsp;&nbsp;<br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/science"><br />
<img border="0" src="https://static.igem.org/mediawiki/2010/d/da/ESBS-Strasbourg-Clpx.gif" width="70" height="85" ></a><br />
<br><br />
Let me guide you</span><br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="under"></a><br />
<div class="heading"><br />
UNDERGRADUATES<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="camille"></a><br />
Camille Bernard<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/3/3d/Bernard_Camille.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Camille has begun her cursus by studying chemistry, physics and mathematics in Classe Prépa. Then she decided to enter in a biotechnology school (ESBS) in Strasbourg because she was keen to learn how the living works. She was interested in taking part of this experience insofar as it is a chance to lead a project since the beginning, from the idea to the culmination. Furthermore it was the opportunity to work with a motivated team and to test our limits. Besides, Camille loves Morgane’s cake; it is the best ATP source in the world!!<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="fabian"></a><br />
Fabian Stiefel<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Stiefel_Fabian.jpg" <br />
height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Fabian is now in the ninth semester and so at his last year as student at the Ecole supérieure de Biotechnology de Strasbourg (ESBS). Before he entered the ESBS he studied two years of chemistry at the University of Freiburg, Germany. The idea of trilingual courses in four Universities in three different countries was and is very thrilling to him. He is very fond of synthetic biology and he wants to continue in this domain of research for his diploma/ master thesis. He finds it also very exciting to work with a highly motivated team on a self chosen project for the summer.<br />
<br />
<br>Three weeks before the jamboree he had discovered a great new game - the blender animation program. Since then, when he haves time, he unleashes his new skills on the innocent ClpXP protease and his friends, stretching and bending them into models and pictures and forcing them to move.<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="georgio"></a><br />
Georgio Kourjian<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/3/31/Kourjian_Georgio.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Georgio joined the Ecole supérieure de Biotechnology de Strasbourg (ESBS) after he got his B.Sc degree in Biochemistry at the University of the Mediterranean in Marseille France. Currently he is in the last year of the master’s program in this trinational Biotechnology school. He was interested about synthetic biology and the idea of designing and building new biological functions and systems not found in nature that is why he joined the ESBS iGEM team. He thinks that participating at the iGEM competition is a very enriching experience.<br />
<br><br />
For him diploma thesis a part of his work will be the use of synthetic biology for medical purposes.<br />
<br><br />
He was mainly responsible of the wiki creation.<br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="jens"></a><br />
Jens-Sebastian Kalchschmidt<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/d/d8/Kalchschmidt_Jens_Sebastian.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Jens is in his last year as student at the Ecole supérieure de Biotechnology de Strasbourg (ESBS). Before he enrolled in the ESBS he studied 2 years molecular biotechnology at the University of Heidelberg, Germany. He decided to take the chance to continue his biotechnology studies within the trilingual study course biotechnology at the ESBS implicating four universities in three countries. In retrospect, he must say that it was absolutely the right choice and the first long-term contact with the international research community. His research interests focus mostly on immunology and infectious diseases, but the iGEM participation sparked his interest in synthetic biology.<br />
<br />
<p>Personal remark: Marathon preparation can be best done during incubation times.</p><br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="morgane"></a><br />
Morgane Griesbeck<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/0/04/Griesbeck_Morgane.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Morgane did her cursus in the so-called « classes préparatoires » where she studied Mathematics, Physcis and Chemistry. She chose then to study Biotechnology, choice she has never regretted. She was very interested in the experience provided by conducting a project from scratch. She was especially attracted by the interdisciplinary aspect of synthetic biology and the juncture of biology and engineering. Besides, Morgane loves chocolate and did amazing chocolate cakes called « Indémoulable de Jean-François ». </div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="pierre"></a><br />
Pierre Dillard<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Dillard_Pierre.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Pierre is currently in his ninth semester at the ESBS. Previously he has done two years in CPGE BCPST where he received a good education in mathematics, physics, chemistry and biology. In the ESBS he specialized himself in synthetic biology because he think that this field can be the future of the biology. iGEM was a seducing project for him because of the intellectual challenge and the team work. To see the evolves of the project all summer long was very grateful. He enjoys also all the new skills acquired during this work.<br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="raphael"></a><br />
Raphaël Doineau<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b1/Doineau_Raphael.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Raphael is just like the other in his ninth semester at the ESBS. Originally from a math physics and chemistry curriculum he chose the ESBS for his international orientation and the synthetic biology approach of biotechnology. In order to obtain further biological background knowledge and skills, he decided to interrupt his curriculum to perform two six months internships in two different labs before continuing ESBS and joining the iGEM team.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="renaud"></a><br />
Renaud Renault<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/e/ef/Renault_Renaud-glow.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Also known as Reno carré (Reno square) he tends to be famous for his experiments on the lack of sleep on himself. As some of his fellows, he is in the third year of ESBS, after having intensively studied Maths, Physics, Biology, Chemistry, and even more for 2 years in Classe Prépa. Since that time, he has been a MATLAB freak, coding some cool stuff you can see on his youtube channel (for instance <a href="http://www.youtube.com/watch?v=vm0qQlzh0hw">http://www.youtube.com/watch?v=vm0qQlzh0hw</a>) and earns his living (sushis are quite expensive) by doing clinical trials. He got interested in Synthetic Biology quite early, and more especially with the iGEM competition. He originally got the idea of engineering a controllable protease which was the basis of our project and is really glad that others were as excited and motivated about it as him.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="sebastien"></a><br />
Sebastien Pigeot<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/Pigeot_Sebastien.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Sébastien decided to study biology after obtaining his A level. He studied for two years in a special school combining half practical courses and half theoretical courses. After completing those two years he decided to travel and did a Bachelor in Science at the Heriot Watt University, Edinburgh. Finally, he returned to France to Strasbourg and joined the ESBS (Ecole Supérieure de Biotechnologie de Strasbourg). He discovered a tri-national school with a great atmosphere and he is really enjoying it. He decided to take part to the igem competition with some of his friends because it is a very challenging competition and he was attracted by the fact to be autonomous toward the reflection and the manipulations. So far he has not been deceived in his expectations.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="thea"></a><br />
Thea Ziegler<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/0/07/Thea_Ziegler.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Thea started her studies at the Humboldt University Berlin with the Bachelor program of Biophysics. As the trinational conception and organization of the ESBS captivated her, she left the German capital after finishing the 4th semester and went to Strasbourg to continue with the diploma course in Biotechnology. In the current last year of her studies she decided to specialize in Synthetic Biology and to take part of the iGEM competition. Behind the basic idea of iGEM she was attracted by the opportunity to work independently without limitations in creativity. She is very satisfied with the theme her team chose, the role and functioning of photoreceptors fascinate her since the early beginning of her studies. In the future she wants to continue within this field.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="yohann"></a><br />
Yohann Lacotte<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a1/Lacotte_Yohann.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Yohann had pretty much the same curriculum than his copartners coming from "Classe Prépa". He is particularly interested in neurophysiology, biophysics and of course, synthetic biology.<br><br />
He likes to go to movie theatre, draw some manga and sing in the shower, but not at the same time natürlich. Although he really enjoys watching some cartoons on TV before his daily nap, he can also be a brutal extrem lab worker all day AND night long. Unfortunately for us, his good mood is proportional to the success rate of his experiments, but once he decided to succeed, he can manage the impossible. Within iGEM, he thus can be seen as the man of the situation, as far as clearing the hurdles is concerned.<br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="yves"></a><br />
Yves Gendrault<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b0/Gendrault_Yves.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
After obtaining his bachelor's degree in Electronique, Signaux et Automatique (ESA), Yves does a Master’s degree in Micro-and Nano-Electronique (MNE) at the Université de Strasbourg (UdS). He discovers the field of Synthetic Biology during an internship in the Institut d'Electronique du Solide et des Systèmes (InESS) laboratory in Strasbourg. During this internship he creates models for several biological processes. Because Synthetic Biology is situated between engineer sciences and biotechnologies, the collaboration with biotechnologists is for him fundamental for a better understanding. He thinks that the iGEM competition is a very interesting experience of this kind of collaboration in an international team.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"></td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="advisors"></a><br />
<div class="heading"><br />
ADVISORS<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="jacques"></a><br />
<div class="name"><br />
Pr. Jacques Haiech<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/Haiech.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Jacques Haiech got a M.D. degree in Mathematics and computer science in 1975 and then a M.D. and a PhD degree in Biochemistry in 1978 dealing with cell signaling (focusing on calcium signal in muscle cells). After his PhD, he has been working part time successively at NCI in Bethesda, then at Vanderbilt University and finally at Northwestern University (Chicago) while being research director at Centre National de la Recherche Scientifique in France, studiyng cellular calcium signals before joining the Strasbourg University as a full professor in 1997. He has founded the first synthetic biology option in an engineering school in France in 2008 along with the first participation of the ESBS-Team to the iGEM competition. Since then, he has developed collaboration with the Strasbourg engineering school of physics on “Design Methodology and Modeling of Synthetic Biosystems”. He is now working in integrating concepts of synthetic biology in personalized medicine.<br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"></td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="instructors"></a><br />
<div class="heading"><br />
INSTRUCTORS<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="maria"></a><br />
<div class="name"><br />
Dr. Maria Zeniou<br />
</div><br />
<div class="profiles"><br />
<img src="http://medchem.u-strasbg.fr/pages/permanents/photos/zeniou.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Maria Zeniou graduated as a molecular biologist in 2002. Her PhD project included genetic studies of an X-linked inherited disorder and functional studies on the protein kinase whose loss of function leads to this disease.<br />
After her PhD, she performed a four-year post-doc in molecular and cellular biology. Within this period, she studied the roles and the regulation of lipid modifying enzymes during the process of regulated hormone exocytosis from neuroendocrine cells.<br />
In 2007, she joined the Strasbourg University as an assistant professor and since 2008 she participates to the iGEM teams of the Ecole Supérieure de Biotechnology de Strasbourg (ESBS) as an instructor. The aim of her current research project is to better understand the physiopathology of gliomas.<br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="christophe"></a><br />
<div class="name"><br />
Pr. Christophe Lallement<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/Lallement_Christophe.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Christophe Lallement received the M.S. degree in engineering from the Science University of Nancy I, Nancy, France, and the Ph.D. degree in engineering from the École Nationale Supérieure des Télecommunications, Paris, France. From November 1994 to September 1997, he was a Postdoctoral Research Scientist with the Laboratory of Electronics, Swiss Federal Institute of Technology in Lausanne (EPFL), Lausanne, Switzerland, working on the characterization and modeling of the metal-oxide-semiconductor field effect transistor (MOSFET) in the development team of the Enz-Krummenacher-Vittoz MOSFET model. In September 1997, he was an Associate Professor with the Université de Strasbourg (UdS), Strasbourg, France, and the Laboratory for Physics and Applications of Semiconductors, Centre National de la Recherche Scientifique. Since September 2003, he has been a Professor with the École Nationale Supérieure de Physique de Strasbourg, Illkirch, France. He is currently with the Institut d’Électronique du Solide et des Systèmes (InESS), UdS, working on the study and the modeling of advanced devices, very-high-speed integrated-circuit hardware description language analog and mixed-signal systems, and biosynthetic systems. He is the responsible for the group “Integrated Instrumental Systems” at InESS.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="morgan"></a><br />
<div class="name"><br />
Dr. Morgan Madec<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/Madec_Morgan.jpg" height="200" width="150"><br />
</div><br />
<br />
<div class="desc"><br />
Morgan Madec was born in 1980. He received the M.S. and Ph.D. degrees in microelectronics from the University Louis Pasteur (ULP), Strasbourg, France, in 2003 and 2006 respectively. From 2003 to 2006, he was with the Laboratoire de Physique et Application des Semi-Conducteurs (PHASE), ULP Centre National de Recherches Scientifiques, Strasbourg, where he prepared a Ph.D. thesis on the design, the simulation and the characterization of optical processors in order to speed up image reconstruction in the medical field.<br />
<br><br />
He is currently a Professor Associate with the Institut d’Électronique du Solide et des Systèmes, Université de Strasbourg, Strasbourg and teaches electronics in the Ecole Nationale Supérieure de Physique de Strasbourg, University of Strasbourg. <br />
<br><br />
His research interests include compact modeling of integrated microsensors (Hall-effect sensor, photodiode ...). <br />
Since 2008, he collaborates with a team of the Laboratoire d’Innovation Therapeutique. The aim of this work is to put the experience in microelectronics system design to good use in synthetic biology.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="bs"></a><br />
<div class="heading"><br />
ESBS - Biotech School<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<br><br />
<img src="http://irebs.u-strasbg.fr/IMG/jpg/PanoESBS2008-2.jpg"><br />
</center><br />
<br><br />
<p><b>ESBS - Ecole Superieure de Biotechnologie de Strasbourg</b></p><br />
The three-year curriculum in Biotechnology is organized by the “Upper Rhine Universities” in Freiburg, Basel, Karlsruhe and Strasbourg. Students from France, Germany and Switzerland receive an interdisciplinary and intensive, trilingual education in biotechnology.<br />
<br />
Most of the lectures take place at the École Supérieure de Biotechnologie de Strasbourg (ESBS) in Strasbourg. Intensive laboratory courses and internships are offered by the universities Basel, Freiburg and Karlsruhe.The languages for lectures and exams are French, German and English.<br />
<br />
Students for this program are selected after successful completion of two years of undergraduate education in sciences or engineering at a university or an equivalent institution.The degree obtained in this program is completed within 6 semesters. Each of the four partner universities is responsible for part of the program, according to their special strengths in research, resulting in a diverse program covering a wide spectrum of current research. All aspects of biotechnology are covered, from molecular biology to microbiology, bioprocess engineering and biocomputing. Lectures in patent law, economics and professional language courses complete the program. In the third year, students can focus on specialized areas, such as bioproduction or bioinformatics.<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"><br />
</td><br />
</tr><br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="uni"></a><br />
<div class="heading"><br />
THE UNIVERSITY OF STRASBOURG<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<br><br />
<img src="http://www.observatoiredessubventions.com/wp-content/uploads/universite-Strasbourg-subventions-aides.JPG"><br />
</center><br />
<br><br />
European by nature and international by design, the University's strengths and assets stem from its active involvement in virtually every discipline comprising the current body of knowledge.<br />
As a young university founded on an age-old tradition, it strives to attain cross-disciplinarity so that this mixing fosters new research opportunities and produces courses that meet society's need. The international dimension is fundamental for the University of Strasbourg and thanks to the world wide reputation of its research teams, built on excellence and efficiency, it emerges among Europe's foremost research universities. Each of the University's main academic fields of instruction is based upon research sections that are the driving force of the institution, with over 2,600 professors and 2,000 staff.<br />
The Technology Transfer Office, one of the very first developed in a French university, strives to promote the work of the researchers and facilitate partnerships with economic and institutional stakeholders.<br />
An essential player in the promotion of scientific and technical culture, the University interfaces with its host city, Strasbourg.<br />
<br />
Solidly anchored in the European Higher Education Area, the University of Strasbourg, a beating heart of the Alsatian metropolis with its 41,000 students, has the potential to face the challenging international competition.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"><br />
</td><br />
</tr><br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="collaboration"></a><br />
<div class="heading"><br />
Collaboration<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<br><br><br />
<br />
<center><br />
<div><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="420" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5516756369958846513%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJrAlpPV3cnrMg%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div><br />
</center><br />
<br><br />
<br />
We set up a collaboration with the iGEM 2010 <a href="https://2010.igem.org/Team:Freiburg_Bioware">Team Freiburg_Bioware</a>, they provided us with the YFP and CFP assembled biobricks cloned into standard pSB1C3 backbone.<br />
<br><br><br />
We visited the Freiburg Team at their lab. Both teams made a presentation of their project and gave some ideas and impressions about the project and iGEM in general.<br />
<br><br><br />
After the serious part, we enjoyed together a nice barbecue on the roof of the University of Freiburg.<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
<br />
</td><br />
</tr><br />
</table><br />
</body><br />
<br />
</p></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Results/BiobricksTeam:ESBS-Strasbourg/Results/Biobricks2010-10-27T15:07:49Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=40 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Biobricks</div><br />
<div class="desc"><br />
<br><br><br />
<ul><br />
<br />
<li><a href="#PIF3">PIF3</a></li><br />
<li><a href="#PIF6">PIF6</a></li><br />
<li><a href="#PHYB908">PHY B 900</a></li><br />
<li><a href="#PHYB642">PHY B 650</a></li><br />
<li><a href="#NCLPX">∆N-ClpX</a></li><br />
<li><a href="#Linker">linker</a></li><br />
<li><a href="#LAA">LAA Tag</a></li><br />
<li><a href="#DAS">DAS Tag</a></li><br />
<li><a href="#Lambda">Lambda Tag</a></li><br />
<li><a href="#GFP">GFP (super fold)</a></li><br />
<li><a href="#PHYB642-CLPX3">PhyB642-(linker-∆NClpX)3</a></li><br />
<li><a href="#PHYB908-CLPX3">PhyB908-(linker-∆NClpX)3</a></li><br />
<li><a href="#CLPX">Full-length ClpX</a></li><br />
<li><a href="#NCLPX-L">∆NClpX-linker-∆NClpX-linker-∆NClpX</a></li><br />
<li><a href="#L-NCLPX">(linker-∆NClpX)3</a></li><br />
<br><br />
<br />
</ul><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly">Our Biobrick Assembly Technique</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=40 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Parts Submitted to Registry</div><br />
<br><br />
<br />
<br />
<br />
<br><br />
&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/3/3a/ESBS-Strasbourg-ClpXPSystem.jpg" width="400px" height="241px" border="0"><br />
&nbsp;&nbsp;&nbsp;<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="300px" height="182px" border="0"><br />
<br />
<br />
<br><br />
<br><br />
<br />
<center><br />
<br />
<table border="1" width="100%" bordercolorlight="#FFFFFF" bordercolordark="#222222" bordercolor="#FFFFFF"><br />
<tr><br />
<td width="165" bgcolor="#800000"><b><font size="4" color="#FFFFFF">Part <br />
Number:</font></b></td><br />
<td width="302" bgcolor="#800000"><b><font size="4" color="#FFFFFF">Part <br />
Name:</font></b></td><br />
<td width="223" bgcolor="#800000"><b><font size="4" color="#FFFFFF"><br />
Plasmid/Resistance</font></b></td><br />
<td width="187" bgcolor="#800000"><b><font size="4" color="#FFFFFF"><br />
Status</font></b></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365000"><br />
<font color="#000000">BBa_K365000</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PIF3">Phytochrome Interacting Factor-3 <br />
(PIF3)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365001"><br />
<font color="#000000">BBa_K365001</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PIF6">Phytochrome Interacting Factor-6 <br />
(PIF6)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365002"><br />
<font color="#000000">BBa_K365002</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB908">Phytochrome B (aa 1-908)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365003"><br />
<font color="#000000">BBa_K365003</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB642">Phytochrome B (aa 1-642)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365004"><br />
<font color="#000000">BBa_K365004</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#NCLPX">&#8710;N-ClpX (aa 61-425)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365005"><br />
<font color="#000000">BBa_K365005</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#Linker">Linker (aa 20)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365006"><br />
<font color="#000000">BBa_K365006</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#LAA">LAA tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365007"><br />
<font color="#000000">BBa_K365007</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#DAS">DAS tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365008"><br />
<font color="#000000">BBa_K365008</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#Lambda">Lambda tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365009"><br />
<font color="#000000">BBa_K365009</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#GFP">GFP (super fold)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365010"><br />
<font color="#000000">BBa_K365010</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB642-CLPX3">PhyB642-(linker-&#8710;NClpX)3</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365011"><br />
<font color="#000000">BBa_K365011</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB908-CLPX3">PhyB908-(linker-&#8710;NClpX)3 </font><br />
</td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365012"><br />
<font color="#000000">BBa_K365012</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#CLPX">Full-length ClpX</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365013"><br />
<font color="#000000">BBa_K365013</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#NCLPX-L">&#8710;NClpX-linker-&#8710;NClpX-linker-&#8710;NClpX</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365014"><br />
<font color="#000000">BBa_K365014</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="L-NCLPX">(linker-&#8710;NClpX)3 </font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
</table><br />
<br />
</center><br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<div id="windowbox" style="position:fixed; top:50%; right:3px; width:11%;"><br />
Colored restriction sites :<br><br />
<b><font color="#FF0000">EcoRI </font><font color="#C0C0C0">NotI </font><font color="#008000">XbaI </font><br />
<font color="#008080">NgoMIV</font><br><br />
<font color="#FF00FF">AgeI </font><font color="#FF6600">SpeI </font><font color="#C0C0C0">NotI </font><font color="#1F497D">PstI </font></b><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB908"></a><br />
Phytochrome B (aa 1-908) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365002"><font color="#E9AF03">BBa_K365002</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>. The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm). <br />
<br><br><br />
The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it will be fused to the N-teminal of the ClpX-trimer.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
In in-vivo applications it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt (2009)</a></i> demonstrated by assaying PIF6 (which has the strongest interactions of all previously reported PIF domains) against different variants of PhyB that the tandem C-terminal PAS domains (residues 1-908)of plant phytochromes are necessary to confer rapid photoreversibility under infrared light.<br />
The original sequence contains a SpeI restriction within the first 908 residues.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-PhyB900.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
The plasmid containing the PhyB-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.<br />
<br><br> <br />
<b>Forward primer (5’->3’): (41bp)</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctag</span>ATGGTTTCCGGAGTC<br />
<br><br><br />
<b>Reverse primer (5’->3’): (52 bp)</b><br />
<br><br />
CAGCTG<u><span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span></u><b>t</b><u><span style="color: #F79646">actagt</span></u><b>atta</b><u><span style="color: #CC00FF">accggt</span></u>GCTCGGGATTTGCAAG<br />
<br><br><br />
In order to get a sequence without an internal restriction sites of one of the BioBrick standards the SpeI-restriction site was altered without changing the encoded amino acid (ACT=Threonine (AC(T,A,G,C)).<br />
<br><br><br />
<b>Primers for Pfu-mutagenese: </b><br />
<br><br />
<b>Forward primer (5’->3’): (28 bp)</b><br />
<br><br />
GGACAAGACGTT<span style="background: black">AC</span><span style="background: red">G</span><span style="background: black">AGT</span>CAGAAAATCG<br />
<br><br><br />
<b>Reverse primer (5’->3’): (28 bp)</b><br />
<br><br />
CGATTTTCTG<span style="background: black">ACT</span><span style="background: red">C</span><span style="background: black">GT</span>AACGTCTTGTCC<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB642"></a><br />
Phytochrome B (aa 1-642) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365003"><font color="#E9AF03">BBa_K365003</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i>. The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm). <br />
<br><br><br />
The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it was fused to the N-teminal of the ClpX-trimer. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
As mentioned before it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light in in vivo-application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i>. Nevertheless, the binding strength and kinetic parameters depend on the composition and nature of the individual system, so we decided to include also this shorter variant of PhyB in our tests.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/9/93/ESBS-Strasbourg-PhyB650.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
The plasmid containing the PhyB-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.<br />
<br><br><br />
<b>Forward primer (5’->3’): (42 bp)</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctag</span>ATGGTTTCCGGAGTC<br />
<br><br><br />
<b>Reverse primer (5’->3’) : (53 bp)</b><br />
<br><br />
CAGCTG<u><span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span></u><b>t</b><u><span style="color: #F79646">actagt</span></u><b>atta</b><u><span style="color: #CC00FF">accggt</span></u>CCCCGCCATATCCCTAC<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PIF3"></a><br />
Phytochrome Interacting Factor-3 (PIF3) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365000"><font color="#E9AF03">BBa_K365000</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
PIF3 is a downstream transcription factor in a well studied signaling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no measurable binding affinity for the dark- or infrared-exposed Pr state.<br><br />
In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX.<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a><br><br />
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/8/8b/ESBS-Strasbourg-PIF3.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<a><i><b><font color="#FF0000" size="2">There is no PDB structure for the PIF3<br>The stucture below is modeled by homology using the server I-TASSER</font></i></b></a></font><br />
</center><br />
<br />
<br><br />
The plasmid containing the PIF3-sequence was provided by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#kircher">the laboratory of Stephan Kircher</a> from the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.<br />
<br><br><br />
<b>Forward primer (5’->3’): 51 bp</b><br />
<br><br />
<span><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b>ATGCCTCTGTTTGAGC</span></p><br />
<br><br><br />
<b>Reverse primer (5’->3’): 51 bp</b><br />
<br><br />
<span style="color: #1F497D"><br />
ctgcag</span><span color: #B8CCE4">cggccgc</span><span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>ATGATGATTCAACCATGGAAC</span></p><br />
<br><br><br />
In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).<br />
<br><br><br />
<b>Primers for Pfu-mutagenese:</b><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GCAAACTCT<span style="background: black">TC</span><span style="background: red">A</span><span style="background: black">AGA</span>GCTAGAGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CTCTCTAGC<span style="background: black">TCT</span><span style="background: red">T</span><span style="background: black">GA</span>AGAGTTTGC<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PIF6"></a><br />
Phytochrome Interacting Factor-6 (PIF6) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365001"><font color="#E9AF03">BBa_K365001</font></a> <br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
For the design of the first engineered system that achieved to enable the spatiotemporal control of PhyB-PIF interactions in in-vivo experiments, <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a> screened multiple potential phytochrome–PIF pairs by a fluorescence translocation assay in NIH3T3 cells. They measured the red-light-induced translocation of yellow fluorescent protein (YFP) fused to PIF domains to co-expressed phytochrome domains fused through a flexible linker to mCherry and localized to the plasma membrane by a carboxyterminalpolybasic, prenylation sequence from Kras. Of all previously reported PIF domains, only the N terminus of PIF6 is strong enough to cause significant translocation of YFP to the membrane. <br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/c/c9/ESBS-Strasbourg-Pif6ex.jpg"><br />
</center><br />
<center><br />
<i><font size="1">Fig.1: Implied system of Lim and Voigt (2009) to screen potential phytochrome-PIF<br>pairs in a fluorescence translocation assay. </font></i><br />
</center><br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose used the same sequence of the last 100-residue N-terminal activated phytochrome binding (APB) domain of PIF6, which was already successfully used by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a>.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/23/ESBS-Strasbourg-PIF6.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<a><i><b><font color="#FF0000" size="2">There is no PDB structure for the PIF6<br>The stucture below is modeled by homology using the server I-TASSER</font></i></b></a></font><br />
</center><br />
<br />
<br />
<br><br><br />
The plasmid containing the PIF6-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. For the synthesis of the Pif6 BioBrick primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.<br />
<br><br><br />
<b>Forward primer (5’->3’): 54 bp</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b>ATGATGTTCTTACCAACCG<br />
<br><br><br />
<b>Reverse primer (5’->3’): 58 bp</b><br />
<br><br />
CAGCTG<span color: #1F497D">ctgcag</span><span color: #B8CCE4">cggccgc</span><span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>GTCAACATGTTTATTGCTTTCC<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="NCLPX"></a><br />
∆N-ClpX (aa 61-425) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365004"><font color="#E9AF03">BBa_K365004</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
ClpXP is a part of an E.coli protease which consists of three parts, the hexametric ClpX and two heptametrical ClpP subunits. ClpX consists of six identical subunits, each 1092bp long. ClpX recognizes and unfolds protein containing certain tags like LAA and leading them into the catalytic center of this protein complex, the two ClpP units. ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI.<br />
<br><br><br />
<p><b>Conception</b></p><br />
ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI. The purpose of this first experimental part was to extract the ClpX gene out of the E.coli genome, to alter the internal EcoRI and AgeI sides in the ClpX gene and to fuse iGEM fusion pre- and suffixes to the ClpX sequence in order to get an iGEM Biobrick with standard prefix and suffix standard without internal EcoRI, Not, XbaI, AgeI, SpeI and PstI sides. <br />
<br><br><br />
The sequence was obtained from the following database for DH5α E.coli cells:<br />
<br><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/gene/945083"><br />
1- http://www.ncbi.nlm.nih.gov/gene/945083</a></span></p><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&to=457924&report=gbwithparts"><br />
2- http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&amp;to=457924&amp;report=gbwithparts</a></p><br />
<br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/32/ESBS-Strasbourg-(-N)ClpX.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Problem: <span style="background: black">2 AgeI and 2 EcoRI sides</b><br />
<br><br><br />
<b>Primers for cloning ClpX out of the E.Coli genome.</b><br />
<br><br />
These primes were used to amplificate ClpX from the E.coli genome.<br />
<br><br><br />
<b>Forward primer (5’->3’) : 31bp</b><br />
<br><br />
<u>CGCAGTGCGCTACCGACGCCGCATGAAATTC</u><br />
<br><br><br />
<b>Reverse primer (5’->3’) : 32bp</b><br />
<br><br />
<u>TTCACCAGATGCCTGTTGCGCTTCCGGCTTGC</u><br />
<br><br><br />
<br />
<b>Primers for Pfu-mutagenese</b><br />
<p><b>1. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (31 bp)</b><br />
<br><br />
CTGATCGGTCCG<span style="background: black">AC</span><span style="background: red">T</span><span style="background: Black">GGT</span>TCCGGTAAAACGC<br />
<br><br><br />
<b>Reverse primer (5’->3’) (31 bp)</b><br />
<br><br />
GCGTTTTACCGGA<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>CGGACCGATCAG<span style="color:red"></span><br />
<br><br><br />
<br />
<p><b>2. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (28 bp)</b><br />
<br><br />
CATCCGCAGCAG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>TTGCAGGTTG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (28 bp)</b><br />
<br><br />
CAACCTGCAA<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CTGCTGCGGATG<br />
<br><br><br />
<br />
<p><b>3. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (25 bp)</b><br />
<br><br />
CGTGGATCTG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>CGTGACGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (25 bp)</b><br />
<br><br />
CTCGTCACG<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CAGATCCACG<br />
<br><br><br />
<br />
<p><b>4. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GGCGCGTAAA<span style="background: black">AC</span><span style="background: red">T</span><span style="background: black">GGT</span>GCCCGTGG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CCACGGGC<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>TTTACGCGCC<br />
<br><br><br />
<b>Primers for amplification of ClpX with fusion pre- and suffix</b><br />
<br><br />
After mutagenesis of internal restriction sides, the fusion pre- and suffixes were added to the ClpX gene.<br />
<br><br><br />
<b>Forward primer (5’->3’):</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b></span><span>CGCAGT</span><span>GCGCTACCGACGCCGC<br />
<br><br><br />
<b>Reverse primer (5’->3’):</b><br />
<br><br />
CAGCTG<span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>TTCACCAGATGCCTGTTGCGC<br />
<br><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="Linker"></a><br />
Linker (aa 20) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365005"><font color="#E9AF03">BBa_K365005</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
The linker biobrick is used to join the three ClpX subunits covalently in order to build a ClpX trimer and to link the degradation tags and PIF3/6 with the protein destined for degradation. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same linker, which was already successfully used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i> to construct the ClpX trimer. It is a twenty amino acid linker (ASGAGGSEGGGSEGGTSGAT). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition RFC 25 fusion prefix and suffix have been added to the sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d1/ESBS-Strasbourg-linker.png" width="250px" height="167px" border="0"><br />
</center><br />
<br />
<br><br><br />
The linker has been order as six separate, EcoRI+AgeI precut primers, which were hybridized in order to obtain the complete linker sequence.<br />
<br><br><br />
Forward strand (5’->3’) : (89 bp)<br />
<br><br />
aattc</span><span color: #B8CCE4">gcggccgc</span><span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gc|cggc</span></b>GCGAGCGGCGCGGGCGGCAGCGAAGGCGGCGGCAG|CGAAGGCGGCACCAGCGGCGCGACC<span style="color: #CC00FF">a</span><br />
<br><br><br />
Reverse strand (5’-3’) : (89 bp)<br />
<br><br />
<span style="color: #CC00FF">ccggt</span><span>GGTCGCGCCG|CTGGTGCCGCCTTCGCTGCCGCCGCCTTCGCTGCC|GCCCGCGCCGCTCGC<b><span style="color:#009999">gccggc</span></b>ca<span style="color:#00B050">tctaga</span>a<span style="color: #B8CCE4">gcggccgc</span><span style="color:red">g</span><br />
<br><br><br />
<b>Ordered primer:</b><br />
<br><br />
<p><br />
<span><br />
Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color:red">aattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gc<br />
</span></b>3’</span></p><br />
<p><br />
<span><br />
Forward: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:#009999">cggc</span></b></span><span>GCGAGCGGCGCGGGCGGCAGCGAAGGCGGCGGCAG <br />
3’</span></p><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’CGAAGGCGGCACCAGCGGCGCGACC<span style="color: #CC00FF">a </span>3’</span></p><br />
<p><br />
<span><br />
Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color:#CC00FF">ccggt</span></span><span>GGTCGCGCCG <br />
3’</span></p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’CTGGTGCCGCCTTCGCTGCCGCCGCCTTCGCTGCC 3’</span></p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’GCCCGCGCCGCTCGC<b><span style="color:#009999">gccggc</span></b>ca<span style="color:#00B050">tctaga</span>a<span style="color: #B8CCE4">gcggccgc</span><span style="color:red">g</span>3’<br />
<br><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="LAA"></a><br />
LAA tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365006"><font color="#E9AF03">BBa_K365006</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
LAA tag is a C-terminal region of the natural ssrA-recognition sequence of E. Coli that interacts with the ClpXP protease. A protein fused with this tag will be preferentially degraded by the ClpX protease without need of an adaptor protein <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same tag, which was already successfully used by used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. It is a eleven amino acid tag (AANDENYALAA). At the end of the coding sequence a double stop codon was added (<span style="color: #F79646">ACTAGT</span>). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence and NgoMIV and Pst1 restriction sites have been added to the sequence.<br />
<br><br><br />
The LAA-tag has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the degradation sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/3e/ESBS-Strasbourg-LAAtag.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<i><font size="2">LAA Tag</font></i><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style=" color: #009999">CCGGC</span></b><span>GCGCTGGCGGCGTAATAAT<span style="color: #F79646">ACTAGT</span>A<span style="color: #B8CCE4">GCGGCCG</span><span style="color: #1F497D">C</span>3’</p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’ <span style=" color: #1F497D"><br />
TGCAG</span><span>C<span style="color: #B8CCE4">GGCCGC</span>T<span style="color: #F79646">ACTAGT</span>ATTATTACGCCGCCAGCGC<b><span style="color:#009999">G</span></b><br />
<br />
3’</span></p><br />
<br><br><br />
For the synthesis of the PstI-site a mistake occurred in the command of the primers, as we did not consider that PstI cuts in the (3’ -> 5’) sens, contrary to the other restriction enzymes of the BioBrick standard. A supplementary step of ligation digestion in the experimental procedure can fix this mistake.<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="DAS"></a><br />
DAS tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365007"><font color="#E9AF03">BBa_K365007</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<p><b>Background:</b></p><br />
The DAS tag presents a C-terminal recognition sequence that has been artificially altered so that it has weakened interactions with ClpXP and depends on an adaptor <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. In E. coli, the adaptor SspB tethers specifically tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In our system, the role of the adaptor-protein SspB has been assumed by Pif3/6. So only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
We decided to use the same tag, which was already successfully used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. It is a eleven amino acid tag (AANDENYADAS). At the end of the coding sequence a double stop codon was added (<span style="color: #F79646">ACTAGT</span>). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition NgoMIV and PST1 restriction sites have been added to the sequence.<br />
<br><br><br />
The DAS-tag has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the degradation sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/23/ESBS-Strasbourg-DAStag.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style=" color: #009999"><br />
CCGGC</span></b><span>GCGGATGCGAGCTAATAAT<span style="color: #F79646">ACTAGT</span>A<span style="color: #B8CCE4">GCGGCCG</span><span style="color: #1F497D">C</span>3’</p><br />
<br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color: #1F497D"><br />
TGCAG</span><span style="color: #B8CCE4">CGGCCGC</span><span>T<span style="color: #F79646">ACTAGT</span>ATTATTAGCTCGCATCCGC<b><span style="color:#009999">G</span></b><br />
<br />
3’</span></p><br />
<br><br><br />
For the synthesis of the PstI-site a mistake occurred in the command of the primers, as we did not consider that PstI cuts in the (3’ -> 5’) sens, contrary to the other restriction enzymes of the BioBrick standard. A supplementary step of ligation digestion in the experimental procedure can fix this mistake. <br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="Lambda"></a><br />
Lambda tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365008"><font color="#E9AF03">BBa_K365008</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
The λO- tag is the N-terminal equalent to the DAS tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same sequence, which was already successfully used by used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i>: NH2-TNTAKILNFGR. The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition NgoMIV and AgeI restriction sites have been added to the sequence. <br />
<br><br><br />
The tag has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the whole degradation tag.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/0a/ESBS-Strasbourg-Lambdatag.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:#009999">AATTC</span></b>GCGGCCGCTTCTAGATGACCAACACCGCGAAAATTCTGAACTTTGGCCGCA 3’<br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:blue">CCGGT</span></b>GCGGCCAAAGTTCAGAATTTTCGCGGTGTTGGTCATCTAGAAGCGGCCGCG 3’</p><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="GFP"></a><br />
GFP (super fold) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365009"><font color="#E9AF03">BBa_K365009</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
The GFP super fold protein originated from the BBa_I746915. This old biobrick contains the normal standard prefix and suffix. When this GFP is now fused to another biobrick a stop codon is created which would terminate the transcription of the fused biobrick. To avoid this inconvenience, we improved this biobrick to the fusion standard BBF RFC 25. This new biobrick can now be added to any biobrick with compatible restriction sides without creating a stop codon.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/c/cd/ESBS-Strasbourg-GFP.png" width="300px" height="163px" border="0"><br />
</center><br />
<br><br />
<p><b>Conception</b></p><br />
Standard PCR techniques were used. The Primer for amplification contained the fusion pre- and suffix and compatible base pair for the GFP gene. <br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB642-CLPX3"></a><br />
PhyB642-(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365010"><font color="#E9AF03">BBa_K365010</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This final construct will be the inducible part of the protease system. This permits the linking of the phytochrome B to the Clpx trimer which forms the light-dependent activation part of our degradation system.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/ESBS-Strasbourg-PhyB650-clpx3.png" width="296px" height="206px" border="0"><br />
</center><br />
<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing linker- ClpX trimer and the PhyB part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB908-CLPX3"></a><br />
PhyB908-(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365011"><font color="#E9AF03">BBa_K365011</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This final construct will be the inducible part of the protease system. This permits the linking of the phytochrome B to the Clpx trimer which forms the light-dependent activation part of our degradation system.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/0f/ESBS-Strasbourg-PhyB908-clpx3.png" width="296px" height="206px" border="0"><br />
</center><br />
<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing linker- ClpX trimer and the PhyB part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="CLPX"></a><br />
Full-length ClpX - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365012"><font color="#E9AF03">BBa_K365012</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
ClpXP is a part of an E.coli protease which consists of three parts, the hexametric ClpX and two heptametrical ClpP subunits. ClpX consists of six identical subunits, each 1092bp long. ClpX recognizes and unfolds protein containing certain tags like LAA and leading them into the catalytic center of this protein complex, the two ClpP units. ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI.<br />
<br><br><br />
<p><b>Conception</b></p><br />
ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI. The purpose of this first experimental part was to extract the ClpX gene out of the E.coli genome, to alter the internal EcoRI and AgeI sides in the ClpX gene and to fuse iGEM fusion pre- and suffixes to the ClpX sequence in order to get an iGEM Biobrick with standard prefix and suffix standard without internal EcoRI, Not, XbaI, AgeI, SpeI and PstI sides. <br />
<br><br><br />
The sequence was obtained from the following database for DH5α E.coli cells:<br />
<br><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/gene/945083"><br />
1- http://www.ncbi.nlm.nih.gov/gene/945083</a></span></p><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&to=457924&report=gbwithparts"><br />
2- http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&amp;to=457924&amp;report=gbwithparts</a></p><br />
<br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d1/ESBS-Strasbourg-ClpXfull.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Problem: <span style="background: black">2 AgeI and 2 EcoRI sides</b><br />
<br><br><br />
<b>Primers for cloning ClpX out of the E.Coli genome.</b><br />
<br><br />
These primes were used to amplificate ClpX from the E.coli genome.<br />
<br><br><br />
<b>Forward primer (5’->3’) : 31bp</b><br />
<br><br />
<u>CGCAGTGCGCTACCGACGCCGCATGAAATTC</u><br />
<br><br><br />
<b>Reverse primer (5’->3’) : 32bp</b><br />
<br><br />
<u>TTCACCAGATGCCTGTTGCGCTTCCGGCTTGC</u><br />
<br><br><br />
<br />
<b>Primers for Pfu-mutagenese</b><br />
<p><b>1. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (31 bp)</b><br />
<br><br />
CTGATCGGTCCG<span style="background: black">AC</span><span style="background: red">T</span><span style="background: Black">GGT</span>TCCGGTAAAACGC<br />
<br><br><br />
<b>Reverse primer (5’->3’) (31 bp)</b><br />
<br><br />
GCGTTTTACCGGA<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>CGGACCGATCAG<span style="color:red"></span><br />
<br><br><br />
<br />
<p><b>2. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (28 bp)</b><br />
<br><br />
CATCCGCAGCAG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>TTGCAGGTTG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (28 bp)</b><br />
<br><br />
CAACCTGCAA<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CTGCTGCGGATG<br />
<br><br><br />
<br />
<p><b>3. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (25 bp)</b><br />
<br><br />
CGTGGATCTG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>CGTGACGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (25 bp)</b><br />
<br><br />
CTCGTCACG<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CAGATCCACG<br />
<br><br><br />
<br />
<p><b>4. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GGCGCGTAAA<span style="background: black">AC</span><span style="background: red">T</span><span style="background: black">GGT</span>GCCCGTGG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CCACGGGC<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>TTTACGCGCC<br />
<br><br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="NCLPX-L"></a><br />
∆NClpX-linker-∆NClpX-linker-∆NClpX - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365013"><font color="#E9AF03">BBa_K365013</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochrome B needs to be fixed to the Clpx hexametric part of the protease. It is possible to link one phytochrome B per ClpX monomer but this could lead to steric problems. So the decision was made to follow the idea of the publication of Tanja Baker 2009. This permits to have only one phytochrome B for three ClpX units. Moreover the publication proved that the speed of the assembly of two ClpX trimers is quite the same than with ClpX monomers. So the Clpx hexameric part is composed of two ClpX trimers each one couple with a phytochrome B. <br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/3f/ESBS-Strasbourg-ClpX-Trimere.png" width="250px" height="132px" border="0"><br />
</center><br />
<br><br><br />
<p><b>Conception:</b</p><br />
ClpX primer was constructed due to cloning methods. The new approach in this method is that the primer was built from a PCR product. The construction of the ClpX dimer was conducted with standard methods. Then in a PCR reaction the ClpX primers located inside of the dimer were used to construct this new primer. The product of this PCR was used as primer for constructing the ClpX trimer.<br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="L-NCLPX"></a><br />
(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365014"><font color="#E9AF03">BBa_K365014</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This construct was the final step for the ClpX hexamer creation. The two trimers will assemble to the full ClpX unit. Then the phytochrome B was cloned to this trimer. It will also be possible to add any other activation system like hormone receptors to this biobrick instead of phytochrome B, giving this part a huge potential of further applications.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/06/ESBS-Strasbourg-Linker-ClpX-Trimere.png" width="250px" height="132px" border="0"><br />
</center><br />
<br><br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing ClpX trimer and the linker part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Results/BiobricksTeam:ESBS-Strasbourg/Results/Biobricks2010-10-27T15:05:05Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=40 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Biobricks</div><br />
<div class="desc"><br />
<br><br><br />
<ul><br />
<br />
<li><a href="#PIF3">PIF3</a></li><br />
<li><a href="#PIF6">PIF6</a></li><br />
<li><a href="#PHYB908">PHY B 900</a></li><br />
<li><a href="#PHYB642">PHY B 650</a></li><br />
<li><a href="#NCLPX">∆N-ClpX</a></li><br />
<li><a href="#Linker">linker</a></li><br />
<li><a href="#LAA">LAA Tag</a></li><br />
<li><a href="#DAS">DAS Tag</a></li><br />
<li><a href="#Lambda">Lambda Tag</a></li><br />
<li><a href="#GFP">GFP (super fold)</a></li><br />
<li><a href="#PHYB642-CLPX3">PhyB642-(linker-∆NClpX)3</a></li><br />
<li><a href="#PHYB908-CLPX3">PhyB908-(linker-∆NClpX)3</a></li><br />
<li><a href="#CLPX">Full-length ClpX</a></li><br />
<li><a href="#NCLPX-L">∆NClpX-linker-∆NClpX-linker-∆NClpX</a></li><br />
<li><a href="#L-NCLPX">(linker-∆NClpX)3</a></li><br />
<br><br />
<br />
</ul><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly">Our Biobrick Assembly Technique</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=40 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Parts Submitted to Registry</div><br />
<br><br />
<br />
<br />
<br />
<br><br />
&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/3/3a/ESBS-Strasbourg-ClpXPSystem.jpg" width="400px" height="241px" border="0"><br />
&nbsp;&nbsp;&nbsp;<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="300px" height="182px" border="0"><br />
<br />
<br />
<br><br />
<br><br />
<br />
<center><br />
<br />
<table border="1" width="100%" bordercolorlight="#FFFFFF" bordercolordark="#222222" bordercolor="#FFFFFF"><br />
<tr><br />
<td width="165" bgcolor="#800000"><b><font size="4" color="#FFFFFF">Part <br />
Number:</font></b></td><br />
<td width="302" bgcolor="#800000"><b><font size="4" color="#FFFFFF">Part <br />
Name:</font></b></td><br />
<td width="223" bgcolor="#800000"><b><font size="4" color="#FFFFFF"><br />
Plasmid/Resistance</font></b></td><br />
<td width="187" bgcolor="#800000"><b><font size="4" color="#FFFFFF"><br />
Status</font></b></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365000"><br />
<font color="#000000">BBa_K365000</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PIF3">Phytochrome Interacting Factor-3 <br />
(PIF3)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365001"><br />
<font color="#000000">BBa_K365001</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PIF6">Phytochrome Interacting Factor-6 <br />
(PIF6)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365002"><br />
<font color="#000000">BBa_K365002</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB908">Phytochrome B (aa 1-908)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365003"><br />
<font color="#000000">BBa_K365003</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB642">Phytochrome B (aa 1-642)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365004"><br />
<font color="#000000">BBa_K365004</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#NCLPX">&#8710;N-ClpX (aa 61-425)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365005"><br />
<font color="#000000">BBa_K365005</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#Linker">Linker (aa 20)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365006"><br />
<font color="#000000">BBa_K365006</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#LAA">LAA tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365007"><br />
<font color="#000000">BBa_K365007</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#DAS">DAS tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365008"><br />
<font color="#000000">BBa_K365008</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#Lambda">Lambda tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365009"><br />
<font color="#000000">BBa_K365009</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#GFP">GFP (super fold)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365010"><br />
<font color="#000000">BBa_K365010</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB642-CLPX3">PhyB642-(linker-&#8710;NClpX)3</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365011"><br />
<font color="#000000">BBa_K365011</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB908-CLPX3">PhyB908-(linker-&#8710;NClpX)3 </font><br />
</td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365012"><br />
<font color="#000000">BBa_K365012</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#CLPX">Full-length ClpX</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365013"><br />
<font color="#000000">BBa_K365013</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#NCLPX-L">&#8710;NClpX-linker-&#8710;NClpX-linker-&#8710;NClpX</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365014"><br />
<font color="#000000">BBa_K365014</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="L-NCLPX">(linker-&#8710;NClpX)3 </font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
</table><br />
<br />
</center><br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<div id="windowbox" style="position:fixed; top:50%; right:3px; width:11%;"><br />
Colored restriction sites :<br><br />
<b><font color="#FF0000">EcoRI </font><font color="#C0C0C0">NotI </font><font color="#008000">XbaI </font><br />
<font color="#008080">NgoMIV</font><br><br />
<font color="#FF00FF">AgeI </font><font color="#FF6600">SpeI </font><font color="#C0C0C0">NotI </font><font color="#1F497D">PstI </font></b><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PIF3"></a><br />
Phytochrome Interacting Factor-3 (PIF3) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365000"><font color="#E9AF03">BBa_K365000</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
PIF3 is a downstream transcription factor in a well studied signaling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no measurable binding affinity for the dark- or infrared-exposed Pr state.<br><br />
In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX.<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a><br><br />
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/8/8b/ESBS-Strasbourg-PIF3.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<a><i><b><font color="#FF0000" size="2">There is no PDB structure for the PIF3<br>The stucture below is modeled by homology using the server I-TASSER</font></i></b></a></font><br />
</center><br />
<br />
<br><br />
The plasmid containing the PIF3-sequence was provided by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#kircher">the laboratory of Stephan Kircher</a> from the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.<br />
<br><br><br />
<b>Forward primer (5’->3’): 51 bp</b><br />
<br><br />
<span><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b>ATGCCTCTGTTTGAGC</span></p><br />
<br><br><br />
<b>Reverse primer (5’->3’): 51 bp</b><br />
<br><br />
<span style="color: #1F497D"><br />
ctgcag</span><span color: #B8CCE4">cggccgc</span><span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>ATGATGATTCAACCATGGAAC</span></p><br />
<br><br><br />
In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).<br />
<br><br><br />
<b>Primers for Pfu-mutagenese:</b><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GCAAACTCT<span style="background: black">TC</span><span style="background: red">A</span><span style="background: black">AGA</span>GCTAGAGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CTCTCTAGC<span style="background: black">TCT</span><span style="background: red">T</span><span style="background: black">GA</span>AGAGTTTGC<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PIF6"></a><br />
Phytochrome Interacting Factor-6 (PIF6) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365001"><font color="#E9AF03">BBa_K365001</font></a> <br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
For the design of the first engineered system that achieved to enable the spatiotemporal control of PhyB-PIF interactions in in-vivo experiments, <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a> screened multiple potential phytochrome–PIF pairs by a fluorescence translocation assay in NIH3T3 cells. They measured the red-light-induced translocation of yellow fluorescent protein (YFP) fused to PIF domains to co-expressed phytochrome domains fused through a flexible linker to mCherry and localized to the plasma membrane by a carboxyterminalpolybasic, prenylation sequence from Kras. Of all previously reported PIF domains, only the N terminus of PIF6 is strong enough to cause significant translocation of YFP to the membrane. <br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/c/c9/ESBS-Strasbourg-Pif6ex.jpg"><br />
</center><br />
<center><br />
<i><font size="1">Fig.1: Implied system of Lim and Voigt (2009) to screen potential phytochrome-PIF<br>pairs in a fluorescence translocation assay. </font></i><br />
</center><br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose used the same sequence of the last 100-residue N-terminal activated phytochrome binding (APB) domain of PIF6, which was already successfully used by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a>.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/23/ESBS-Strasbourg-PIF6.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<a><i><b><font color="#FF0000" size="2">There is no PDB structure for the PIF6<br>The stucture below is modeled by homology using the server I-TASSER</font></i></b></a></font><br />
</center><br />
<br />
<br />
<br><br><br />
The plasmid containing the PIF6-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. For the synthesis of the Pif6 BioBrick primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.<br />
<br><br><br />
<b>Forward primer (5’->3’): 54 bp</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b>ATGATGTTCTTACCAACCG<br />
<br><br><br />
<b>Reverse primer (5’->3’): 58 bp</b><br />
<br><br />
CAGCTG<span color: #1F497D">ctgcag</span><span color: #B8CCE4">cggccgc</span><span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>GTCAACATGTTTATTGCTTTCC<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB908"></a><br />
Phytochrome B (aa 1-908) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365002"><font color="#E9AF03">BBa_K365002</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>. The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm). <br />
<br><br><br />
The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it will be fused to the N-teminal of the ClpX-trimer.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
In in-vivo applications it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt (2009)</a></i> demonstrated by assaying PIF6 (which has the strongest interactions of all previously reported PIF domains) against different variants of PhyB that the tandem C-terminal PAS domains (residues 1-908)of plant phytochromes are necessary to confer rapid photoreversibility under infrared light.<br />
The original sequence contains a SpeI restriction within the first 908 residues.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-PhyB900.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
The plasmid containing the PhyB-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.<br />
<br><br> <br />
<b>Forward primer (5’->3’): (41bp)</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctag</span>ATGGTTTCCGGAGTC<br />
<br><br><br />
<b>Reverse primer (5’->3’): (52 bp)</b><br />
<br><br />
CAGCTG<u><span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span></u><b>t</b><u><span style="color: #F79646">actagt</span></u><b>atta</b><u><span style="color: #CC00FF">accggt</span></u>GCTCGGGATTTGCAAG<br />
<br><br><br />
In order to get a sequence without an internal restriction sites of one of the BioBrick standards the SpeI-restriction site was altered without changing the encoded amino acid (ACT=Threonine (AC(T,A,G,C)).<br />
<br><br><br />
<b>Primers for Pfu-mutagenese: </b><br />
<br><br />
<b>Forward primer (5’->3’): (28 bp)</b><br />
<br><br />
GGACAAGACGTT<span style="background: black">AC</span><span style="background: red">G</span><span style="background: black">AGT</span>CAGAAAATCG<br />
<br><br><br />
<b>Reverse primer (5’->3’): (28 bp)</b><br />
<br><br />
CGATTTTCTG<span style="background: black">ACT</span><span style="background: red">C</span><span style="background: black">GT</span>AACGTCTTGTCC<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB642"></a><br />
Phytochrome B (aa 1-642) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365003"><font color="#E9AF03">BBa_K365003</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i>. The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm). <br />
<br><br><br />
The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it was fused to the N-teminal of the ClpX-trimer. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
As mentioned before it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light in in vivo-application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i>. Nevertheless, the binding strength and kinetic parameters depend on the composition and nature of the individual system, so we decided to include also this shorter variant of PhyB in our tests.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/9/93/ESBS-Strasbourg-PhyB650.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
The plasmid containing the PhyB-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.<br />
<br><br><br />
<b>Forward primer (5’->3’): (42 bp)</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctag</span>ATGGTTTCCGGAGTC<br />
<br><br><br />
<b>Reverse primer (5’->3’) : (53 bp)</b><br />
<br><br />
CAGCTG<u><span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span></u><b>t</b><u><span style="color: #F79646">actagt</span></u><b>atta</b><u><span style="color: #CC00FF">accggt</span></u>CCCCGCCATATCCCTAC<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="NCLPX"></a><br />
∆N-ClpX (aa 61-425) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365004"><font color="#E9AF03">BBa_K365004</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
ClpXP is a part of an E.coli protease which consists of three parts, the hexametric ClpX and two heptametrical ClpP subunits. ClpX consists of six identical subunits, each 1092bp long. ClpX recognizes and unfolds protein containing certain tags like LAA and leading them into the catalytic center of this protein complex, the two ClpP units. ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI.<br />
<br><br><br />
<p><b>Conception</b></p><br />
ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI. The purpose of this first experimental part was to extract the ClpX gene out of the E.coli genome, to alter the internal EcoRI and AgeI sides in the ClpX gene and to fuse iGEM fusion pre- and suffixes to the ClpX sequence in order to get an iGEM Biobrick with standard prefix and suffix standard without internal EcoRI, Not, XbaI, AgeI, SpeI and PstI sides. <br />
<br><br><br />
The sequence was obtained from the following database for DH5α E.coli cells:<br />
<br><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/gene/945083"><br />
1- http://www.ncbi.nlm.nih.gov/gene/945083</a></span></p><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&to=457924&report=gbwithparts"><br />
2- http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&amp;to=457924&amp;report=gbwithparts</a></p><br />
<br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/32/ESBS-Strasbourg-(-N)ClpX.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Problem: <span style="background: black">2 AgeI and 2 EcoRI sides</b><br />
<br><br><br />
<b>Primers for cloning ClpX out of the E.Coli genome.</b><br />
<br><br />
These primes were used to amplificate ClpX from the E.coli genome.<br />
<br><br><br />
<b>Forward primer (5’->3’) : 31bp</b><br />
<br><br />
<u>CGCAGTGCGCTACCGACGCCGCATGAAATTC</u><br />
<br><br><br />
<b>Reverse primer (5’->3’) : 32bp</b><br />
<br><br />
<u>TTCACCAGATGCCTGTTGCGCTTCCGGCTTGC</u><br />
<br><br><br />
<br />
<b>Primers for Pfu-mutagenese</b><br />
<p><b>1. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (31 bp)</b><br />
<br><br />
CTGATCGGTCCG<span style="background: black">AC</span><span style="background: red">T</span><span style="background: Black">GGT</span>TCCGGTAAAACGC<br />
<br><br><br />
<b>Reverse primer (5’->3’) (31 bp)</b><br />
<br><br />
GCGTTTTACCGGA<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>CGGACCGATCAG<span style="color:red"></span><br />
<br><br><br />
<br />
<p><b>2. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (28 bp)</b><br />
<br><br />
CATCCGCAGCAG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>TTGCAGGTTG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (28 bp)</b><br />
<br><br />
CAACCTGCAA<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CTGCTGCGGATG<br />
<br><br><br />
<br />
<p><b>3. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (25 bp)</b><br />
<br><br />
CGTGGATCTG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>CGTGACGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (25 bp)</b><br />
<br><br />
CTCGTCACG<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CAGATCCACG<br />
<br><br><br />
<br />
<p><b>4. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GGCGCGTAAA<span style="background: black">AC</span><span style="background: red">T</span><span style="background: black">GGT</span>GCCCGTGG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CCACGGGC<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>TTTACGCGCC<br />
<br><br><br />
<b>Primers for amplification of ClpX with fusion pre- and suffix</b><br />
<br><br />
After mutagenesis of internal restriction sides, the fusion pre- and suffixes were added to the ClpX gene.<br />
<br><br><br />
<b>Forward primer (5’->3’):</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b></span><span>CGCAGT</span><span>GCGCTACCGACGCCGC<br />
<br><br><br />
<b>Reverse primer (5’->3’):</b><br />
<br><br />
CAGCTG<span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>TTCACCAGATGCCTGTTGCGC<br />
<br><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="Linker"></a><br />
Linker (aa 20) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365005"><font color="#E9AF03">BBa_K365005</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
The linker biobrick is used to join the three ClpX subunits covalently in order to build a ClpX trimer and to link the degradation tags and PIF3/6 with the protein destined for degradation. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same linker, which was already successfully used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i> to construct the ClpX trimer. It is a twenty amino acid linker (ASGAGGSEGGGSEGGTSGAT). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition RFC 25 fusion prefix and suffix have been added to the sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d1/ESBS-Strasbourg-linker.png" width="250px" height="167px" border="0"><br />
</center><br />
<br />
<br><br><br />
The linker has been order as six separate, EcoRI+AgeI precut primers, which were hybridized in order to obtain the complete linker sequence.<br />
<br><br><br />
Forward strand (5’->3’) : (89 bp)<br />
<br><br />
aattc</span><span color: #B8CCE4">gcggccgc</span><span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gc|cggc</span></b>GCGAGCGGCGCGGGCGGCAGCGAAGGCGGCGGCAG|CGAAGGCGGCACCAGCGGCGCGACC<span style="color: #CC00FF">a</span><br />
<br><br><br />
Reverse strand (5’-3’) : (89 bp)<br />
<br><br />
<span style="color: #CC00FF">ccggt</span><span>GGTCGCGCCG|CTGGTGCCGCCTTCGCTGCCGCCGCCTTCGCTGCC|GCCCGCGCCGCTCGC<b><span style="color:#009999">gccggc</span></b>ca<span style="color:#00B050">tctaga</span>a<span style="color: #B8CCE4">gcggccgc</span><span style="color:red">g</span><br />
<br><br><br />
<b>Ordered primer:</b><br />
<br><br />
<p><br />
<span><br />
Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color:red">aattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gc<br />
</span></b>3’</span></p><br />
<p><br />
<span><br />
Forward: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:#009999">cggc</span></b></span><span>GCGAGCGGCGCGGGCGGCAGCGAAGGCGGCGGCAG <br />
3’</span></p><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’CGAAGGCGGCACCAGCGGCGCGACC<span style="color: #CC00FF">a </span>3’</span></p><br />
<p><br />
<span><br />
Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color:#CC00FF">ccggt</span></span><span>GGTCGCGCCG <br />
3’</span></p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’CTGGTGCCGCCTTCGCTGCCGCCGCCTTCGCTGCC 3’</span></p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’GCCCGCGCCGCTCGC<b><span style="color:#009999">gccggc</span></b>ca<span style="color:#00B050">tctaga</span>a<span style="color: #B8CCE4">gcggccgc</span><span style="color:red">g</span>3’<br />
<br><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="LAA"></a><br />
LAA tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365006"><font color="#E9AF03">BBa_K365006</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
LAA tag is a C-terminal region of the natural ssrA-recognition sequence of E. Coli that interacts with the ClpXP protease. A protein fused with this tag will be preferentially degraded by the ClpX protease without need of an adaptor protein <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same tag, which was already successfully used by used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. It is a eleven amino acid tag (AANDENYALAA). At the end of the coding sequence a double stop codon was added (<span style="color: #F79646">ACTAGT</span>). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence and NgoMIV and Pst1 restriction sites have been added to the sequence.<br />
<br><br><br />
The LAA-tag has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the degradation sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/3e/ESBS-Strasbourg-LAAtag.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<i><font size="2">LAA Tag</font></i><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style=" color: #009999">CCGGC</span></b><span>GCGCTGGCGGCGTAATAAT<span style="color: #F79646">ACTAGT</span>A<span style="color: #B8CCE4">GCGGCCG</span><span style="color: #1F497D">C</span>3’</p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’ <span style=" color: #1F497D"><br />
TGCAG</span><span>C<span style="color: #B8CCE4">GGCCGC</span>T<span style="color: #F79646">ACTAGT</span>ATTATTACGCCGCCAGCGC<b><span style="color:#009999">G</span></b><br />
<br />
3’</span></p><br />
<br><br><br />
For the synthesis of the PstI-site a mistake occurred in the command of the primers, as we did not consider that PstI cuts in the (3’ -> 5’) sens, contrary to the other restriction enzymes of the BioBrick standard. A supplementary step of ligation digestion in the experimental procedure can fix this mistake.<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="DAS"></a><br />
DAS tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365007"><font color="#E9AF03">BBa_K365007</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<p><b>Background:</b></p><br />
The DAS tag presents a C-terminal recognition sequence that has been artificially altered so that it has weakened interactions with ClpXP and depends on an adaptor <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. In E. coli, the adaptor SspB tethers specifically tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In our system, the role of the adaptor-protein SspB has been assumed by Pif3/6. So only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
We decided to use the same tag, which was already successfully used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. It is a eleven amino acid tag (AANDENYADAS). At the end of the coding sequence a double stop codon was added (<span style="color: #F79646">ACTAGT</span>). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition NgoMIV and PST1 restriction sites have been added to the sequence.<br />
<br><br><br />
The DAS-tag has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the degradation sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/23/ESBS-Strasbourg-DAStag.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style=" color: #009999"><br />
CCGGC</span></b><span>GCGGATGCGAGCTAATAAT<span style="color: #F79646">ACTAGT</span>A<span style="color: #B8CCE4">GCGGCCG</span><span style="color: #1F497D">C</span>3’</p><br />
<br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color: #1F497D"><br />
TGCAG</span><span style="color: #B8CCE4">CGGCCGC</span><span>T<span style="color: #F79646">ACTAGT</span>ATTATTAGCTCGCATCCGC<b><span style="color:#009999">G</span></b><br />
<br />
3’</span></p><br />
<br><br><br />
For the synthesis of the PstI-site a mistake occurred in the command of the primers, as we did not consider that PstI cuts in the (3’ -> 5’) sens, contrary to the other restriction enzymes of the BioBrick standard. A supplementary step of ligation digestion in the experimental procedure can fix this mistake. <br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="Lambda"></a><br />
Lambda tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365008"><font color="#E9AF03">BBa_K365008</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
The λO- tag is the N-terminal equalent to the DAS tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same sequence, which was already successfully used by used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i>: NH2-TNTAKILNFGR. The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition NgoMIV and AgeI restriction sites have been added to the sequence. <br />
<br><br><br />
The tag has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the whole degradation tag.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/0a/ESBS-Strasbourg-Lambdatag.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:#009999">AATTC</span></b>GCGGCCGCTTCTAGATGACCAACACCGCGAAAATTCTGAACTTTGGCCGCA 3’<br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:blue">CCGGT</span></b>GCGGCCAAAGTTCAGAATTTTCGCGGTGTTGGTCATCTAGAAGCGGCCGCG 3’</p><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="GFP"></a><br />
GFP (super fold) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365009"><font color="#E9AF03">BBa_K365009</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
The GFP super fold protein originated from the BBa_I746915. This old biobrick contains the normal standard prefix and suffix. When this GFP is now fused to another biobrick a stop codon is created which would terminate the transcription of the fused biobrick. To avoid this inconvenience, we improved this biobrick to the fusion standard BBF RFC 25. This new biobrick can now be added to any biobrick with compatible restriction sides without creating a stop codon.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/c/cd/ESBS-Strasbourg-GFP.png" width="300px" height="163px" border="0"><br />
</center><br />
<br><br />
<p><b>Conception</b></p><br />
Standard PCR techniques were used. The Primer for amplification contained the fusion pre- and suffix and compatible base pair for the GFP gene. <br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB642-CLPX3"></a><br />
PhyB642-(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365010"><font color="#E9AF03">BBa_K365010</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This final construct will be the inducible part of the protease system. This permits the linking of the phytochrome B to the Clpx trimer which forms the light-dependent activation part of our degradation system.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/ESBS-Strasbourg-PhyB650-clpx3.png" width="296px" height="206px" border="0"><br />
</center><br />
<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing linker- ClpX trimer and the PhyB part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB908-CLPX3"></a><br />
PhyB908-(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365011"><font color="#E9AF03">BBa_K365011</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This final construct will be the inducible part of the protease system. This permits the linking of the phytochrome B to the Clpx trimer which forms the light-dependent activation part of our degradation system.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/0f/ESBS-Strasbourg-PhyB908-clpx3.png" width="296px" height="206px" border="0"><br />
</center><br />
<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing linker- ClpX trimer and the PhyB part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="CLPX"></a><br />
Full-length ClpX - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365012"><font color="#E9AF03">BBa_K365012</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
ClpXP is a part of an E.coli protease which consists of three parts, the hexametric ClpX and two heptametrical ClpP subunits. ClpX consists of six identical subunits, each 1092bp long. ClpX recognizes and unfolds protein containing certain tags like LAA and leading them into the catalytic center of this protein complex, the two ClpP units. ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI.<br />
<br><br><br />
<p><b>Conception</b></p><br />
ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI. The purpose of this first experimental part was to extract the ClpX gene out of the E.coli genome, to alter the internal EcoRI and AgeI sides in the ClpX gene and to fuse iGEM fusion pre- and suffixes to the ClpX sequence in order to get an iGEM Biobrick with standard prefix and suffix standard without internal EcoRI, Not, XbaI, AgeI, SpeI and PstI sides. <br />
<br><br><br />
The sequence was obtained from the following database for DH5α E.coli cells:<br />
<br><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/gene/945083"><br />
1- http://www.ncbi.nlm.nih.gov/gene/945083</a></span></p><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&to=457924&report=gbwithparts"><br />
2- http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&amp;to=457924&amp;report=gbwithparts</a></p><br />
<br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d1/ESBS-Strasbourg-ClpXfull.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Problem: <span style="background: black">2 AgeI and 2 EcoRI sides</b><br />
<br><br><br />
<b>Primers for cloning ClpX out of the E.Coli genome.</b><br />
<br><br />
These primes were used to amplificate ClpX from the E.coli genome.<br />
<br><br><br />
<b>Forward primer (5’->3’) : 31bp</b><br />
<br><br />
<u>CGCAGTGCGCTACCGACGCCGCATGAAATTC</u><br />
<br><br><br />
<b>Reverse primer (5’->3’) : 32bp</b><br />
<br><br />
<u>TTCACCAGATGCCTGTTGCGCTTCCGGCTTGC</u><br />
<br><br><br />
<br />
<b>Primers for Pfu-mutagenese</b><br />
<p><b>1. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (31 bp)</b><br />
<br><br />
CTGATCGGTCCG<span style="background: black">AC</span><span style="background: red">T</span><span style="background: Black">GGT</span>TCCGGTAAAACGC<br />
<br><br><br />
<b>Reverse primer (5’->3’) (31 bp)</b><br />
<br><br />
GCGTTTTACCGGA<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>CGGACCGATCAG<span style="color:red"></span><br />
<br><br><br />
<br />
<p><b>2. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (28 bp)</b><br />
<br><br />
CATCCGCAGCAG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>TTGCAGGTTG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (28 bp)</b><br />
<br><br />
CAACCTGCAA<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CTGCTGCGGATG<br />
<br><br><br />
<br />
<p><b>3. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (25 bp)</b><br />
<br><br />
CGTGGATCTG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>CGTGACGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (25 bp)</b><br />
<br><br />
CTCGTCACG<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CAGATCCACG<br />
<br><br><br />
<br />
<p><b>4. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GGCGCGTAAA<span style="background: black">AC</span><span style="background: red">T</span><span style="background: black">GGT</span>GCCCGTGG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CCACGGGC<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>TTTACGCGCC<br />
<br><br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="NCLPX-L"></a><br />
∆NClpX-linker-∆NClpX-linker-∆NClpX - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365013"><font color="#E9AF03">BBa_K365013</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochrome B needs to be fixed to the Clpx hexametric part of the protease. It is possible to link one phytochrome B per ClpX monomer but this could lead to steric problems. So the decision was made to follow the idea of the publication of Tanja Baker 2009. This permits to have only one phytochrome B for three ClpX units. Moreover the publication proved that the speed of the assembly of two ClpX trimers is quite the same than with ClpX monomers. So the Clpx hexameric part is composed of two ClpX trimers each one couple with a phytochrome B. <br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/3f/ESBS-Strasbourg-ClpX-Trimere.png" width="250px" height="132px" border="0"><br />
</center><br />
<br><br><br />
<p><b>Conception:</b</p><br />
ClpX primer was constructed due to cloning methods. The new approach in this method is that the primer was built from a PCR product. The construction of the ClpX dimer was conducted with standard methods. Then in a PCR reaction the ClpX primers located inside of the dimer were used to construct this new primer. The product of this PCR was used as primer for constructing the ClpX trimer.<br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="L-NCLPX"></a><br />
(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365014"><font color="#E9AF03">BBa_K365014</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This construct was the final step for the ClpX hexamer creation. The two trimers will assemble to the full ClpX unit. Then the phytochrome B was cloned to this trimer. It will also be possible to add any other activation system like hormone receptors to this biobrick instead of phytochrome B, giving this part a huge potential of further applications.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/06/ESBS-Strasbourg-Linker-ClpX-Trimere.png" width="250px" height="132px" border="0"><br />
</center><br />
<br><br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing ClpX trimer and the linker part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Results/BiobricksTeam:ESBS-Strasbourg/Results/Biobricks2010-10-27T14:35:26Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=40 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Biobricks</div><br />
<div class="desc"><br />
<br><br><br />
<ul><br />
<br />
<li><a href="#PIF3">PIF3</a></li><br />
<li><a href="#PIF6">PIF6</a></li><br />
<li><a href="#PHYB908">PHY B 900</a></li><br />
<li><a href="#PHYB642">PHY B 650</a></li><br />
<li><a href="#NCLPX">∆N-ClpX</a></li><br />
<li><a href="#Linker">linker</a></li><br />
<li><a href="#LAA">LAA Tag</a></li><br />
<li><a href="#DAS">DAS Tag</a></li><br />
<li><a href="#Lambda">Lambda Tag</a></li><br />
<li><a href="#GFP">GFP (super fold)</a></li><br />
<li><a href="#PHYB642-CLPX3">PhyB642-(linker-∆NClpX)3</a></li><br />
<li><a href="#PHYB908-CLPX3">PhyB908-(linker-∆NClpX)3</a></li><br />
<li><a href="#CLPX">Full-length ClpX</a></li><br />
<li><a href="#NCLPX-L">∆NClpX-linker-∆NClpX-linker-∆NClpX</a></li><br />
<li><a href="#L-NCLPX">(linker-∆NClpX)3</a></li><br />
<br><br />
<br />
</ul><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly">Our Biobrick Assembly Technique</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=40 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Parts Submitted to Registry</div><br />
<br><br />
<br />
<br />
<br />
<br><br />
&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/3/3a/ESBS-Strasbourg-ClpXPSystem.jpg" width="400px" height="241px" border="0"><br />
&nbsp;&nbsp;&nbsp;<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="300px" height="182px" border="0"><br />
<br />
<br />
<br><br />
<br><br />
<br />
<center><br />
<br />
<table border="1" width="100%" bordercolorlight="#FFFFFF" bordercolordark="#222222" bordercolor="#FFFFFF"><br />
<tr><br />
<td width="165" bgcolor="#800000"><b><font size="4" color="#FFFFFF">Part <br />
Number:</font></b></td><br />
<td width="302" bgcolor="#800000"><b><font size="4" color="#FFFFFF">Part <br />
Name:</font></b></td><br />
<td width="223" bgcolor="#800000"><b><font size="4" color="#FFFFFF"><br />
Plasmid/Resistance</font></b></td><br />
<td width="187" bgcolor="#800000"><b><font size="4" color="#FFFFFF"><br />
Status</font></b></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365000"><br />
<font color="#000000">BBa_K365000</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PIF3">Phytochrome Interacting Factor-3 <br />
(PIF3)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365001"><br />
<font color="#000000">BBa_K365001</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PIF6">Phytochrome Interacting Factor-6 <br />
(PIF6)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365002"><br />
<font color="#000000">BBa_K365002</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB908">Phytochrome B (aa 1-908)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365003"><br />
<font color="#000000">BBa_K365003</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB642">Phytochrome B (aa 1-642)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365004"><br />
<font color="#000000">BBa_K365004</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#NCLPX">&#8710;N-ClpX (aa 61-425)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365005"><br />
<font color="#000000">BBa_K365005</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#Linker">Linker (aa 20)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365006"><br />
<font color="#000000">BBa_K365006</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#LAA">LAA tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365007"><br />
<font color="#000000">BBa_K365007</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#DAS">DAS tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365008"><br />
<font color="#000000">BBa_K365008</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#Lambda">Lambda tag</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365009"><br />
<font color="#000000">BBa_K365009</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#GFP">GFP (super fold)</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365010"><br />
<font color="#000000">BBa_K365010</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB642-CLPX3">PhyB642-(linker-&#8710;NClpX)3</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365011"><br />
<font color="#000000">BBa_K365011</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#PHYB908-CLPX3">PhyB908-(linker-&#8710;NClpX)3 </font><br />
</td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365012"><br />
<font color="#000000">BBa_K365012</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#CLPX">Full-length ClpX</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#009933"><font color="#FFFFFF">Sequenced</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365013"><br />
<font color="#000000">BBa_K365013</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="#NCLPX-L">&#8710;NClpX-linker-&#8710;NClpX-linker-&#8710;NClpX</font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#E9AF03"><br />
<a class="noul_link" target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365014"><br />
<font color="#000000">BBa_K365014</font></a></td><br />
<td width="302"><font color="#FFFFFF"><a href="L-NCLPX">(linker-&#8710;NClpX)3 </font></td><br />
<td width="223"><font color="#FFFFFF">pSB1C3 / Chloramphenicol</font></td><br />
<td width="187" bgcolor="#6600CC"><font color="#FFFFFF">Assembled</font></td><br />
</tr><br />
</table><br />
<br />
</center><br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<div id="windowbox" style="position:fixed; top:50%; right:3px; width:11%;"><br />
Colored restriction sites :<br><br />
<b><font color="#FF0000">EcoRI </font><font color="#C0C0C0">NotI </font><font color="#008000">XbaI </font><br />
<font color="#008080">NgoMIV</font><br><br />
<font color="#FF00FF">AgeI </font><font color="#FF6600">SpeI </font><font color="#C0C0C0">NotI </font><font color="#1F497D">PstI </font></b><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PIF3"></a><br />
Phytochrome Interacting Factor-3 (PIF3) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365000"><font color="#E9AF03">BBa_K365000</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
PIF3 is a downstream transcription factor in a well studied signaling pathway of A. thaliana, upon stimulation with red (650 nm) light, it binds directly to PhyB and translocates to the nucleus as a heterodimer where it modulates the transcription of response genes. PIF3 binds only the red-light-exposed form of phytochrome, Pfr, and shows no measurable binding affinity for the dark- or infrared-exposed Pr state.<br><br />
In our system target proteins are fused to PIF3 and tagged with the DAS degradation sequence which, through light activation, brings the degradation tag in proximity to ClpX.<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The light-sensitive interaction with PhyB has been mapped to the first 100-residue N-terminal activated phytochrome binding (APB) domain of PIF3 <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a><br><br />
We chose this sequence, as it has already been successfully used in different synthetic in vitro applications that benefitted from its light-sensitive interactions with PhyB. The original sequence contains an XbaI restriction site.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/8/8b/ESBS-Strasbourg-PIF3.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<a><i><b><font color="#FF0000" size="2">There is no PDB structure for the PIF3<br>The stucture below is modeled by homology using the server I-TASSER</font></i></b></a></font><br />
</center><br />
<br />
<br><br />
The plasmid containing the PIF3-sequence was provided by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#kircher">the laboratory of Stephan Kircher</a> from the University of Freiburg. For the synthesis of the BioBrick part primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.<br />
<br><br><br />
<b>Forward primer (5’->3’): 51 bp</b><br />
<br><br />
<span><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b>ATGCCTCTGTTTGAGC</span></p><br />
<br><br><br />
<b>Reverse primer (5’->3’): 51 bp</b><br />
<br><br />
<span style="color: #1F497D"><br />
ctgcag</span><span color: #B8CCE4">cggccgc</span><span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>ATGATGATTCAACCATGGAAC</span></p><br />
<br><br><br />
In order to get a sequence without an internal restriction sites of one of the BioBrick standards the XbaI-restriction site was altered without changing the encoded amino acid(TCT=Serin (TC(T,A,G,C)).<br />
<br><br><br />
<b>Primers for Pfu-mutagenese:</b><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GCAAACTCT<span style="background: black">TC</span><span style="background: red">A</span><span style="background: black">AGA</span>GCTAGAGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CTCTCTAGC<span style="background: black">TCT</span><span style="background: red">T</span><span style="background: black">GA</span>AGAGTTTGC<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PIF6"></a><br />
Phytochrome Interacting Factor-6 (PIF6) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365001"><font color="#E9AF03">BBa_K365001</font></a> <br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
For the design of the first engineered system that achieved to enable the spatiotemporal control of PhyB-PIF interactions in in-vivo experiments, <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a> screened multiple potential phytochrome–PIF pairs by a fluorescence translocation assay in NIH3T3 cells. They measured the red-light-induced translocation of yellow fluorescent protein (YFP) fused to PIF domains to co-expressed phytochrome domains fused through a flexible linker to mCherry and localized to the plasma membrane by a carboxyterminalpolybasic, prenylation sequence from Kras. Of all previously reported PIF domains, only the N terminus of PIF6 is strong enough to cause significant translocation of YFP to the membrane. <br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/c/c9/ESBS-Strasbourg-Pif6ex.jpg"><br />
</center><br />
<center><br />
<i><font size="1">Fig.1: Implied system of Lim and Voigt (2009) to screen potential phytochrome-PIF<br>pairs in a fluorescence translocation assay. </font></i><br />
</center><br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose used the same sequence of the last 100-residue N-terminal activated phytochrome binding (APB) domain of PIF6, which was already successfully used by <a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt, 2009.)</a>.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/23/ESBS-Strasbourg-PIF6.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<a><i><b><font color="#FF0000" size="2">There is no PDB structure for the PIF6<br>The stucture below is modeled by homology using the server I-TASSER</font></i></b></a></font><br />
</center><br />
<br />
<br />
<br><br><br />
The plasmid containing the PIF6-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. For the synthesis of the Pif6 BioBrick primers containing the sites of the Fusion Protein BioBrick Assembly Standard were used.<br />
<br><br><br />
<b>Forward primer (5’->3’): 54 bp</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b>ATGATGTTCTTACCAACCG<br />
<br><br><br />
<b>Reverse primer (5’->3’): 58 bp</b><br />
<br><br />
CAGCTG<span color: #1F497D">ctgcag</span><span color: #B8CCE4">cggccgc</span><span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>GTCAACATGTTTATTGCTTTCC<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB908"></a><br />
Phytochrome B (aa 1-908) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365002"><font color="#E9AF03">BBa_K365002</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>. The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm). <br />
<br><br><br />
The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it will be fused to the N-teminal of the ClpX-trimer.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
In in-vivo applications it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt (2009)</a></i> demonstrated by assaying PIF6 (which has the strongest interactions of all previously reported PIF domains) against different variants of PhyB that the tandem C-terminal PAS domains (residues 1-908)of plant phytochromes are necessary to confer rapid photoreversibility under infrared light.<br />
The original sequence contains a SpeI restriction within the first 908 residues.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-PhyB900.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
The plasmid containing the PhyB-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.<br />
<br><br> <br />
<b>Forward primer (5’->3’): (41bp)</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctag</span>ATGGTTTCCGGAGTC<br />
<br><br><br />
<b>Reverse primer (5’->3’): (52 bp)</b><br />
<br><br />
CAGCTG<u><span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span></u><b>t</b><u><span style="color: #F79646">actagt</span></u><b>atta</b><u><span style="color: #CC00FF">accggt</span></u>GCTCGGGATTTGCAAG<br />
<br><br><br />
In order to get a sequence without an internal restriction sites of one of the BioBrick standards the SpeI-restriction site was altered without changing the encoded amino acid (ACT=Threonine (AC(T,A,G,C)).<br />
<br><br><br />
<b>Primers for Pfu-mutagenese: </b><br />
<br><br />
<b>Forward primer (5’->3’): (28 bp)</b><br />
<br><br />
GGACAAGACGTT<span style="background: black">AC</span><span style="background: red">G</span><span style="background: black">AGT</span>CAGAAAATCG<br />
<br><br><br />
<b>Reverse primer (5’->3’): (28 bp)</b><br />
<br><br />
CGATTTTCTG<span style="background: black">ACT</span><span style="background: red">C</span><span style="background: black">GT</span>AACGTCTTGTCC<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB642"></a><br />
Phytochrome B (aa 1-642) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365003"><font color="#E9AF03">BBa_K365003</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochromes characterised by a red/far-red photochromicity. Through red-light (650–670 nm) absorption the phytochrome undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of the PIF. This light-sensitive interaction has been mapped to the 650-residue amino-terminal photosensory core of PhyB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i>. The process is completely reversible through absorption in the near infra-red spectrum (705–740 nm). <br />
<br><br><br />
The photoreceptor protein PhyB serves for the light-dependent activation of the system, therefore it was fused to the N-teminal of the ClpX-trimer. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
As mentioned before it has been shown that the PIF-interaction with the PhyB photosensory core (residues 1–650) is irreversible in infrared light in in vivo-application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i>. Nevertheless, the binding strength and kinetic parameters depend on the composition and nature of the individual system, so we decided to include also this shorter variant of PhyB in our tests.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/9/93/ESBS-Strasbourg-PhyB650.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
The plasmid containing the PhyB-sequence was provided by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment#weber">the laboratory of Wilfried Weber</a></i> from the University of Freiburg. To create the BioBrick part the sequence was amplified with primers containing the standard prefix with ATG and the fusion suffix of the Fusion Protein Assembly Standard.<br />
<br><br><br />
<b>Forward primer (5’->3’): (42 bp)</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctag</span>ATGGTTTCCGGAGTC<br />
<br><br><br />
<b>Reverse primer (5’->3’) : (53 bp)</b><br />
<br><br />
CAGCTG<u><span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span></u><b>t</b><u><span style="color: #F79646">actagt</span></u><b>atta</b><u><span style="color: #CC00FF">accggt</span></u>CCCCGCCATATCCCTAC<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="NCLPX"></a><br />
∆N-ClpX (aa 61-425) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365004"><font color="#E9AF03">BBa_K365004</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
ClpXP is a part of an E.coli protease which consists of three parts, the hexametric ClpX and two heptametrical ClpP subunits. ClpX consists of six identical subunits, each 1092bp long. ClpX recognizes and unfolds protein containing certain tags like LAA and leading them into the catalytic center of this protein complex, the two ClpP units. ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI.<br />
<br><br><br />
<p><b>Conception</b></p><br />
ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI. The purpose of this first experimental part was to extract the ClpX gene out of the E.coli genome, to alter the internal EcoRI and AgeI sides in the ClpX gene and to fuse iGEM fusion pre- and suffixes to the ClpX sequence in order to get an iGEM Biobrick with standard prefix and suffix standard without internal EcoRI, Not, XbaI, AgeI, SpeI and PstI sides. <br />
<br><br><br />
The sequence was obtained from the following database for DH5α E.coli cells:<br />
<br><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/gene/945083"><br />
1- http://www.ncbi.nlm.nih.gov/gene/945083</a></span></p><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&to=457924&report=gbwithparts"><br />
2- http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&amp;to=457924&amp;report=gbwithparts</a></p><br />
<br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/32/ESBS-Strasbourg-(-N)ClpX.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Problem: <span style="background: black">2 AgeI and 2 EcoRI sides</b><br />
<br><br><br />
<b>Primers for cloning ClpX out of the E.Coli genome.</b><br />
<br><br />
These primes were used to amplificate ClpX from the E.coli genome.<br />
<br><br><br />
<b>Forward primer (5’->3’) : 31bp</b><br />
<br><br />
<u>CGCAGTGCGCTACCGACGCCGCATGAAATTC</u><br />
<br><br><br />
<b>Reverse primer (5’->3’) : 32bp</b><br />
<br><br />
<u>TTCACCAGATGCCTGTTGCGCTTCCGGCTTGC</u><br />
<br><br><br />
<br />
<b>Primers for Pfu-mutagenese</b><br />
<p><b>1. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (31 bp)</b><br />
<br><br />
CTGATCGGTCCG<span style="background: black">AC</span><span style="background: red">T</span><span style="background: Black">GGT</span>TCCGGTAAAACGC<br />
<br><br><br />
<b>Reverse primer (5’->3’) (31 bp)</b><br />
<br><br />
GCGTTTTACCGGA<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>CGGACCGATCAG<span style="color:red"></span><br />
<br><br><br />
<br />
<p><b>2. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (28 bp)</b><br />
<br><br />
CATCCGCAGCAG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>TTGCAGGTTG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (28 bp)</b><br />
<br><br />
CAACCTGCAA<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CTGCTGCGGATG<br />
<br><br><br />
<br />
<p><b>3. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (25 bp)</b><br />
<br><br />
CGTGGATCTG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>CGTGACGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (25 bp)</b><br />
<br><br />
CTCGTCACG<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CAGATCCACG<br />
<br><br><br />
<br />
<p><b>4. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GGCGCGTAAA<span style="background: black">AC</span><span style="background: red">T</span><span style="background: black">GGT</span>GCCCGTGG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CCACGGGC<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>TTTACGCGCC<br />
<br><br><br />
<b>Primers for amplification of ClpX with fusion pre- and suffix</b><br />
<br><br />
After mutagenesis of internal restriction sides, the fusion pre- and suffixes were added to the ClpX gene.<br />
<br><br><br />
<b>Forward primer (5’->3’):</b><br />
<br><br />
GGATCC<span style="color:red">gaattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gccggc</span></b></span><span>CGCAGT</span><span>GCGCTACCGACGCCGC<br />
<br><br><br />
<b>Reverse primer (5’->3’):</b><br />
<br><br />
CAGCTG<span style="color: #1F497D">ctgcag</span><span style="color: #B8CCE4">cggccgc</span>t<span style="color: #F79646">actagt</span>atta<span style="color: #CC00FF">accggt</span>TTCACCAGATGCCTGTTGCGC<br />
<br><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="Linker"></a><br />
Linker (aa 20) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365005"><font color="#E9AF03">BBa_K365005</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
The linker biobrick is used to join the three ClpX subunits covalently in order to build a ClpX trimer and to link the degradation tags and PIF3/6 with the protein destined for degradation. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same linker, which was already successfully used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i> to construct the ClpX trimer. It is a twenty amino acid linker (ASGAGGSEGGGSEGGTSGAT). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition RFC 25 fusion prefix and suffix have been added to the sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d1/ESBS-Strasbourg-linker.png" width="250px" height="167px" border="0"><br />
</center><br />
<br />
<br><br><br />
The linker has been order as six separate, EcoRI+AgeI precut primers, which were hybridized in order to obtain the complete linker sequence.<br />
<br><br><br />
Forward strand (5’->3’) : (89 bp)<br />
<br><br />
aattc</span><span color: #B8CCE4">gcggccgc</span><span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gc|cggc</span></b>GCGAGCGGCGCGGGCGGCAGCGAAGGCGGCGGCAG|CGAAGGCGGCACCAGCGGCGCGACC<span style="color: #CC00FF">a</span><br />
<br><br><br />
Reverse strand (5’-3’) : (89 bp)<br />
<br><br />
<span style="color: #CC00FF">ccggt</span><span>GGTCGCGCCG|CTGGTGCCGCCTTCGCTGCCGCCGCCTTCGCTGCC|GCCCGCGCCGCTCGC<b><span style="color:#009999">gccggc</span></b>ca<span style="color:#00B050">tctaga</span>a<span style="color: #B8CCE4">gcggccgc</span><span style="color:red">g</span><br />
<br><br><br />
<b>Ordered primer:</b><br />
<br><br />
<p><br />
<span><br />
Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color:red">aattc</span><span style="color: #B8CCE4">gcggccgc</span>t<span style="color:#00B050">tctaga</span>tg<b><span style="color:#009999">gc<br />
</span></b>3’</span></p><br />
<p><br />
<span><br />
Forward: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:#009999">cggc</span></b></span><span>GCGAGCGGCGCGGGCGGCAGCGAAGGCGGCGGCAG <br />
3’</span></p><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’CGAAGGCGGCACCAGCGGCGCGACC<span style="color: #CC00FF">a </span>3’</span></p><br />
<p><br />
<span><br />
Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color:#CC00FF">ccggt</span></span><span>GGTCGCGCCG <br />
3’</span></p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’CTGGTGCCGCCTTCGCTGCCGCCGCCTTCGCTGCC 3’</span></p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />
5’GCCCGCGCCGCTCGC<b><span style="color:#009999">gccggc</span></b>ca<span style="color:#00B050">tctaga</span>a<span style="color: #B8CCE4">gcggccgc</span><span style="color:red">g</span>3’<br />
<br><br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="LAA"></a><br />
LAA tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365006"><font color="#E9AF03">BBa_K365006</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
LAA tag is a C-terminal region of the natural ssrA-recognition sequence of E. Coli that interacts with the ClpXP protease. A protein fused with this tag will be preferentially degraded by the ClpX protease without need of an adaptor protein <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same tag, which was already successfully used by used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. It is a eleven amino acid tag (AANDENYALAA). At the end of the coding sequence a double stop codon was added (<span style="color: #F79646">ACTAGT</span>). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence and NgoMIV and Pst1 restriction sites have been added to the sequence.<br />
<br><br><br />
The LAA-tag has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the degradation sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/3e/ESBS-Strasbourg-LAAtag.png" width="250px" height="167px" border="0"><br />
</center><br />
<center><br />
<i><font size="2">LAA Tag</font></i><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style=" color: #009999">CCGGC</span></b><span>GCGCTGGCGGCGTAATAAT<span style="color: #F79646">ACTAGT</span>A<span style="color: #B8CCE4">GCGGCCG</span><span style="color: #1F497D">C</span>3’</p><br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’ <span style=" color: #1F497D"><br />
TGCAG</span><span>C<span style="color: #B8CCE4">GGCCGC</span>T<span style="color: #F79646">ACTAGT</span>ATTATTACGCCGCCAGCGC<b><span style="color:#009999">G</span></b><br />
<br />
3’</span></p><br />
<br><br><br />
For the synthesis of the PstI-site a mistake occurred in the command of the primers, as we did not consider that PstI cuts in the (3’ -> 5’) sens, contrary to the other restriction enzymes of the BioBrick standard. A supplementary step of ligation digestion in the experimental procedure can fix this mistake.<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="DAS"></a><br />
DAS tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365007"><font color="#E9AF03">BBa_K365007</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<p><b>Background:</b></p><br />
The DAS tag presents a C-terminal recognition sequence that has been artificially altered so that it has weakened interactions with ClpXP and depends on an adaptor <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. In E. coli, the adaptor SspB tethers specifically tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In our system, the role of the adaptor-protein SspB has been assumed by Pif3/6. So only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>Conception:</b></p><br />
We decided to use the same tag, which was already successfully used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2006)</a></i>. It is a eleven amino acid tag (AANDENYADAS). At the end of the coding sequence a double stop codon was added (<span style="color: #F79646">ACTAGT</span>). The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition NgoMIV and PST1 restriction sites have been added to the sequence.<br />
<br><br><br />
The DAS-tag has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the degradation sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/23/ESBS-Strasbourg-DAStag.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style=" color: #009999"><br />
CCGGC</span></b><span>GCGGATGCGAGCTAATAAT<span style="color: #F79646">ACTAGT</span>A<span style="color: #B8CCE4">GCGGCCG</span><span style="color: #1F497D">C</span>3’</p><br />
<br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<span style="color: #1F497D"><br />
TGCAG</span><span style="color: #B8CCE4">CGGCCGC</span><span>T<span style="color: #F79646">ACTAGT</span>ATTATTAGCTCGCATCCGC<b><span style="color:#009999">G</span></b><br />
<br />
3’</span></p><br />
<br><br><br />
For the synthesis of the PstI-site a mistake occurred in the command of the primers, as we did not consider that PstI cuts in the (3’ -> 5’) sens, contrary to the other restriction enzymes of the BioBrick standard. A supplementary step of ligation digestion in the experimental procedure can fix this mistake. <br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="Lambda"></a><br />
Lambda tag - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365008"><font color="#E9AF03">BBa_K365008</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
The λO- tag is the N-terminal equalent to the DAS tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
<br><br><br />
<p><b>Conception:</b></p><br />
We chose to use the same sequence, which was already successfully used by used by <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer (2009)</a></i>: NH2-TNTAKILNFGR. The codon usage of E. coli <i><a href="http://www.geneinfinity.org/sp_codonusage.html">(http://www.geneinfinity.org/sp_codonusage.html)</a></i> has been used to decide the DNA sequence, in addition NgoMIV and AgeI restriction sites have been added to the sequence. <br />
<br><br><br />
The linker has been order as two separate, <span style="color: #009999">NgoMIV </span>+ <span style="color: blue">Pst1</span> precut primers, which were hybridized in order to obtain the complete linker sequence.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/0a/ESBS-Strasbourg-Lambdatag.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Ordered primer</b><br />
<br><br />
<p><br />
<span>Forward:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:#009999">AATTC</span></b>GCGGCCGCTTCTAGATGACCAACACCGCGAAAATTCTGAACTTTGGCCGCA 3’<br />
<p><br />
<span>Reverse:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5’<b><span style="color:blue">CCGGT</span></b>GCGGCCAAAGTTCAGAATTTTCGCGGTGTTGGTCATCTAGAAGCGGCCGCG 3’</p><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="GFP"></a><br />
GFP (super fold) - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365009"><font color="#E9AF03">BBa_K365009</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
The GFP super fold protein originated from the BBa_I746915. This old biobrick contains the normal standard prefix and suffix. When this GFP is now fused to another biobrick a stop codon is created which would terminate the transcription of the fused biobrick. To avoid this inconvenience, we improved this biobrick to the fusion standard BBF RFC 25. This new biobrick can now be added to any biobrick with compatible restriction sides without creating a stop codon.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/c/cd/ESBS-Strasbourg-GFP.png" width="300px" height="163px" border="0"><br />
</center><br />
<br><br />
<p><b>Conception</b></p><br />
Standard PCR techniques were used. The Primer for amplification contained the fusion pre- and suffix and compatible base pair for the GFP gene. <br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB642-CLPX3"></a><br />
PhyB642-(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365010"><font color="#E9AF03">BBa_K365010</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This final construct will be the inducible part of the protease system. This permits the linking of the phytochrome B to the Clpx trimer which forms the light-dependent activation part of our degradation system.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/ESBS-Strasbourg-PhyB650-clpx3.png" width="296px" height="206px" border="0"><br />
</center><br />
<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing linker- ClpX trimer and the PhyB part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="PHYB908-CLPX3"></a><br />
PhyB908-(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365011"><font color="#E9AF03">BBa_K365011</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This final construct will be the inducible part of the protease system. This permits the linking of the phytochrome B to the Clpx trimer which forms the light-dependent activation part of our degradation system.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/0f/ESBS-Strasbourg-PhyB908-clpx3.png" width="296px" height="206px" border="0"><br />
</center><br />
<br><br />
<br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing linker- ClpX trimer and the PhyB part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="CLPX"></a><br />
Full-length ClpX - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365012"><font color="#E9AF03">BBa_K365012</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background</b></p><br />
ClpXP is a part of an E.coli protease which consists of three parts, the hexametric ClpX and two heptametrical ClpP subunits. ClpX consists of six identical subunits, each 1092bp long. ClpX recognizes and unfolds protein containing certain tags like LAA and leading them into the catalytic center of this protein complex, the two ClpP units. ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI.<br />
<br><br><br />
<p><b>Conception</b></p><br />
ClpX has two internal restriction sides for EcoRI and two restriction sides for AgeI. The purpose of this first experimental part was to extract the ClpX gene out of the E.coli genome, to alter the internal EcoRI and AgeI sides in the ClpX gene and to fuse iGEM fusion pre- and suffixes to the ClpX sequence in order to get an iGEM Biobrick with standard prefix and suffix standard without internal EcoRI, Not, XbaI, AgeI, SpeI and PstI sides. <br />
<br><br><br />
The sequence was obtained from the following database for DH5α E.coli cells:<br />
<br><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/gene/945083"><br />
1- http://www.ncbi.nlm.nih.gov/gene/945083</a></span></p><br />
<p><a target="_blank" href="http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&to=457924&report=gbwithparts"><br />
2- http://www.ncbi.nlm.nih.gov/nuccore/49175990?from=456650&amp;to=457924&amp;report=gbwithparts</a></p><br />
<br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d1/ESBS-Strasbourg-ClpXfull.png" width="250px" height="167px" border="0"><br />
</center><br />
<br><br><br />
<b>Problem: <span style="background: black">2 AgeI and 2 EcoRI sides</b><br />
<br><br><br />
<b>Primers for cloning ClpX out of the E.Coli genome.</b><br />
<br><br />
These primes were used to amplificate ClpX from the E.coli genome.<br />
<br><br><br />
<b>Forward primer (5’->3’) : 31bp</b><br />
<br><br />
<u>CGCAGTGCGCTACCGACGCCGCATGAAATTC</u><br />
<br><br><br />
<b>Reverse primer (5’->3’) : 32bp</b><br />
<br><br />
<u>TTCACCAGATGCCTGTTGCGCTTCCGGCTTGC</u><br />
<br><br><br />
<br />
<b>Primers for Pfu-mutagenese</b><br />
<p><b>1. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (31 bp)</b><br />
<br><br />
CTGATCGGTCCG<span style="background: black">AC</span><span style="background: red">T</span><span style="background: Black">GGT</span>TCCGGTAAAACGC<br />
<br><br><br />
<b>Reverse primer (5’->3’) (31 bp)</b><br />
<br><br />
GCGTTTTACCGGA<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>CGGACCGATCAG<span style="color:red"></span><br />
<br><br><br />
<br />
<p><b>2. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (28 bp)</b><br />
<br><br />
CATCCGCAGCAG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>TTGCAGGTTG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (28 bp)</b><br />
<br><br />
CAACCTGCAA<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CTGCTGCGGATG<br />
<br><br><br />
<br />
<p><b>3. GAA=Glu GA(A,G), TTC=Phe TT(C,T)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;EcoRI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (25 bp)</b><br />
<br><br />
CGTGGATCTG<span style="background: black">GA</span><span style="background: red">G</span><span style="background: black">TTC</span>CGTGACGAG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (25 bp)</b><br />
<br><br />
CTCGTCACG<span style="background: black">GAA</span><span style="background: red">C</span><span style="background: black">TC</span>CAGATCCACG<br />
<br><br><br />
<br />
<p><b>4. ACC=Thr AC(A,T,G,C), GGT=Gly GG(A,T,G,C)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;AgeI site</b></p><br />
<br><br />
<b>Forward primer (5’->3’) (24 bp)</b><br />
<br><br />
GGCGCGTAAA<span style="background: black">AC</span><span style="background: red">T</span><span style="background: black">GGT</span>GCCCGTGG<br />
<br><br><br />
<b>Reverse primer (5’->3’) (24 bp)</b><br />
<br><br />
CCACGGGC<span style="background: black">ACC</span><span style="background: red">A</span><span style="background: black">GT</span>TTTACGCGCC<br />
<br><br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="NCLPX-L"></a><br />
∆NClpX-linker-∆NClpX-linker-∆NClpX - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365013"><font color="#E9AF03">BBa_K365013</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
Phytochrome B needs to be fixed to the Clpx hexametric part of the protease. It is possible to link one phytochrome B per ClpX monomer but this could lead to steric problems. So the decision was made to follow the idea of the publication of Tanja Baker 2009. This permits to have only one phytochrome B for three ClpX units. Moreover the publication proved that the speed of the assembly of two ClpX trimers is quite the same than with ClpX monomers. So the Clpx hexameric part is composed of two ClpX trimers each one couple with a phytochrome B. <br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/3/3f/ESBS-Strasbourg-ClpX-Trimere.png" width="250px" height="132px" border="0"><br />
</center><br />
<br><br><br />
<p><b>Conception:</b</p><br />
ClpX primer was constructed due to cloning methods. The new approach in this method is that the primer was built from a PCR product. The construction of the ClpX dimer was conducted with standard methods. Then in a PCR reaction the ClpX primers located inside of the dimer were used to construct this new primer. The product of this PCR was used as primer for constructing the ClpX trimer.<br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
<a name="L-NCLPX"></a><br />
(linker-∆NClpX)3 - <a target="_blank" href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K365014"><font color="#E9AF03">BBa_K365014</font></a><br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
<p><b>Background:</b></p><br />
This construct was the final step for the ClpX hexamer creation. The two trimers will assemble to the full ClpX unit. Then the phytochrome B was cloned to this trimer. It will also be possible to add any other activation system like hormone receptors to this biobrick instead of phytochrome B, giving this part a huge potential of further applications.<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/0/06/ESBS-Strasbourg-Linker-ClpX-Trimere.png" width="250px" height="132px" border="0"><br />
</center><br />
<br><br><br />
<p><b>Conception:</b></p><br />
The standards cloning methods were used. This includes digestion of the vector containing ClpX trimer and the linker part then the ligation of them and to finish the transformation of competente cells with this plasmid.<br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/TeamTeam:ESBS-Strasbourg/Team2010-10-27T13:58:02Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/f/fa/ESBS-Strasbourg-Blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=65 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">THE TEAM</div><br />
<div class="desc"><br />
<a href="#under"><b>Undergraduates</b></a><br><br />
<ul><br />
<li><a href="#camille">Camille Bernard</a></li><br />
<li><a href="#fabian">Fabian Stiefel</a></li><br />
<li><a href="#georgio">Georgio Kourjian</a></li><br />
<li><a href="#jens">Jens-Sebastian Kalchschmidt</a></li><br />
<li><a href="#morgane">Morgane Griesbeck</a></li><br />
<li><a href="#pierre">Pierre Dillard</a></li><br />
<li><a href="#raphael">Raphaël Doineau</a></li><br />
<li><a href="#renaud">Renaud Renault</a></li><br />
<li><a href="#sebastien">Sebastien Pigeot</a></li><br />
<li><a href="#thea">Thea Ziegler</a></li><br />
<li><a href="#yohann">Yohann Lacotte</a></li><br />
<li><a href="#yves">Yves Gendrault</a></li><br />
</ul><br />
<br><br />
<a href="#advisors"><b>Advisors</b></a><br><br />
<ul><br />
<li><a href="#jacques">Pr. Jacques Haiech</a></li><br />
</ul><br />
<br><br />
<a href="#instructors"><b>Instructors</b></a><br><br />
<ul><br />
<li><a href="#maria">Dr. Maria Zeniou</a></li><br />
<li><a href="#christophe">Pr. Christophe Lallement</a></li><br />
<li><a href="#morgan">Dr. Morgan Madec</a></li><br />
</ul><br />
<br><br />
<br />
<a href="#uni"><b>Our Universities</b></a><br><br />
<ul><br />
<li><a href="#bs">ESBS - Biotech School</a></li><br />
<li><a href="#uni">University of Strasbourg</a></li><br />
</ul><br />
<br><br />
<a href="#collaboration"><b>Collaboration</b></a><br><br />
<br><br />
<br />
<br />
<br />
</td><br />
<td width="10" rowspan=65 bgcolor="#800000"><br />
</div><br />
<br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" height="420"><br />
<div class="heading"><br />
OUR TEAM<br />
</div><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/8/81/ESBS_Strasboug_wiki.JPG" width="500" height="375"><br />
</center><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#800000" height="10"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="under"></a><br />
<div class="heading"><br />
UNDERGRADUATES<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="camille"></a><br />
Camille Bernard<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/3/3d/Bernard_Camille.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Camille has begun her cursus by studying chemistry, physics and mathematics in Classe Prépa. Then she decided to enter in a biotechnology school (ESBS) in Strasbourg because she was keen to learn how the living works. She was interested in taking part of this experience insofar as it is a chance to lead a project since the beginning, from the idea to the culmination. Furthermore it was the opportunity to work with a motivated team and to test our limits. Besides, Camille loves Morgane’s cake; it is the best ATP source in the world!!<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="fabian"></a><br />
Fabian Stiefel<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Stiefel_Fabian.jpg" <br />
height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Fabian is now in the ninth semester and so at his last year as student at the Ecole supérieure de Biotechnology de Strasbourg (ESBS). Before he entered the ESBS he studied two years of chemistry at the University of Freiburg, Germany. The idea of trilingual courses in four Universities in three different countries was and is very thrilling to him. He is very fond of synthetic biology and he wants to continue in this domain of research for his diploma/ master thesis. He finds it also very exciting to work with a highly motivated team on a self chosen project for the summer.<br />
<br />
<br>Three weeks before the jamboree he had discovered a great new game - the blender animation program. Since then, when he haves time, he unleashes his new skills on the innocent ClpXP protease and his friends, stretching and bending them into models and pictures and forcing them to move.<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="georgio"></a><br />
Georgio Kourjian<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/3/31/Kourjian_Georgio.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Georgio joined the Ecole supérieure de Biotechnology de Strasbourg (ESBS) after he got his B.Sc degree in Biochemistry at the University of the Mediterranean in Marseille France. Currently he is in the last year of the master’s program in this trinational Biotechnology school. He was interested about synthetic biology and the idea of designing and building new biological functions and systems not found in nature that is why he joined the ESBS iGEM team. He thinks that participating at the iGEM competition is a very enriching experience.<br />
<br><br />
For him diploma thesis a part of his work will be the use of synthetic biology for medical purposes.<br />
<br><br />
He was mainly responsible of the wiki creation.<br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="jens"></a><br />
Jens-Sebastian Kalchschmidt<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/d/d8/Kalchschmidt_Jens_Sebastian.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Jens is in his last year as student at the Ecole supérieure de Biotechnology de Strasbourg (ESBS). Before he enrolled in the ESBS he studied 2 years molecular biotechnology at the University of Heidelberg, Germany. He decided to take the chance to continue his biotechnology studies within the trilingual study course biotechnology at the ESBS implicating four universities in three countries. In retrospect, he must say that it was absolutely the right choice and the first long-term contact with the international research community. His research interests focus mostly on immunology and infectious diseases, but the iGEM participation sparked his interest in synthetic biology.<br />
<br />
<p>Personal remark: Marathon preparation can be best done during incubation times.</p><br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="morgane"></a><br />
Morgane Griesbeck<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/0/04/Griesbeck_Morgane.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Morgane did her cursus in the so-called « classes préparatoires » where she studied Mathematics, Physcis and Chemistry. She chose then to study Biotechnology, choice she has never regretted. She was very interested in the experience provided by conducting a project from scratch. She was especially attracted by the interdisciplinary aspect of synthetic biology and the juncture of biology and engineering. Besides, Morgane loves chocolate and did amazing chocolate cakes called « Indémoulable de Jean-François ». </div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="pierre"></a><br />
Pierre Dillard<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Dillard_Pierre.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Pierre is currently in his ninth semester at the ESBS. Previously he has done two years in CPGE BCPST where he received a good education in mathematics, physics, chemistry and biology. In the ESBS he specialized himself in synthetic biology because he think that this field can be the future of the biology. iGEM was a seducing project for him because of the intellectual challenge and the team work. To see the evolves of the project all summer long was very grateful. He enjoys also all the new skills acquired during this work.<br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="raphael"></a><br />
Raphaël Doineau<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b1/Doineau_Raphael.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Raphael is just like the other in his ninth semester at the ESBS. Originally from a math physics and chemistry curriculum he chose the ESBS for his international orientation and the synthetic biology approach of biotechnology. In order to obtain further biological background knowledge and skills, he decided to interrupt his curriculum to perform two six months internships in two different labs before continuing ESBS and joining the iGEM team.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="renaud"></a><br />
Renaud Renault<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/e/ef/Renault_Renaud-glow.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Also known as Reno carré (Reno square) he tends to be famous for his experiments on the lack of sleep on himself. As some of his fellows, he is in the third year of ESBS, after having intensively studied Maths, Physics, Biology, Chemistry, and even more for 2 years in Classe Prépa. Since that time, he has been a MATLAB freak, coding some cool stuff you can see on his youtube channel (for instance <a href="http://www.youtube.com/watch?v=vm0qQlzh0hw">http://www.youtube.com/watch?v=vm0qQlzh0hw</a>) and earns his living (sushis are quite expensive) by doing clinical trials. He got interested in Synthetic Biology quite early, and more especially with the iGEM competition. He originally got the idea of engineering a controllable protease which was the basis of our project and is really glad that others were as excited and motivated about it as him.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="sebastien"></a><br />
Sebastien Pigeot<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/Pigeot_Sebastien.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Sébastien decided to study biology after obtaining his A level. He studied for two years in a special school combining half practical courses and half theoretical courses. After completing those two years he decided to travel and did a Bachelor in Science at the Heriot Watt University, Edinburgh. Finally, he returned to France to Strasbourg and joined the ESBS (Ecole Supérieure de Biotechnologie de Strasbourg). He discovered a tri-national school with a great atmosphere and he is really enjoying it. He decided to take part to the igem competition with some of his friends because it is a very challenging competition and he was attracted by the fact to be autonomous toward the reflection and the manipulations. So far he has not been deceived in his expectations.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="thea"></a><br />
Thea Ziegler<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/0/07/Thea_Ziegler.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Thea started her studies at the Humboldt University Berlin with the Bachelor program of Biophysics. As the trinational conception and organization of the ESBS captivated her, she left the German capital after finishing the 4th semester and went to Strasbourg to continue with the diploma course in Biotechnology. In the current last year of her studies she decided to specialize in Synthetic Biology and to take part of the iGEM competition. Behind the basic idea of iGEM she was attracted of the opportunity to work independently without limitations in creativity. She is very satisfied with the theme her team chose, the role and functioning of photoreceptors fascinate her since the early beginning of her studies. In the future she wants to continue within this field.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="yohann"></a><br />
Yohann Lacotte<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a1/Lacotte_Yohann.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Yohann had pretty much the same curriculum than his copartners coming from "Classe Prépa". He is particularly interested in neurophysiology, biophysics and of course, synthetic biology.<br><br />
He likes to go to movie theatre, draw some manga and sing in the shower, but not at the same time natürlich. Although he really enjoys watching some cartoons on TV before his daily nap, he can also be a brutal extrem lab worker all day AND night long. Unfortunately for us, his good mood is proportional to the success rate of his experiments, but once he decided to succeed, he can manage the impossible. Within iGEM, he thus can be seen as the man of the situation, as far as clearing the hurdles is concerned.<br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="yves"></a><br />
Yves Gendrault<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b0/Gendrault_Yves.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
After obtaining his bachelor's degree in Electronique, Signaux et Automatique (ESA), Yves does a Master’s degree in Micro-and Nano-Electronique (MNE) at the Université de Strasbourg (UdS). He discovers the field of Synthetic Biology during an internship in the Institut d'Electronique du Solide et des Systèmes (InESS) laboratory in Strasbourg. During this internship he creates models for several biological processes. Because Synthetic Biology is situated between engineer sciences and biotechnologies, the collaboration with biotechnologists is for him fundamental for a better understanding. He thinks that the iGEM competition is a very interesting experience of this kind of collaboration in an international team.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"></td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="advisors"></a><br />
<div class="heading"><br />
ADVISORS<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="jacques"></a><br />
<div class="name"><br />
Pr. Jacques Haiech<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/Haiech.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Jacques Haiech got a M.D. degree in Mathematics and computer science in 1975 and then a M.D. and a PhD degree in Biochemistry in 1978 dealing with cell signaling (focusing on calcium signal in muscle cells). After his PhD, he has been working part time successively at NCI in Bethesda, then at Vanderbilt University and finally at Northwestern University (Chicago) while being research director at Centre National de la Recherche Scientifique in France, studiyng cellular calcium signals before joining the Strasbourg University as a full professor in 1997. He has founded the first synthetic biology option in an engineering school in France in 2008 along with the first participation of the ESBS-Team to the iGEM competition. Since then, he has developed collaboration with the Strasbourg engineering school of physics on “Design Methodology and Modeling of Synthetic Biosystems”. He is now working in integrating concepts of synthetic biology in personalized medicine.<br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"></td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="instructors"></a><br />
<div class="heading"><br />
INSTRUCTORS<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="maria"></a><br />
<div class="name"><br />
Dr. Maria Zeniou<br />
</div><br />
<div class="profiles"><br />
<img src="http://medchem.u-strasbg.fr/pages/permanents/photos/zeniou.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Maria Zeniou graduated as a molecular biologist in 2002. Her PhD project included genetic studies of an X-linked inherited disorder and functional studies on the protein kinase whose loss of function leads to this disease.<br />
After her PhD, she performed a four-year post-doc in molecular and cellular biology. Within this period, she studied the roles and the regulation of lipid modifying enzymes during the process of regulated hormone exocytosis from neuroendocrine cells.<br />
In 2007, she joined the Strasbourg University as an assistant professor and since 2008 she participates to the iGEM teams of the Ecole Supérieure de Biotechnology de Strasbourg (ESBS) as an instructor. The aim of her current research project is to better understand the physiopathology of gliomas.<br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="christophe"></a><br />
<div class="name"><br />
Pr. Christophe Lallement<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/Lallement_Christophe.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Christophe Lallement received the M.S. degree in engineering from the Science University of Nancy I, Nancy, France, and the Ph.D. degree in engineering from the École Nationale Supérieure des Télecommunications, Paris, France. From November 1994 to September 1997, he was a Postdoctoral Research Scientist with the Laboratory of Electronics, Swiss Federal Institute of Technology in Lausanne (EPFL), Lausanne, Switzerland, working on the characterization and modeling of the metal-oxide-semiconductor field effect transistor (MOSFET) in the development team of the Enz-Krummenacher-Vittoz MOSFET model. In September 1997, he was an Associate Professor with the Université de Strasbourg (UdS), Strasbourg, France, and the Laboratory for Physics and Applications of Semiconductors, Centre National de la Recherche Scientifique. Since September 2003, he has been a Professor with the École Nationale Supérieure de Physique de Strasbourg, Illkirch, France. He is currently with the Institut d’Électronique du Solide et des Systèmes (InESS), UdS, working on the study and the modeling of advanced devices, very-high-speed integrated-circuit hardware description language analog and mixed-signal systems, and biosynthetic systems. He is the responsible for the group “Integrated Instrumental Systems” at InESS.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="morgan"></a><br />
<div class="name"><br />
Dr. Morgan Madec<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/Madec_Morgan.jpg" height="200" width="150"><br />
</div><br />
<br />
<div class="desc"><br />
Morgan Madec was born in 1980. He received the M.S. and Ph.D. degrees in microelectronics from the University Louis Pasteur (ULP), Strasbourg, France, in 2003 and 2006 respectively. From 2003 to 2006, he was with the Laboratoire de Physique et Application des Semi-Conducteurs (PHASE), ULP Centre National de Recherches Scientifiques, Strasbourg, where he prepared a Ph.D. thesis on the design, the simulation and the characterization of optical processors in order to speed up image reconstruction in the medical field.<br />
<br><br />
He is currently a Professor Associate with the Institut d’Électronique du Solide et des Systèmes, Université de Strasbourg, Strasbourg and teaches electronics in the Ecole Nationale Supérieure de Physique de Strasbourg, University of Strasbourg. <br />
<br><br />
His research interests include compact modeling of integrated microsensors (Hall-effect sensor, photodiode ...). <br />
Since 2008, he collaborates with a team of the Laboratoire d’Innovation Therapeutique. The aim of this work is to put the experience in microelectronics system design to good use in synthetic biology.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="bs"></a><br />
<div class="heading"><br />
ESBS - Biotech School<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<br><br />
<img src="http://irebs.u-strasbg.fr/IMG/jpg/PanoESBS2008-2.jpg"><br />
</center><br />
<br><br />
<p><b>ESBS - Ecole Superieure de Biotechnologie de Strasbourg</b></p><br />
The three-year curriculum in Biotechnology is organized by the “Upper Rhine Universities” in Freiburg, Basel, Karlsruhe and Strasbourg. Students from France, Germany and Switzerland receive an interdisciplinary and intensive, trilingual education in biotechnology.<br />
<br />
Most of the lectures take place at the École Supérieure de Biotechnologie de Strasbourg (ESBS) in Strasbourg. Intensive laboratory courses and internships are offered by the universities Basel, Freiburg and Karlsruhe.The languages for lectures and exams are French, German and English.<br />
<br />
Students for this program are selected after successful completion of two years of undergraduate education in sciences or engineering at a university or an equivalent institution.The degree obtained in this program is completed within 6 semesters. Each of the four partner universities is responsible for part of the program, according to their special strengths in research, resulting in a diverse program covering a wide spectrum of current research. All aspects of biotechnology are covered, from molecular biology to microbiology, bioprocess engineering and biocomputing. Lectures in patent law, economics and professional language courses complete the program. In the third year, students can focus on specialized areas, such as bioproduction or bioinformatics.<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"><br />
</td><br />
</tr><br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="uni"></a><br />
<div class="heading"><br />
THE UNIVERSITY OF STRASBOURG<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<br><br />
<img src="http://www.observatoiredessubventions.com/wp-content/uploads/universite-Strasbourg-subventions-aides.JPG"><br />
</center><br />
<br><br />
European by nature and international by design, the University's strengths and assets stem from its active involvement in virtually every discipline comprising the current body of knowledge.<br />
As a young university founded on an age-old tradition, it strives to attain cross-disciplinarity so that this mixing fosters new research opportunities and produces courses that meet society's need. The international dimension is fundamental for the University of Strasbourg and thanks to the world wide reputation of its research teams, built on excellence and efficiency, it emerges among Europe's foremost research universities. Each of the University's main academic fields of instruction is based upon research sections that are the driving force of the institution, with over 2,600 professors and 2,000 staff.<br />
The Technology Transfer Office, one of the very first developed in a French university, strives to promote the work of the researchers and facilitate partnerships with economic and institutional stakeholders.<br />
An essential player in the promotion of scientific and technical culture, the University interfaces with its host city, Strasbourg.<br />
<br />
Solidly anchored in the European Higher Education Area, the University of Strasbourg, a beating heart of the Alsatian metropolis with its 41,000 students, has the potential to face the challenging international competition.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"><br />
</td><br />
</tr><br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="collaboration"></a><br />
<div class="heading"><br />
Collaboration<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<br><br><br />
<br />
<center><br />
<div><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="420" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5516756369958846513%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJrAlpPV3cnrMg%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div><br />
</center><br />
<br><br />
<br />
We set up a collaboration with the iGEM 2010 <a href="https://2010.igem.org/Team:Freiburg_Bioware">Team Freiburg_Bioware</a>, they provided us with the YFP and CFP assembled biobricks cloned into standard pSB1C3 backbone.<br />
<br><br><br />
We visited the Freiburg Team at their lab. Both teams made a presentation of their project and gave some ideas and impressions about the project and iGEM in general.<br />
<br><br><br />
After the serious part, we enjoyed together a nice barbecue on the roof of the University of Freiburg.<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
<br />
</td><br />
</tr><br />
</table><br />
</body><br />
<br />
</p></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-27T13:06:25Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Renner and Moroder, 2006)</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
A complex understanding of living cells requires methods to affect and control the activities of their constituent proteins at fine spatial and temporal resolutions. Measuring responses to precise perturbations, allows the testing and improvement of predictive models of cellular networks.<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Griffith and Grossman, 2008)</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br><br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial applications. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-27T12:50:19Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from the MIT.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d7/ESBS-Strasbourg-Clpp.png" width="220px" height="316px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-clpx.png" width="217px" height="316px"><br />
</center><br />
<br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/ESBS-Strasbourg-PhyB.png" width="192px" height="316px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
<p><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i> </span></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Wu and Lagarias)</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Quail and Koloszvari)</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.(2009)</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and coworkers</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/c/c3/ESBS-Strasbourg-Phybdomain.png" width="148px" height="270px" align="left"><br />
<p>&nbsp;</p><br />
<p><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> in a novel background. </span></p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lamparter and Hughes, 2001)</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/82/ESBS-Strasbourg-ImageProteinfinal%2B.png" width="239px" height="168px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></p><br />
<br />
<br />
<br><br><br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Park and Song, 2008)</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"(>Baker and Sauer)</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/87/ESBS-Strasbourg-System.png" width="192px" height="317px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">“Engineering Synthetic Adaptors and Substrates for Controlled ClpXP Degradation” from Tania Baker and al. </a></i></span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br> <br />
<br><br><br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Houry W. A. et al, 2003; Maurizi M. R. et al., 1998)</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the DAS-degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but it remains inactive until light-induction. However, it is expected to stay active for the background of naturally SsrA-tagged proteins, creating no interference with the natural occurring proteins of E.coli.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in a ClpX-deficient E. Coli strain.<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-27T12:42:56Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from the MIT.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d7/ESBS-Strasbourg-Clpp.png" width="220px" height="316px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-clpx.png" width="217px" height="316px"><br />
</center><br />
<br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/ESBS-Strasbourg-PhyB.png" width="192px" height="316px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
<p><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i> </span></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Wu and Lagarias)</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Quail and Koloszvari)</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.(2009)</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and coworkers</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/c/c3/ESBS-Strasbourg-Phybdomain.png" width="148px" height="270px" align="left"><br />
<p>&nbsp;</p><br />
<p><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> in a novel background. </span></p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<br><br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lamparter and Hughes, 2001)</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/82/ESBS-Strasbourg-ImageProteinfinal%2B.png" width="239px" height="168px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></p><br />
<br />
<br />
<br><br><br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Park and Song, 2008)</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"(>Baker and Sauer)</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/87/ESBS-Strasbourg-System.png" width="192px" height="317px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">“Engineering Synthetic Adaptors and Substrates for Controlled ClpXP Degradation” from Tania Baker and al. </a></i></span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br> <br />
<br><br><br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Houry W. A. et al, 2003; Maurizi M. R. et al., 1998)</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in an E. Coli deficient in ClpX. (ClpX knocked out)<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/ProjectTeam:ESBS-Strasbourg/Project2010-10-27T12:25:57Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#degradation">1. Degradation system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#light">2. Light detection system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<div class="heading">A light-controllable specific protein degradation system as new standard for synthetic biology</div><br />
</center><br />
<center><br />
<br><br />
<br><br />
<body><br />
<object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br />
</body><br />
</center><br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
Abstract<br />
</div><br />
<div class="desc"><br />
<br><br />
The aim of our project is to engineer a light-inducible degradation system as a new fundamental component that can be easily used to build more complex biological circuits inside chassis organisms. This new component consists of the bacterial protease ClpXP from Escherichia Coli fused to the photoreceptor protein phytochrome B of Arabidopsis thaliana. The degradation system is universally applicable to any given protein by addition of a specially designed Biobrick containing the phytochrome interacting factor (PIF3/6) and a specific degradation sequence (DAS-tag). This Biobrick can be added to the C-terminal of the target protein by standard assembly methods. Illumination of red light (660nm) induces a conformational change in phytochrome B and activates the system, an impulse of far-red light (730nm) leads to disruption of the degradation. This allows a tight control over the catalytic activity, enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility. <br />
<br><br><br />
<br><br />
<br />
<p><b>Theoretical Background:</b></p><br />
<br><br />
Our system contains several parts: the bacterial ClpXP protease from E. Coli and the specific recognition sequence (DAS-tag) for ClpX for the degradation part as the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
The ClpXP proteases consist of three main parts: the ClpX unit and two units of ClpP. The ClpX forms a hexametric ring and binds to a double heptamer of ClpP. The ClpX is responsible for recognizing proteins bearing a specific degradation tag, unfolding and leading them into the catalytic core of the enzyme, where two ClpP subunits break down the peptides bonds.<br />
<br><br><br />
PhyB is characterized by a red/far-red photochromicity. Through red-light absorption (650–670 nm)PhyB undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of different interacting factors (PIF).The process is completely reversible through absorption in the near infra-red spectrum (705-740nm). PhyB is fused tothe N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme (thanks to the findings of Baker & Sauer in 2005). <br />
<br><br><br />
Target proteins are fused to the PIF and tagged with the specific degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal. <br />
<br><br><br />
In the native organism, the SsrA tag is added to incomplete proteins whose translation has been aborted. Thus, misfunctionnal proteins do not accumulate inside the cell. To engineer controlled degradation, Baker and Sauer (2006) designed a series of modified SsrA tags that have weakened interactions with ClpXP. The DAS-tag presents one of these artificial sequence; its Kd value is significantly higher than the one of wild type SsrA, thus degradation of DAS-tagged proteins is not significant within the range of physiological concentrations. However, through the action of the adaptor protein SspB which helps tethering the tagged protein to the protease, DAS-tagged proteins are significantly degraded. <br />
<br><br><br />
<p><b>In our system this adaptator will be replaced by a light sensitive tethering system.</b></p><br />
<br><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/ProjectTeam:ESBS-Strasbourg/Project2010-10-27T11:54:54Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice"><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#degradation">1. Degradation system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#light">2. Light detection system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<div class="heading">A light-controllable specific protein degradation system as new standard for synthetic biology</div><br />
</center><br />
<center><br />
<br><br />
<br><br />
<body><br />
<object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br />
</body><br />
</center><br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
Abstract<br />
</div><br />
<div class="desc"><br />
<br><br />
The aim of our project is to engineer a light-inducible degradation system as a new fundamental component that can be easily used to build more complex biological circuits inside chassis organisms. This new component consists of the bacterial protease ClpXP from Escherichia Coli fused to the photoreceptor protein phytochrome B of Arabidopsis thaliana. The degradation system is universally applicable to any given protein by addition of a specially designed Biobrick containing the phytochrome interacting factor (PIF3/6) and a specific degradation sequence (DAS-tag). This Biobrick can be added to the C-terminal of the target protein by standard assembly methods. Illumination of red light (660nm) induces a conformational change in phytochrome B and activates the system, an impulse of far-red light (730nm) leads to disruption of the degradation. This allows a tight control over the catalytic activity, enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility. <br />
<br><br><br />
<br><br />
<br />
<p><b>Theoretical Background:</b></p><br />
<br><br />
Our system contains several parts: the bacterial ClpXP protease from E. Coli, the specific recognition sequence (DAS-tag) for ClpX for the degradation part, the photoreceptor protein phytochrome B (PhyB) and phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system. <br />
<br><br><br />
- Degradation : The ClpXP proteases consist of three main parts: the ClpX unit and two units of ClpP. The ClpX forms a hexametric ring and binds to a double heptamer of ClpP. The ClpX is responsible for recognizing proteins bearing a specific degradation tag, unfolding and leading them into the catalytic core of the enzyme, where two ClpP subunits break down the peptides bonds.<br><br />
<br><br />
- Light sensitivity: PhyB is characterized by a red/far-red photochromicity. Through red-light absorption (650–670 nm )PhyB undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of different interacting factors (PIF).The process is completely reversible through absorption in the near infra-red spectrum (705-740nm).<br />
PhyB is fused tothe N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme (thanks to the findings of Baker & Sauer in 2005). <br />
<br><br><br />
Target proteins are fused to the PIF and tagged with the specific degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal. <br />
<br><br><br />
The system can be constitutively expressed in the chassis but remains inactive until light-induction. However it is expected to stay active for the background of naturally SsrA-tagged proteins, creating no interference with the natural occurring proteins of E.coli. <br />
<br><br><br />
In the native organism, the SsrA tag is added to incomplete proteins whose translation has been aborted. Thus, misfunctionnal proteins do not accumulate inside the cell. To engineer controlled degradation, Baker and Sauer (2006) designed a series of modified SsrA tags that have weakened interactions with ClpXP. This is the DAS tag. The DAS tag has a higher Kd value than wild type SsrA tag, thus degradation of DAS-tagged proteins is not significant within the range of physiological concentrations. However, through the action of an adaptor protein (SspB) which hepls tethering the tagged protein to the protease, DAS-tagged proteins are significantly degraded. <br />
<br><br><br />
<p><b>Our idea is to replace this adaptator system with a light sensitive tethering system.</b></p><br />
<br><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-26T20:24:46Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<div class="heading"><br />
&nbsp;&nbsp;<br />
</div><br />
<div class="desc"><br />
<div class="heading">Synthetic Photoreceptors:</div><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Möglich & Moffath, 2010)</a></i>.<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The reason for the great success was probably that it can be genetically encoded and expressed in the desired location, affording non-invasive and reversible control over neural processes with high spatiotemporal resolution. The new generation of recently developed engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; wavelengths that are well tolerated by biological systems and that have good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for the artificially designed systems based on the implementation of naturally occurring light-sensitive domain or the use of semi-synthetic photoactive allosteric modulators. <br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Because of their generic nature engineered photoreceptors can be used to control a broad range of biological processes in intact cells and organism. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Levskaya et. al (2009) </a></i>demonstrated an application of such a tool to visualize cell shape at a high resolution. <br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module. This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-26T20:23:57Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<div class="heading"><br />
&nbsp;&nbsp;<br />
</div><br />
<div class="desc"><br />
<div class="heading">Synthetic Photoreceptors:</div><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins17,18. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Möglich & Moffath, 2010)</a></i>.<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The reason for the great success was probably that it can be genetically encoded and expressed in the desired location, affording non-invasive and reversible control over neural processes with high spatiotemporal resolution. The new generation of recently developed engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; wavelengths that are well tolerated by biological systems and that have good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for the artificially designed systems based on the implementation of naturally occurring light-sensitive domain or the use of semi-synthetic photoactive allosteric modulators. <br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Because of their generic nature engineered photoreceptors can be used to control a broad range of biological processes in intact cells and organism. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Levskaya et. al (2009) </a></i>demonstrated an application of such a tool to visualize cell shape at a high resolution. <br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module. This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-26T20:20:11Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
&nbsp;&nbsp;<br />
</div><br />
<div class="desc"><br />
<div class="heading">Synthetic Photoreceptors:</div><br />
<br><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins17,18. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Möglich & Moffath, 2010)</a></i>.<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The reason for the great success was probably that it can be genetically encoded and expressed in the desired location, affording non-invasive and reversible control over neural processes with high spatiotemporal resolution. The new generation of recently developed engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; wavelengths that are well tolerated by biological systems and that have good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for the artificially designed systems based on the implementation of naturally occurring light-sensitive domain or the use of semi-synthetic photoactive allosteric modulators. <br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Because of their generic nature engineered photoreceptors can be used to control a broad range of biological processes in intact cells and organism. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Levskaya et. al (2009) </a></i>demonstrated an application of such a tool to visualize cell shape at a high resolution. <br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module. This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-26T19:59:17Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Renner and Moroder, 2006)</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
A complex understanding of living cells requires methods to affect and control the activities of their constituent proteins at fine spatial and temporal resolutions. Measuring responses to precise perturbations, allows the testing and improvement of predictive models of cellular networks.<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. Moreover, suppressions of a protein by recombination or CreLox methods are more difficult to set up, as the suppression is irreversible it can be lethal for the cells. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Griffith and Grossman, 2008)</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br>br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial application in multi -step synthesizes. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br />
<br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-26T19:58:40Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<center><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Team_ESBS-Strasbourg_construction.jpg"><br />
</center><br />
<br><br />
&nbsp;&nbsp;</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
&nbsp;&nbsp;<br />
</div><br />
<div class="desc"><br />
<div class="heading">Synthetic Photoreceptors:</div><br />
<br><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins17,18. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Möglich & Moffath, 2010)</a></i>.<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The reason for the great success was probably that it can be genetically encoded and expressed in the desired location, affording non-invasive and reversible control over neural processes with high spatiotemporal resolution. The new generation of recently developed engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; wavelengths that are well tolerated by biological systems and that have good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for the artificially designed systems based on the implementation of naturally occurring light-sensitive domain or the use of semi-synthetic photoactive allosteric modulators. <br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Because of their generic nature engineered photoreceptors can be used to control a broad range of biological processes in intact cells and organism. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Levskaya et. al (2009) </a></i>demonstrated an application of such a tool to visualize cell shape at a high resolution. <br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module. This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-26T19:56:41Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Renner and Moroder, 2006)</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
A complex understanding of living cells requires methods to affect and control the activities of their constituent proteins at fine spatial and temporal resolutions. Measuring responses to precise perturbations, allows the testing and improvement of predictive models of cellular networks.Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. Moreover, suppressions of a protein by recombination or CreLox methods are more difficult to set up, as the suppression is irreversible it can be lethal for the cells. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Griffith and Grossman, 2008)</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br>br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial application in multi -step synthesizes. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br />
<br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Notebook/SyntethicTeam:ESBS-Strasbourg/Notebook/Syntethic2010-10-26T19:48:56Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<div class="desc"><br />
&nbsp;&nbsp;<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
<br><br />
<a href="-">&nbsp;&nbsp;</a><br />
<br><br><br />
<a href="http://">&nbsp;&nbsp;</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">&nbsp;&nbsp;</div><br />
<center><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Team_ESBS-Strasbourg_construction.jpg"><br />
</center><br />
<br><br />
&nbsp;&nbsp;</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
&nbsp;&nbsp;<br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
The use and design of Synthetic Photoreceptors is a promising approach in Synthetic Biology, as light is an ideal tool to gain spatiotemporal control of biological processes<br />
<br><br><br />
Photoreceptors respond to light absorption with a change in biological activity that elicits a physiological response. Since the biological activity of photoreceptors is light-dependent, light can be used to control their function and thus the behavior of entire cells and organisms in which they are expressed. The identification, understanding and following application of fluorescent proteins have been a revolution in molecular biology due to the improved ability to MONITOR cellular processes. In great contrast, the application of photoreceptors allows us even to CONTROL cellular behavior by light.<br />
<br><br><br />
There are six different classes of photoreceptors distinguished by their chromophores and photochemistry: light-oxygen-voltage (LOV) sensors, xanthopsins, phytochromes, blue-light sensors using flavin adenine dinucleotide (BLUF), cryptochromes, and rhodopsins17,18. The two classes which are currently most widely used in the design of engineered photoreceptors are LOV domains and phytochromes (Möglich & Moffath, 2010).<br />
<br><br><br />
The first in vivo applications of natural photoreceptors were in the domain of neurosciences using the light-sensitive cation channel channelrhodopsin. The reason for the great success was probably that it can be genetically encoded and expressed in the desired location, affording non-invasive and reversible control over neural processes with high spatiotemporal resolution. The new generation of recently developed engineered photoreceptors now extends the repertoire of light-regulated tools. Phytochromes are especially attractive for biological applications because they respond to changes in the red and far-red region of the electromagnetic spectrum; wavelengths that are well tolerated by biological systems and that have good tissue penetrance.<br />
<br><br><br />
Based on the properties and architecture of natural photoreceptors, artificially photoreceptors with novel light-regulated functions have been successfully designed and used to control molecular activity and cellular behavior. There have been various examples for the artificially designed systems based on the implementation of naturally occurring light-sensitive domain or the use of semi-synthetic photoactive allosteric modulators. <br />
<br><br><br />
In Synthetic Biology there is a special interest of coupling the activity of targeted proteins to light signals. Synthetic photoreceptor interaction modules can be integrated in genetic circuits enlarging the power and accessibility of tool sets and methods available in this emerging field. Because of their generic nature engineered photoreceptors can be used to control a broad range of biological processes in intact cells and organism. The high spatial and temporal resolution and non-invasiveness of light control allows the construction of new analytical tools. Levskaya et. al (2009) demonstrated an application of such a tool to visualize cell shape at a high resolution. <br />
<br><br><br />
An improved mechanistic understanding of different, natural photoreceptor classes and the work on further examples of engineered photoreceptors will provide an improved basis for the design and application of novel groundbreaking synthetic photoreceptors.<br />
<br><br><br />
The possibility to render any arbitrary biological functionality, especially in mammalian cells, light-dependent would extend their present applications as clever tool in cell biology to a clinical standard module. This design of such a synthetic light-gated module is an appealing future objective in Synthetic Biology, as the use of such a device would present a general approach without the need for time-consuming case-by-case engineering.<br />
<br><br />
<br><br />
<br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-26T17:34:17Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Renner and Moroder, 2006)</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. Moreover, suppressions of a protein by recombination or CreLox methods are more difficult to set up, as the suppression is irreversible it can be lethal for the cells. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Griffith and Grossman, 2008)</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br>br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial application in multi -step synthesizes. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br />
<br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-26T17:33:21Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Renner and Moroder, 2006)</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br />
<a name="knock"></a><br />
<p><b>A universal tool for protein analysis</b></p><br />
<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. Moreover, suppressions of a protein by recombination or CreLox methods are more difficult to set up, as the suppression is irreversible it can be lethal for the cells. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Griffith and Grossman, 2008)</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br>br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system would be useful in any domain of research. The tight control of light regulation should enable gene expression to be spatially and temporally controlled, leading to potential applications in the production of biological material composites and the study of multicellular signalling networks. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses. In the beginning, the protein levels are at native concentration. After a light impulse the degradation system is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out with an on and off switch. After this an alternation of light impulses turn the system on and off in certain time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment of protein concentration in the cells.</font></i></a></div><br />
</center><br />
<br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial application in multi -step synthesizes. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 500px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1" >Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor, the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence, CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a></div><br />
</center><br />
<br />
<br><br><br><br><br><br><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br />
<br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limits are imagination and motivation.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<br />
<div style="position: relative; width: 550px; height: 100px; id="layer1" align="justify"><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm, CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm. Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a>.</font></i></a></div><br />
<br />
</center><br />
<br><br><br><br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/ProjectTeam:ESBS-Strasbourg/Project2010-10-26T11:32:45Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#degradation">1. Degradation system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#light">2. Light detection system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<div class="heading">A light-controllable specific protein degradation system as new standard for synthetic biology</div><br />
</center><br />
<center><br />
<br><br />
<br><br />
<body><br />
<object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br />
</body><br />
</center><br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
Abstract<br />
</div><br />
<div class="desc"><br />
<br><br />
The aim of our project is to engineer a light-inducible degradation system as a new fundamental component that can be easily used to build more complex biological circuits inside chassis organisms. This new component consists of the bacterial protease ClpXP from Escherichia Coli fused to the photoreceptor protein phytochrome B of Arabidopsis thaliana. The degradation system is universally applicable to any given protein by integration into the especially designed Biobrick containing the phytochrome interacting factor (PIF3/6) and a specific degradation sequence (DAS-tag). This Biobrick can be added to the C-terminalof the target protein by standard assembly methods. Illumination with far-red light leads to the disruption of degradation. This allows a tight control over the catalytic activity enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br><br />
<br><br />
<br><br />
<p><b>Theoretical Background:</b></p><br />
<br><br />
Our system contains several parts: the bacterial ClpXP protease from E. Coli as the specific recognition sequences (DAS-tag) for ClpX for the degradation part and the photoreceptor protein phytochrome B (PhyB) and phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system.<br />
<br><br><br />
- Degradation : The ClpXP proteases consist of three main parts: the ClpX unit and two units of ClpP. The ClpX forms a hexametric ring and binds to a double heptamer of ClpP. The ClpX is responsible for recognizing proteins bearing a specific degradation tag, unfolding and leading them into the catalytic core of the enzyme, the two ClpP subunits which break down peptide bonds.<br><br />
<br><br />
- Light sensitivity: PhyB is characterised by a red/far-red photochromicity. Through red-light absorption (650–670 nm )PhyB undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of different interacting factors (PIF).The process is completely reversible through absorption in the near infra-red spectrum (705-740nm).<br><br />
PhyB is fused the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme (thanks to the findings of Baker & Sauer in 2005) .<br />
<br><br><br />
Target proteins are fused to the PIF and tagged with the specific degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<br><br />
The system can be constitutively expressed in the chassis but remains inactive until light-induction. However it is expected to stay active for the background of naturally SsrA-tagged proteins, so that it does not interfere with the natural occuring proteins of E.coli. <br />
<br><br><br />
<br><br />
In the native organism, the SsrA tag is added to incomplete proteins whose translation has been aborted. Thus, misfunctionnal proteins do not accumulate inside the cell. To engineer controlled degradation, Baker and Sauer (2006) designed a series of modified ssrA tags that have weakened interactions with ClpXP. The DAS tag has a higher Kd value than wild type SsrA tag, thus degradation of DAS-tagged proteins is not significant within the range of physiological concentrations. However, through the action of an adaptor protein (SspB) which hepls tethering the tagged protein to the protease, DAS-tagged proteins are significantly degraded.<br />
<br><br><br />
<p><b>Our idea is to replace this adaptator system with a light sensitive tethering system.</b></p><br />
<br><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/ProjectTeam:ESBS-Strasbourg/Project2010-10-26T11:32:10Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#degradation">1. Degradation system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#light">2. Light detection system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<div class="heading">A light-controllable specific protein degradation system as new standard for synthetic biology</div><br />
</center><br />
<center><br />
<br><br />
<br><br />
<body><br />
<object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br />
</body><br />
</center><br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
Abstract<br />
</div><br />
<div class="desc"><br />
<br><br />
The aim of our project is to engineer a light-inducible degradation system as a new fundamental component that can be easily used to build more complex biological circuits inside chassis organisms. This new component consists of the bacterial protease ClpXP from Escherichia Coli fused to the photoreceptor protein phytochrome B of Arabidopsis thaliana. The degradation system is universally applicable to any given protein by integration into the especially designed Biobrick containing the phytochrome interacting factor (PIF3/6) and a specific degradation sequence (DAS-tag). This Biobrick can be added to the C-terminalof the target protein by standard assembly methods. Illumination with far-red light leads to the disruption of degradation. This allows a tight control over the catalytic activity enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br><br />
<br><br />
<br><br />
<p><b>Theoretical Background:</b></p><br />
<br><br />
Our system contains several parts: the bacterial ClpXP protease from E. Coli as the specific recognition sequences (DAS-tag) for ClpX for the degradation part and the photoreceptor protein phytochrome B (PhyB) and phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system.<br />
<br><br><br />
- Degradation : The ClpXP proteases consist of three main parts: the ClpX unit and two units of ClpP. The ClpX forms a hexametric ring and binds to a double heptamer of ClpP. The ClpX is responsible for recognizing proteins bearing a specific degradation tag, unfolding and leading them into the catalytic core of the enzyme, the two ClpP subunits which break down peptide bonds.<br><br />
<br><br />
- Light sensitivity: PhyB is characterised by a red/far-red photochromicity. Through red-light absorption (650–670 nm )PhyB undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of different interacting factors (PIF).The process is completely reversible through absorption in the near infra-red spectrum (705-740nm).<br><br />
PhyB is fused the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme (thanks to the findings of Baker & Sauer in 2005) .<br />
<br><br><br />
Target proteins are fused to the PIF and tagged with the specific degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<br><br />
The system can be constitutively expressed in the chassis but remains inactive until light-induction. However it is expected to stay active for the background of naturally SsrA-tagged proteins, so that it does not interfere with the natural occuring proteins of E.coli. <br />
<br><br><br />
<br><br />
In the native organism, the SsrA tag is added to incomplete proteins whose translation has been aborted. Thus, misfunctionnal proteins do not accumulate inside the cell.<br />
<br><br><br />
To engineer controlled degradation, Baker and Sauer (2006) designed a series of modified ssrA tags that have weakened interactions with ClpXP. The DAS tag has a higher Kd value than wild type SsrA tag, thus degradation of DAS-tagged proteins is not significant within the range of physiological concentrations. However, through the action of an adaptor protein (SspB) which hepls tethering the tagged protein to the protease, DAS-tagged proteins are significantly degraded.<br />
<br><br><br />
<p><b>Our idea is to replace this adaptator system with a light sensitive tethering system.</b></p><br />
<br><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/ProjectTeam:ESBS-Strasbourg/Project2010-10-26T11:30:55Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#degradation">1. Degradation system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#light">2. Light detection system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<div class="heading">A light-controllable specific protein degradation system as new standard for synthetic biology</div><br />
</center><br />
<center><br />
<br><br />
<br><br />
<body><br />
<object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br />
</body><br />
</center><br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
Abstract<br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
The aim of our project is to engineer a light-inducible degradation system as a new fundamental component that can be easily used to build more complex biological circuits inside chassis organisms. This new component consists of the bacterial protease ClpXP from Escherichia Coli fused to the photoreceptor protein phytochrome B of Arabidopsis thaliana. The degradation system is universally applicable to any given protein by integration into the especially designed Biobrick containing the phytochrome interacting factor (PIF3/6) and a specific degradation sequence (DAS-tag). This Biobrick can be added to the C-terminalof the target protein by standard assembly methods. Illumination with far-red light leads to the disruption of degradation. This allows a tight control over the catalytic activity enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br><br />
<br><br />
<br><br />
<p><b>Theoretical Background:</b></p><br />
<br><br />
Our system contains several parts: the bacterial ClpXP protease from E. Coli as the specific recognition sequences (DAS-tag) for ClpX for the degradation part and the photoreceptor protein phytochrome B (PhyB) and phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system.<br />
<br><br><br />
- Degradation : The ClpXP proteases consist of three main parts: the ClpX unit and two units of ClpP. The ClpX forms a hexametric ring and binds to a double heptamer of ClpP. The ClpX is responsible for recognizing proteins bearing a specific degradation tag, unfolding and leading them into the catalytic core of the enzyme, the two ClpP subunits which break down peptide bonds.<br><br />
<br><br />
- Light sensitivity: PhyB is characterised by a red/far-red photochromicity. Through red-light absorption (650–670 nm )PhyB undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of different interacting factors (PIF).The process is completely reversible through absorption in the near infra-red spectrum (705-740nm).<br><br />
PhyB is fused the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme (thanks to the findings of Baker & Sauer in 2005) .<br />
<br><br><br />
Target proteins are fused to the PIF and tagged with the specific degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<br><br />
The system can be constitutively expressed in the chassis but remains inactive until light-induction. However it is expected to stay active for the background of naturally SsrA-tagged proteins, so it will not interfere with the natural occuring proteins of E.coli. <br />
<br><br><br />
<br><br />
In the native organism, the SsrA tag is added to incomplete proteins whose translation has been aborted. Thus, misfunctionnal proteins do not accumulate inside the cell.<br />
<br><br><br />
To engineer controlled degradation, Baker and Sauer (2006) designed a series of modified ssrA tags that have weakened interactions with ClpXP. The DAS tag has a higher Kd value than wild type SsrA tag, thus degradation of DAS-tagged proteins is not significant within the range of physiological concentrations. However, through the action of an adaptor protein (SspB) which hepls tethering the tagged protein to the protease, DAS-tagged proteins are significantly degraded.<br />
<br><br><br />
<p><b>Our idea is to replace this adaptator system with a light sensitive tethering system.</b></p><br />
<br><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/ProjectTeam:ESBS-Strasbourg/Project2010-10-26T11:25:02Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#degradation">1. Degradation system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#light">2. Light detection system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<div class="heading">A light-controllable specific protein degradation system as new standard for synthetic biology</div><br />
</center><br />
<center><br />
<br><br />
<br><br />
<body><br />
<object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br />
</body><br />
</center><br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
Abstract<br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
The aim of our project is to engineer a light-inducible degradation system as a new fundamental component that can be easily used to build more complex biological circuits inside chassis organisms. This new component consists of the bacterial protease ClpXP from Escherichia Coli fused to the photoreceptor protein phytochrome B of Arabidopsis thaliana. The degradation system is universally applicable to any given protein by integration into the especially designed Biobrick containing the phytochrome interacting factor (PIF3/6) and a specific degradation sequence (DAS-tag). This Biobrick can be added to the C-terminalof the target protein by standard assembly methods. Illumination with far-red light leads to the disruption of degradation. This allows a tight control over the catalytic activity enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but remains inactive for the tagged protein. However it is expected to stay active for the background of naturally SsrA tagged proteins and so it will not interfere with the metabolism of E.coli. Instantly after the light inducement the system is turned on, due to the lack of transcriptional or translational delay and is expected to remain active until another light signal turns it off.<br />
<br><br><br />
In our modeling part we will used this system for a genetic oscillator which could be used for multi step synthesis. <br />
<br><br><br />
<p><b>Theoretical Background:</b></p><br />
<br><br />
Our system contains several parts: the bacterial ClpXP protease from E. Coli as the specific recognition sequences (DAS-tag) for ClpX for the degradation part and the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system.<br />
<br><br><br />
- Degradation : The ClpXP proteases consist of three main parts: the ClpX unit and two units of ClpP. The ClpX forms a hexametric ring and binds to a double heptamer of ClpP. The ClpX is responsible for recognizing proteins bearing a specific degradation tag, unfolding and leading them into the catalytic core of the enzyme, the two ClpP subunits which break down peptide bonds.<br><br />
<br><br />
- Light sensitivity: PhyB is characterised by a red/far-red photochromicity. Through red-light absorption (650–670 nm )PhyB undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of different interacting factors (PIF).The process is completely reversible through absorption in the near infra-red spectrum (705-740nm).<br><br />
PhyB is fused the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme (thanks to the findings of Baker & Sauer in 2005) .<br />
<br><br><br />
Target proteins are fused to the PIF and tagged with the specific degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<br><br />
Note : In the native organism, the SsrA tag is added to incomplete proteins whose translation has been aborted. Thus, misfunctionnal proteins do not accumulate inside the cell.<br />
<br><br><br />
To engineer controlled degradation, Baker and Sauer (2006) designed a series of modified ssrA tags that have weakened interactions with ClpXP. The DAS tag has a higher Kd value than wild type SsrA tag, thus degradation of DAS-tagged proteins is not significant within the range of physiological concentrations. However, through the action of an adaptor protein (SspB) which hepls tethering the tagged protein to the protease, DAS-tagged proteins are significantly degraded.<br />
<br><br><br />
<p><b>Our idea is to replace this adaptator system with a light sensitive tethering system.</b></p><br />
<br><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/ProjectTeam:ESBS-Strasbourg/Project2010-10-26T11:00:56Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#degradation">1. Degradation system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#light">2. Light detection system</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<div class="heading">A light-controllable specific protein degradation system as new standard for synthetic biology</div><br />
</center><br />
<center><br />
<br><br />
<br><br />
<body><br />
<object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/Vb1Y7lsKEho?hl=en&fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br />
</body><br />
</center><br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141""><br />
<br><br />
<div class="heading"><br />
Abstract<br />
</div><br />
<div class="desc"><br />
<br><br />
<br><br />
The aim of our project is to engineer a new fundamental component that could be universally used to build more complex or more controllable biological circuits inside chassis organisms. This new component consists of the E.coli protease ClpXP to which the phytochrome B of arabidopsis thaliana is fused. Any given protein can be degraded as long as it is tagged with our especially designed Biobrick containing a PIF sequence. This Biobrick can be added to the C-terminal end by standard assembly methods. The activity of this system is tightly controlled and reversible by light inducement.<br />
<br><br><br />
The system can be constitutively expressed in the chassis but remains inactive for the tagged protein. However it is expected to stay active for the background of naturally SsrA tagged proteins and so it will not interfere with the metabolism of E.coli. Instantly after the light inducement the system is turned on, due to the lack of transcriptional or translational delay and is expected to remain active until another light signal turns it off.<br />
<br><br><br />
In our modeling part we will used this system for a genetic oscillator which could be used for multi step synthesis. <br />
<br><br><br />
<p><b>Theoretical Background:</b></p><br />
<br><br />
Our system contains several parts: the bacterial ClpXP protease from E. Coli as the specific recognition sequences (DAS-tag) for ClpX for the degradation part and the photoreceptor protein phytochrome B (PhyB) and the phytochrome interacting factor (PIF3/6) from A. thaliana for the light-dependent part of the system.<br />
<br><br><br />
- Degradation : The ClpXP proteases consist of three main parts: the ClpX unit and two units of ClpP. The ClpX forms a hexametric ring and binds to a double heptamer of ClpP. The ClpX is responsible for recognizing proteins bearing a specific degradation tag, unfolding and leading them into the catalytic core of the enzyme, the two ClpP subunits which break down peptide bonds.<br><br />
<br><br />
- Light sensitivity: PhyB is characterised by a red/far-red photochromicity. Through red-light absorption (650–670 nm )PhyB undergoes a rapid conformational change from its ground state Pr to its active state Pfr. The structural change allows the binding of different interacting factors (PIF).The process is completely reversible through absorption in the near infra-red spectrum (705-740nm).<br><br />
PhyB is fused the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme (thanks to the findings of Baker & Sauer in 2005) .<br />
<br><br><br />
Target proteins are fused to the PIF and tagged with the specific degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<br><br />
Note : In the native organism, the SsrA tag is added to incomplete proteins whose translation has been aborted. Thus, misfunctionnal proteins do not accumulate inside the cell.<br />
<br><br><br />
To engineer controlled degradation, Baker and Sauer (2006) designed a series of modified ssrA tags that have weakened interactions with ClpXP. The DAS tag has a higher Kd value than wild type SsrA tag, thus degradation of DAS-tagged proteins is not significant within the range of physiological concentrations. However, through the action of an adaptor protein (SspB) which hepls tethering the tagged protein to the protease, DAS-tagged proteins are significantly degraded.<br />
<br><br><br />
<p><b>Our idea is to replace this adaptator system with a light sensitive tethering system.</b></p><br />
<br><br />
<br><br><br />
</div><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Results/AssemblyTeam:ESBS-Strasbourg/Results/Assembly2010-10-26T10:02:16Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Biobrick Assembly</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#technique">Technique</a></li><br />
<li><a href="#trouble">Troubleshooting</a></li><br />
<li><a href="#improvements">Improvements</a></li><br />
</ul><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<a name="technique"></a><br />
<div class="heading">A new standard for multiple Biobrick assembly</div><br />
<a name="technique"></a><br />
<br><br><br />
<br />
The standard Biobrick assembly technique provides an easy method to assemble two different biobricks. However, due to the transformation step this technique is very slow and inefficient when fusing several different biobricks together. <br />
<br><br><br />
The new multiple Biobrick assembly technique is a fast and efficient method if several biobricks have to be fused. It doesn't require a transformation step between different assemblies! <br />
<br><br><br />
It uses the primers of the standard biobrick verification (verification forward (VF) and verification reverse (VR)) and the same enzymes as the classic three-way ligation, which are provided by the assembly kit. However it is recommended for fusion biobricks which should be expressed by the same promoter not to use the standard enzymes EcoRI and SpeI as these enzymes create stop codons between the biobricks. For fusion biobricks the enzymes NgoMIV and AgeI should be used as described in BBF RFC 25 protocol.<br />
<br><br><br />
This technique consists of two PCR's, one digestion, one ligation and one separation on a low melting point gel. The technique functions as it is explained in figure 1.<br />
<br><br><br />
Step one is a normal PCR with the primers VF and VR. PCR program and conditions should be selected according to the fragments which are to be amplified. <br />
<br><br><br />
Step two is a digestion either with AgeI or NgoMIV. It is very important to heat inactivate the restriction enzymes before going to step three.<br />
<br><br><br />
Step three is a short ligation under standard parameters for 30 min. In this step many side products can occur. A deeper analysis of this step is provided in the troubleshooting part.<br />
<br><br><br />
Step four is again a PCR reaction under normal conditions with the primers VF and VR. As the ligation step produces side products, several PCR band can occur on a verification gel. This makes step five necessary.<br />
<br><br><br />
Step five is a separation on a low melting point (LMP) gel (1 % of low melting point agaraose). The band with the desired size can be cut out and extracted via a Quaigen gel extraction kit. <br />
<br><br><br />
After step five a purified amplified fused biobrick product is obtained. It can be immediately used to be fused to a third biobrick without cloning into a plasmid and the transformation into a host organism like E.coli.. After repeating this protocol to fuse the three, four or even more biobricks together a final product can be cloned into any plasmid. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/8/8b/ESBS-Strasbourg-NewTechnique.jpg" width="550" height="472"><br />
</center><br />
<center><br />
<i><font size="1">Figure 1 The new standard in multiple Biobrick assembly technique. First step is the PCR amplification out of the iGEM vector<br>using primer VF and VR. The following step is the digestion with either AgeI or NgoMIV. Third step is a ligation for 30 min.<br> Fourth step is the amplification via PCR with the primers VF and VR. In Step five the right band is separated and selected<br> through a LMP gel and extracted via the Quaigen gel extraction kit.</font></i><br />
</center><br />
<br><br />
<br />
<br />
<a name="trouble"></a><br />
<div class="heading">Troubleshooting</div><br />
<br />
<br><br><br />
The ligation step creates several different products. This occurs because the NgoMIV and AgeI enzymes are restriction enzymes which cut the sequence as palindromes. This allows same fragments to be ligated together (number 4 and 5) which occurs especially with the short fragments (Number 1 and 3). Also the ligation of the short fragments cut with AgeI and NgoMIV can be ligated (number 2). All possible side products are shown in figure 2.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/0/0d/ESBS-Strasbourg-Sideproducts.jpg" width="550" height="402"><br />
</center><br />
<center><br />
<i><font size="1">Figure 2 Image with all the side products of the ligation step three. On the top are the products of step two after<br>the PCR amplification. They are digested either with AgeI or NgoMIV and ligated for 30 min under standard conditions.<br>This creates unwanted side products (number 1-5) and the wanted product (number 6). All fragments will be amplified<br>via PCR and product 6) has to be selected through the separation on a LMP gel.</font></i><br />
</center><br />
<br />
<br><br><br />
All products can be amplified via PCR. So after the PCR reaction there are several amplified products. The right band has to be separated on a LMP gel.<br />
<br><br><br />
This selection on the LMP gel can be difficult when the product consists of two times the same biobrick or two different biobricks of the same size. On the LPM the bands of incorrect ligated products (like number 4 and 5) and the correct ligated product are of the same size. So a separation on the LMP gel is not possible. If two biobricks of the same size should be fused, a nested PCR reaction in step four can be conducted (see improvements below). If the biobricks differs in size they can be selected on the LMP gel.<br />
<br><br><br />
<br />
<a name="improvements"></a><br />
<div class="heading">Improvements</div><br />
<br />
<br><br><br />
To avoid the amplification of side products after the ligation and to skip the separation step on the LMP gel, a nested PCR can be used. For this reaction others primers have to be designed and the primers VF and VR cannot be used. This different step can be used if two biobricks of the same size have to be fused together. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/2/23/ESBS-Strasbourg-Improvements.jpg"><br />
</center><br />
<center><br />
<i><font size="1">Figure 3 A nested PCR. After the first three steps, several products are obtained. To avoid<br> the amplification of the side products primers which have are complementary to the genes<br> and have overhand containing the VF and VR sequences. This PCR reaction replaces<br> the step four and five in the above mentioned protocol.</font></i><br />
</center><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-26T09:56:05Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: degradation system with the bacterial ClpXP protease from Escherichia coli (E.Coli), the light detection system with the photoreceptor protein Phytochrome B and the Phytochrome Interacting Factor (PIF 3 or 6) from Arabidopsis thaliana (A. thaliana) and the protein tagging with the DAS/LAA recognition sequences for ClpX represent the main parts of our system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from Berkeley.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d5/ESBS-Strasbourg-Clpp.jpg" width="219px" height="282px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/5/52/ESBS-Strasbourg-Clpx.jpg" width="219px" height="282px"><br />
</center><br />
<center><br />
<i><font size="2">The figure on the left shows the two heptamers forming ClpP in our light controllable protease<br><br />
The figure on the right shows the hexamers of ClpX in our light controllable protease</font></i></a><br />
</center><br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/ESBS-Strasbourg-PhyB.jpg" width="219px" height="282px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i> </span></center></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
&nbsp;&nbsp;The figure shows the phytochromes B<br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;in our light controllable protease<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Wu and Lagarias)</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Quail and Koloszvari)</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.(2009)</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and coworkers</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-phybdomain.jpg" width="143px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<br><br />
<p><center><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> in a novel background. </span></center></p><br />
<br />
<br><br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The figure shows the<br>&nbsp; phytochrome B domains<br>&nbsp; used in our construction <br />
<br />
<br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lamparter and Hughes, 2001)</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="234px" height="143px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><center><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></center></p><br />
<br />
<br><br><br><br />
The figure shows the C-terminally tagged target protein contruct PIF-linker-Protein-Tag<br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Park and Song, 2008)</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"(>Baker and Sauer)</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-system.jpg" width="150px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">“Engineering Synthetic Adaptors and Substrates for Controlled ClpXP Degradation” from Tania Baker and al. </a></i></span></center></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
The figure shows the whole light<br> controllable degradation system <br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Houry W. A. et al, 2003; Maurizi M. R. et al., 1998)</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in an E. Coli deficient in ClpX. (ClpX knocked out)<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
<br><br><br />
<br />
<p><b>All in all, we had a precise and feasible project to start working.</b></p><br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-26T09:55:23Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: degradation system with the bacterial ClpXP protease from Escherichia coli (E.Coli), the light detection system with the photoreceptor protein Phytochrome B and the Phytochrome Interacting Factor (PIF 3 or 6) from Arabidopsis thaliana (A. thaliana) and the protein tagging with the DAS/LAA recognition sequences for ClpX represent the main parts of our system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from Berkeley.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d5/ESBS-Strasbourg-Clpp.jpg" width="219px" height="282px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/5/52/ESBS-Strasbourg-Clpx.jpg" width="219px" height="282px"><br />
</center><br />
<center><br />
<i><font size="2">The figure on the left shows the two heptamers forming ClpP in our light controllable protease<br><br />
The figure on the right shows the hexamers of ClpX in our light controllable protease</font></i></a><br />
</center><br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/ESBS-Strasbourg-PhyB.jpg" width="219px" height="282px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i> </span></center></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
&nbsp;&nbsp;The figure shows the phytochromes B<br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;in our light controllable protease<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Wu and Lagarias)</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Quail and Koloszvari)</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.(2009)</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and coworkers</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-phybdomain.jpg" width="143px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<br><br />
<p><center><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> in a novel background. </span></center></p><br />
<br />
<br><br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The figure shows the<br>&nbsp; phytochrome B domains<br>&nbsp; used in our construction <br />
<br />
<br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lamparter and Hughes, 2001)</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="234px" height="143px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><center><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></center></p><br />
<br />
<br><br><br><br />
The figure shows the C-terminally tagged target protein contruct PIF-linker-Protein-Tag<br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Park and Song, 2008)</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"(>Baker and Sauer)</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-system.jpg" width="150px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">“Engineering Synthetic Adaptors and Substrates for Controlled ClpXP Degradation” from Tania Baker and al. </a></i></span></center></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
The figure shows the whole light<br> controllable degradation system <br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Houry W. A. et al, 2003; Maurizi M. R. et al., 1998)</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in an E. Coli deficient in ClpX. (ClpX knocked out)<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
<br><br><br />
<br><br><br />
All in all, we had a precise and feasible project to start working.<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-26T09:42:50Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Renner and Moroder, 2006)</a></i>. However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
<a name="knock"></a><br />
<p><b>Gene-knockout alternative</b></p><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. Moreover, suppressions of a protein by recombination or CreLox methods are more difficult to set up, as the suppression is irreversible it can be lethal for the cells. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Griffith and Grossman, 2008)</a></i> a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br>br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system is useful in any domain of research. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses.<br> In the beginning, the protein levels are at native concentration. After a light impulse the degradation system<br> is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out<br> with an on and off switch. After this an alternation of light impulses turn the system on and off in certain<br> time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment<br> of protein concentration in the cells.</font></i></a><br />
</center><br />
<br><br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial application in multi -step synthesizes. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a<br> gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor,<br> the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence,<br> CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene<br> cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator<br> for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP<br> protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate<br> the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress<br> P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse<br> of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on<br> and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a><br />
</center><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br />
<br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limit is the imagination, the motivation and the skills.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning<br> gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm,<br> CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm.<br> Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for<br> the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene <br>expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the<br> whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette<br> three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a><br />
</center><br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/ApplicationTeam:ESBS-Strasbourg/Project/Application2010-10-26T09:40:14Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=3 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">Application</div><br />
<div class="desc"><br />
<ul><br />
<li><a href="#knock">Gene-knockout Alternative</a></li><br />
<li><a href="#flip">Flip Flop</a></li><br />
<li><a href="#geneos">Genetic Oscillator </a></li><br />
</ul><br />
<br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=3 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading">Applications:</div><br />
<br><br />
As previously described, our degradation system consists of an engineered protease which can be activated by light impulses. This allows a tight control over the catalytic activity core enabling the modulation of protein function in a general fashion with the combined characteristics of specificity, high temporal precision and rapid reversibility.<br />
<br><br />
The system is easily adaptable to new targets proteins, the target-labeling only requires the fusion to the specific degradation tag and PIF. This offers a very cheap easy and applicable method for protein analysis.<br />
<br><br><br />
One of the major advantages is the "non invasive" induction of the protein degradation. Chemical genetics enable perturbations through the introduction of cell membrane-permeable small molecules, allowing the conditional regulation of activity through non-covalent and reversible interactions which is convenient for studies at the cellular level. The use of photolabile ‘‘caged’’ chemical compounds allows to affect subcellular targets in a second-timescale. Some chemical photoswitches such as azobenzene even offer reversible photo-control when attached to macromolecules (Renner and Moroder, 2006). However, the requirement to introduce exogenous, chemically modified materials into cells limits the use of these methods in biological applications.<br />
<br><br />
Instead of the induction by chemical agents, the induction of our system is achieved by light impulses. Chemical agents can interfere with host cell metabolism thereby changing their behavior and impact on complex pathways which may create the impossibility of obtaining neutral results. The induction by light enables the studies of target proteins in a natural unaffected environment. <br />
<br><br />
<a name="knock"></a><br />
<p><b>Gene-knockout alternative</b></p><br />
Another alternative in protein function studies is the use of gene-knockout techniques. These approaches can provide information about incompletely known gene functions, for instance the role of the corresponding protein in interactions with other proteins. But they do not provide any possibility to study kinetic characteristics or the dynamic of protein interactions.<br />
<br><br />
Our system provides a very effective alternative to this approach. Due to the possibility to regulate protein degradation by light-guided on/off switching of the protease activity, it is a tool to control the level of target protein concentration. The common gene knock out methods do not provide any insight to the impact of varying protein concentration. Moreover, suppressions of a protein by recombination or CreLox methods are more difficult to set up, as the suppression is irreversible it can be lethal for the cells. <br />
<br><br><br />
This new system allows through its high turnover rate for proteins (Griffith and Grossman, 2008) a complete degradation of the protein, simulating a gene knockdown. After light induction with 660nm the system should rest in its active state until a light impulse of 730nm changes its back on its inactive state. So a permanent on switch simulates a gene knockdown as every protein is immediately degraded and a permanent off switch favors the native gene expression.<br />
<br>br><br />
With alternating light impulses it should be also possible to adjust certain protein levels by switching the system on and off. This allows the control of complex protein dynamics in vivo as all protein levels can be adjusted to simulate the desired condition.<br />
<br><br><br />
Such a system is useful in any domain of research. Both medical researches as fundamental cell biology require a deep understanding of protein function and their role in interactions with other proteins as in signal cascades and metabolic pathways. The possibility to control protein dynamics in a general manner offers a great approach for medical treatments. <br />
<br><br><br />
An example of this tightly controlled system can be seen in figure 1.<br />
<br><br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg" width="500px" height="400px"></a><br />
</center><br />
<center><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/4/4b/ESBS-Strasbourg-Appfig1.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 1 An example of how protein levels can be adjusted by alternating light impulses.<br> In the beginning, the protein levels are at native concentration. After a light impulse the degradation system<br> is on and will degrade the protein very fast and efficient. These first two steps are like a gene knock out<br> with an on and off switch. After this an alternation of light impulses turn the system on and off in certain<br> time periods. So the protease is turned between active and inactive. This allows the fine tuned adjustment<br> of protein concentration in the cells.</font></i></a><br />
</center><br />
<br><br />
<a name="flip"></a><br />
<p><b>Flip Flop</b></p><br />
The system further allows the control of transcriptional regulation. Another application of this system is the creating of a flip flop mechanism which can be induced by light. This can allow the expression of two different genes sequentially. In the beginning just the gene in gene cassette one is expressed. In the example this is the GPF protein. After a light induction the gene expression is switched to gene cassette two, which is RFP in this example. Figure 2 gives a more detailed description of this mechanism. This allows the tight control of two genes in one host organism. The tight control and sequentially nature of this flip flop mechanism allows a light-controlled multistep synthesis which a huge potential for industrial application in multi -step synthesizes. <br />
<br><br />
Moreover several enzymatic steps can be conducted sequentially in one single organism, so even complex biomolecules can be produced in a single bioreactor. This is an enormous gain of time and money. <br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg" width="500px" height="325px"></a><br />
</center><br />
<center><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/e/e0/ESBS-Strasbourg-Appfig2.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 2 The flip flop mechanism. This mechanism shows how to change from the expression of a<br> gene in the first cassette to a gene in the second cassette. P is the promoter, CR is a cross repressor,<br> the symbol besides the cross repressor symbolize that this protein is tagged with the DAS degradation sequence,<br> CA is a cross activator and C is the gene cassette. At start condition P1 expresses all the proteins of gene<br> cassette one (C1). The cross repressor for promoter P2 (CR2) represses P2 stronger than the cross activator<br> for P2 (CA2) activates it. This results in an expression of the GFP protein. After light induction with 660nm, the ClpXP<br> protease will degrade the tagged CR2. After the degradation of the repressor, the cross activator will activate<br> the promoter P2 which will lead to an complete expression of gene cassette two (C2). The CR1 of the C2 will now repress<br> P1 which will terminate the expression of gene cassette one. So a switch from C1 to C2 is achieved. An light impulse<br> of 730nm will switch of the ClpXP protease. With another light impulse of 660nm the ClpXP system will be turned on<br> and a switch from C2 to C1 will occur. A detailed analysis of this mechanism can be seen in the modeling part.</font></i></a><br />
</center><br />
<br><br />
<a name="geneos"></a><br />
<p><b>Genetic Oscillator</b></p><br />
The idea of the flip flop mechanism can be extended to a genetic oscillator with three, four or even more sequential steps. Figure 3 shows an example of a three step oscillator. This oscillator is tightly controlled by light and allows the sequentially expression of three different genes. Such an implementation would present a genetically encoded device to store multiple bits of information within a living cell.<br />
<br><br><br />
The light-dependent protease with its specific degradation tags is a versatile approach for transcriptional regulation and protein analysis. It gives the synthetic biology community a basic device with a broad range of applications in fundamental research. The only limit is the imagination, the motivation and the skills.<br />
<br><br><br />
<br />
<center><br />
<br><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg" width="550px" height="290px"></a><br />
</center><br />
<center><br />
<a target="_blank" href="https://static.igem.org/mediawiki/2010/2/2a/ESBS-Strasbourg-Appfig3.jpg"><br />
<i><font color="#E9AF03" size="1">Figure 3 The three step oscillator. The principle is the same as with the flip flop mechanism. In the beginning<br> gene cassette C1 with GFP is expressed and CR2 and CR3 represses P2 and P3. After a light impulse of 660nm,<br> CR2 and CR3 are degraded and CA2 can activate P2. The ClpXP system will be switch off by a light impulse with 730nm.<br> Due to the absence of CR2 and CR3 gene cassette C2 and C3 will be no longer repressed. But as just an CA for<br> the P2 was expressed from C1, C2 will be far stronger expressed than C3. So the CR3 on the C2 will terminate gene <br>expression of P3 and thus will terminate the whole expression of C3. CR1 will also repress the expression of P1 and thus the<br> whole expression of C1. After another light impulse of 660nm, the switch from gene cassette two (C1) to gene cassette<br> three (C3) will occur with the same mechanism as from C1 to C2. </font></i></a><br />
</center><br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-26T09:35:41Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: degradation system with the bacterial ClpXP protease from Escherichia coli (E.Coli), the light detection system with the photoreceptor protein Phytochrome B and the Phytochrome Interacting Factor (PIF 3 or 6) from Arabidopsis thaliana (A. thaliana) and the protein tagging with the DAS/LAA recognition sequences for ClpX represent the main parts of our system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from Berkeley.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d5/ESBS-Strasbourg-Clpp.jpg" width="219px" height="282px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/5/52/ESBS-Strasbourg-Clpx.jpg" width="219px" height="282px"><br />
</center><br />
<center><br />
<i><font size="2">The figure on the left shows the two heptamers forming ClpP in our light controllable protease<br><br />
The figure on the right shows the hexamers of ClpX in our light controllable protease</font></i></a><br />
</center><br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/ESBS-Strasbourg-PhyB.jpg" width="219px" height="282px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i> </span></center></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
&nbsp;&nbsp;The figure shows the phytochromes B<br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;in our light controllable protease<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Wu and Lagarias)</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Quail and Koloszvari)</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.(2009)</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and coworkers</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-phybdomain.jpg" width="143px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<br><br />
<p><center><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> in a novel background. </span></center></p><br />
<br />
<br><br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The figure shows the<br>&nbsp; phytochrome B domains<br>&nbsp; used in our construction <br />
<br />
<br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lamparter and Hughes, 2001)</a></i>. Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="234px" height="143px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><center><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></center></p><br />
<br />
<br><br><br><br />
The figure shows the C-terminally tagged target protein contruct PIF-linker-Protein-Tag<br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Park and Song, 2008)</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"(>Baker and Sauer)</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-system.jpg" width="150px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">“Engineering Synthetic Adaptors and Substrates for Controlled ClpXP Degradation” from Tania Baker and al. </a></i></span></center></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
The figure shows the whole light<br> controllable degradation system <br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Houry W. A. et al, 2003; Maurizi M. R. et al., 1998)</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in an E. Coli deficient in ClpX. (ClpX knocked out)<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
We had a precise and feasible project to start working.<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-26T09:33:08Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: degradation system with the bacterial ClpXP protease from Escherichia coli (E.Coli), the light detection system with the photoreceptor protein Phytochrome B and the Phytochrome Interacting Factor (PIF 3 or 6) from Arabidopsis thaliana (A. thaliana) and the protein tagging with the DAS/LAA recognition sequences for ClpX represent the main parts of our system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from Berkeley.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d5/ESBS-Strasbourg-Clpp.jpg" width="219px" height="282px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/5/52/ESBS-Strasbourg-Clpx.jpg" width="219px" height="282px"><br />
</center><br />
<center><br />
<i><font size="2">The figure on the left shows the two heptamers forming ClpP in our light controllable protease<br><br />
The figure on the right shows the hexamers of ClpX in our light controllable protease</font></i></a><br />
</center><br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/ESBS-Strasbourg-PhyB.jpg" width="219px" height="282px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i> </span></center></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
&nbsp;&nbsp;The figure shows the phytochromes B<br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;in our light controllable protease<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Wu and Lagarias)</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Quail and Koloszvari)</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.(2009)</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and coworkers</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-phybdomain.jpg" width="143px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<br><br />
<p><center><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim and Voigt</a></i> in a novel background. </span></center></p><br />
<br />
<br><br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The figure shows the<br>&nbsp; phytochrome B domains<br>&nbsp; used in our construction <br />
<br />
<br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism (Lamparter and Hughes, 2001). Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="234px" height="143px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><center><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></center></p><br />
<br />
<br><br><br><br />
The figure shows the C-terminally tagged target protein contruct PIF-linker-Protein-Tag<br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Park and Song, 2008)</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"(>Baker and Sauer)</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-system.jpg" width="150px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">“Engineering Synthetic Adaptors and Substrates for Controlled ClpXP Degradation” from Tania Baker and al. </a></i></span></center></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
The figure shows the whole light<br> controllable degradation system <br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Houry W. A. et al, 2003; Maurizi M. R. et al., 1998)</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in an E. Coli deficient in ClpX. (ClpX knocked out)<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
We had a precise and feasible project to start working.<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-26T09:29:57Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: degradation system with the bacterial ClpXP protease from Escherichia coli (E.Coli), the light detection system with the photoreceptor protein Phytochrome B and the Phytochrome Interacting Factor (PIF 3 or 6) from Arabidopsis thaliana (A. thaliana) and the protein tagging with the DAS/LAA recognition sequences for ClpX represent the main parts of our system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from Berkeley.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d5/ESBS-Strasbourg-Clpp.jpg" width="219px" height="282px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/5/52/ESBS-Strasbourg-Clpx.jpg" width="219px" height="282px"><br />
</center><br />
<center><br />
<i><font size="2">The figure on the left shows the two heptamers forming ClpP in our light controllable protease<br><br />
The figure on the right shows the hexamers of ClpX in our light controllable protease</font></i></a><br />
</center><br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/ESBS-Strasbourg-PhyB.jpg" width="219px" height="282px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i> </span></center></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
&nbsp;&nbsp;The figure shows the phytochromes B<br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;in our light controllable protease<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Wu and Lagarias)</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Quail and Koloszvari)</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and coworkers</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-phybdomain.jpg" width="143px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<br><br />
<p><center><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt</a></i> in a novel background. </span></center></p><br />
<br />
<br><br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The figure shows the<br>&nbsp; phytochrome B domains<br>&nbsp; used in our construction <br />
<br />
<br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. It is possible to produce the holophytochrome in E. coli by co-expressing two genes from Synechocystis for chromophore biosynthesis together withcyanobacterial chromophore 1(Cph1) from the same organism (Lamparter and Hughes, 2001). Heme oxygenase converts host heme to biliverdin IXK which is then reduced to phycocyanobilin via phycocyanobilin:ferredoxin oxidoreductase. The Cph1 apophytochrome is able to autoassemble with the phycocyanobilin in vivo to form the fully photoreversible holophytochrome.<br><br><br />
Nevertheless, we decided to use the exogenous way by adding exogenous PCB and to focus on our main objective to prove the functionality of our system. Beside that it has been shown that the endogenous way to produce the holoenzyme leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="234px" height="143px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><center><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></center></p><br />
<br />
<br><br><br><br />
The figure shows the C-terminally tagged target protein contruct PIF-linker-Protein-Tag<br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-linker-Protein-Tag. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Park and Song, 2008)</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"(>Baker and Sauer)</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-system.jpg" width="150px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">“Engineering Synthetic Adaptors and Substrates for Controlled ClpXP Degradation” from Tania Baker and al. </a></i></span></center></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
The figure shows the whole light<br> controllable degradation system <br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Houry W. A. et al, 2003; Maurizi M. R. et al., 1998)</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in an E. Coli deficient in ClpX. (ClpX knocked out)<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
We had a precise and feasible project to start working.<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/Project/StrategyTeam:ESBS-Strasbourg/Project/Strategy2010-10-26T09:23:42Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 17px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:143px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:153px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style><br />
<br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#advisors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Instructors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#collaboration"><br />
Collaboration</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project"><br />
Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/visual"><br />
Visual Description</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment"><br />
Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks"><br />
Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Assembly"><br />
<font size="3">Biobrick Assembly Technique</font></a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling"><br />
Modeling</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Device">Lighting device</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a><br />
&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic"><br />
Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook"><br />
Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li><br />
<p><br/><a><br />
HUMAN PRACTICE</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/organisation"><br />
Organisation</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/survey"><br />
Survey</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/video"><br />
The ClpX video</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Humanpractice/game"><br />
The ClpX game</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/safety"><br />
Project Safety</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<td width="210" rowspan=20 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">PROJECT INDEX</div><br />
<div class="desc"><br />
Our device construction is divided into 4 components :<br><br><br />
<a href="#degradation">1. Degradation system</a><br />
<br><br />
<a href="#light">2. Light detection system</a><br />
<br><br />
<a href="#tagging">3. Protein Tagging</a><br />
<br><br />
<a href="#system">4. Light controllable protease</a><br />
<br><br><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/notebook">Notebook</a><br />
</div><br />
</p></div><br />
</td><br />
<td width="10" rowspan=20 bgcolor="#222222"><br />
</div><br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="Intro"></a><br />
Introduction<br />
</div><br />
<br />
<br><br />
<br />
The work of the former IGEM Team had a great influence on our choice, particularly those of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>. Their goal was to control cells’ state by linking the natural variability of life to the binary system of computing. In the project of <i><a href="https://2008.igem.org/Team:ESBS-Strasbourg">The ESBS 2008 Team</a></i>, the incrementing from one bit to another required a protease which was expressed during the mitosis in yeast. Renaud Renault of the actual iGEM team had thus the idea of inventing a degradation system which would be not only temporally controllable but also specific.<br />
<br><br><br />
Based on this idea we chose to create a light-controllable specific protein degradation system. The system contains several parts: degradation system with the bacterial ClpXP protease from Escherichia coli (E.Coli), the light detection system with the photoreceptor protein Phytochrome B and the Phytochrome Interacting Factor (PIF 3 or 6) from Arabidopsis thaliana (A. thaliana) and the protein tagging with the DAS/LAA recognition sequences for ClpX represent the main parts of our system. <br />
<br><br><br />
The different parts, their basic ideas and their strategic development will be discussed in detail in the following separated parts. The choice of the host organism will also be explained, followed by the final structure of the light controllable protease.<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="degradation"></a><br />
Degradation system<br />
</div><br />
<br><br />
The ClpXP from E.coli protease rapidly established itself as an evident choice. Indeed, this protease has been very well studied, notably by <a href="http://web.mit.edu/bakerlab/index.html">the Tania Baker Team</font></a> from Berkeley.<br />
<br><br><br />
<p><b>Description</b></p><br />
Basically, ClpXP is an AAA protease present in bacteria, consisting of two main components, ClpX and ClpP. The ClpX is a hexamer consisting of six identical subunits. It recognizes specific degradation tags of target substrate proteins, unfolds them in an ATP-consuming hydrolysis reaction, and uses additional cycles of ATP hydrolysis to translocate the unfolded polypeptide into an interior chamber of ClpP, where proteolysis takes place. ClpP is a multi-subunit serine peptidase, in which the proteolytic active sites reside within a barrel-shaped structure.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/d/d5/ESBS-Strasbourg-Clpp.jpg" width="219px" height="282px"><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/5/52/ESBS-Strasbourg-Clpx.jpg" width="219px" height="282px"><br />
</center><br />
<center><br />
<i><font size="2">The figure on the left shows the two heptamers forming ClpP in our light controllable protease<br><br />
The figure on the right shows the hexamers of ClpX in our light controllable protease</font></i></a><br />
</center><br />
<br><br><br />
<p><b>How using the ClpXP protease ? : The question of the use of an adaptator</b></p><br />
This question was really critical. We focused on different strategies before making a definitive choice.<br />
<br><br />
The publication of Tania Baker <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i> based on the ClpXP protease of E. Coli which degrades substrates bearing the specific SsrA recognition sequence, has been the starting point of our reflection. In this work Baker and colleagues designed a series of modified ssrA tags which have weakened interactions with ClpXP to engineer controlled degradation. In E. coli, the adaptor SspB tethers ssrA-tagged substrates to the ClpXP protease, causing a modest increase in their rate of degradation. In the absence of SspB , substrates bearing the artificially altered DAS-tag were stable, in contrast the degradation of substrates bearing these engineered peptide tags was 100-fold more efficiently when SspB was present.<br />
<br><br><br />
Upon these findings our first idea consisted in using the native ClpX with the mutated tag and a modified SspB whose binding to ClpX should be controlled by light in order to control protein degradation. Forcing cells to produce an inactive form of an adaptator seem to be a good solution to be able to stop the degradation at a certain point. This could be realized by producing two parts of the adaptator which could interconnect them after light-induction by fusing them to proteins which had this capacity, for instance the couple Phytochrome/PIF.<br />
<br><br><br />
However, the use of the adaptor-based system posed some major problems concerning the complexity. Subsequent to another finding of Baker et. al., we decided to fuse our phytochrome directly to the N-terminal of ClpX, as it is not required for the basic enzymatic functions of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Baker and Sauer 2006)</a></i>.<br />
<br><br><br />
Further, we decided to fuse the target protein, additionally to the specific degradation tag, with PIF which will assume the role of the adaptor protein SspB . <br />
<br />
<br />
<br><br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" valign="top"><br />
<div class="heading"><br />
<a name="light"></a><br />
Light detection system<br />
</div><br />
<div class="desc"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/ESBS-Strasbourg-PhyB.jpg" width="219px" height="282px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>As told before, the Phytochrome/PIF system has been chosen as light detection system. Many reasons have motivated our choice: it is well-characterized, offers a second timescale control which is an order of magnitude faster than previous chemically induced translocation systems and are very near the physical limits for whole-cell diffusion. It has also been proven to be robust being cycled over a hundred times by alternating red and infrared illumination with no measurable decrease in recruitment ratios over time <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Lim & Voigt 2009)</a></i> </span></center></p><br />
<br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
&nbsp;&nbsp;The figure shows the phytochromes B<br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;in our light controllable protease<br />
<br><br><br />
<p><b>Description</b></p><br />
Phytochromes are photoreceptive signaling proteins responsible for mediating many light-sensitive processes in plants, including seed germination, seedling de-etiolation and shade avoidance. They detect red and near-infrared light through the photoisomerization of a covalently bound tetrapyrrole chromophore such as phycocyanobilin (PCB) for plant phytochromes. This photoisomerization event is coupled to an allosteric transition in the phytochrome between two conformational states called Pr (red-absorbing) and Pfr (far-red-absorbing). <br />
<br><br><br />
Upon stimulation with red light (650 nm), the phytochrome B (PhyB) protein binds directly to a downstream transcription factor, the phytochrome interaction factor (PIF). PIF is a nuclear-localized, basic helix–loop–helix (bHLH) factor initially isolated as interacting with the non-photoactive, C-terminal domain of Arabidopsis PhyB.<br />
<br><br><br />
<p><b>Construction choice</b></p><br />
We needed to study the different domains of the phytochrome B in order to try to reduce its size which can be a potential sterical hindrance for ClpX activity. <br />
<br><br />
All plant phytochromes can be divided into an N-terminal photo sensory domain and a C-terminal dimerization domain. The Nterminal photo sensory domain comprises four consecutive subdomains called P1, P2/PAS, P3/GAF, and P4/PHY (named sequentially from the N terminus), the C-terminal domain consists of two subdomains, the PAS-A and PAS-B domains and the histidine kinase–related domain (HKRD) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Wu and Lagarias)</a></i>. The PAS domain is named after three proteins in which it occurs: Per (period circadian protein), Arn (Ah receptor nucleartranslocator protein), and Sim (single-minded protein) <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.<br />
<br><br />
The P1 domain is not essential for the function of PHYB. Deletion of amino acids 1–57 of Arabidopsis PHYB yields a protein with full activity <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Quail and Koloszvari)</a></i>. In contrast, the P2/PAS and P3/GAF domains form the essential photo sensory core domain. These domains contain a bilin lyase activity, which is responsible for the binding of the chromophore to a cysteine residue in the P3/GAF domain. The P2/PAS and P3/GAF domains play critical roles in photo sensing, whereas the P4/PHY domain is necessary for fine tuning phytochrome activity. Deletion of the P4/PHY domain increases the dark reversion rate (i.e., the instability of the Pfr conformation) and causes a blue shift in absorption by both Pr and Pfr. A serine/threonine kinase domain that governs phytochrome autophosphorylation and phytochrome-directed phosphorylation of other proteins, such as the phytochrome interacting factor (PIF3) has also been located in the N-terminal domain <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>. The PAS-A and PAS-B domains of PHYB are necessary for dimerization and nuclear localization, whereas PAS-A, PAS-B, and the HKRD domains are necessary for nuclear speckle formation <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Bae and Choi, 2008)</a></i>.Dimerization is required for PhyB full activity.<br />
<br><br><br />
The light-sensitive interaction between PHYB and PIF3 has been mapped to the 650-residue amino-terminal photosensory core of PHYB <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Khanna et al., 2004)</a></i>.<br />
<br><br />
The improved understanding of these mechanisms has been helpful for the design of the first engineered photoreceptors. By now there have been three illuminating studies that utilized the interaction between PhyB and PIF3 to achieve light regulation of target proteins. <br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Leung et al.</a></i> put the association of the GTPase Cdc42 with its effector protein WASP under red-light control. When in complex with PhyB-Cdc42, PIF3-WASP promoted actin polymerization in vitro; use in vivo was not demonstrated. Based on the interaction between PhyB and PIF3, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Muir and coworkers</a></i> established a protein-splicing system that was moderately regulated by red light in vitro65. Lastly, <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt</a></i> employed the light-dependent interaction between PhyB and PIF6 to activate target proteins in vivo. The nucleotide exchange factors Tiam and intersectin were recruited to the plasma membrane in a red-light-controlled manner where they activated their GTPase effectors Rac1 and Cdc42, respectively. In their activated form, the GTPases promoted formation of cell protrusions, and thus the motility of fibroblasts could be controlled by red light.<br />
<br><br />
With this first successful in-vivo application <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt</a></i> have shown that the PIF-interaction with the PhyB photo sensory core (residues 1–642) is irreversible in infrared light. By assaying PIF6, which has the strongest interactions of all previously reported PIF domains, against different variants of PhyB they demonstrated that the tandem C-terminal PAS domains (residues 1-908) of PHYB are necessary to confer rapid photo reversibility under infrared light. The interaction with PIF3 has been too weak to cause significant translocation.<br />
<br><br><br />
<br />
<br />
<img src="https://static.igem.org/mediawiki/2010/e/e7/ESBS-Strasbourg-phybdomain.jpg" width="143px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<br><br />
<p><center><span>Upon these findings, we decided to tests different variants for the implementation of our system: for the phytochrome constructs we choose PhyB residues 1-908 (PhyB900) and the photo sensory core domain residues 1-642 (PhyB650) in combination with PIF3 (residues 1-100) and PIF6 (residues 1-100).<br> The choice to include the shorter PhyB650 variant in our tests is reasoned by the risk of a potential sterical hindrance of ClpX due to the fusioned PhyB. Due to its reduced size, the PhyB650 construct provides an additional control for the case that the system implementation using PhyB950 does not produce results. Further, binding strength and kinetic parameters depend on the composition and nature of the individual system, so we thought it a good idea to test the findings of <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Lim & Voigt</a></i> in a novel background. </span></center></p><br />
<br />
<br><br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The figure shows the<br>&nbsp; phytochrome B domains<br>&nbsp; used in our construction <br />
<br><br><br />
<br />
<p><b>The question of the chromophore</b></p><br />
Since the plant phytochromes PhyA and PhyB employ the modified tetrapyrroles PCB or PΦB which are not available in most tissues and cell types, these chromophores must be supplied either exogenously or endogenously. The PCB chromophore, stemming from heme can be produced by ??? cells by inserting three additional genes into the ??? pathway [3]. Nevertheless, we decided to use the exogenous way by adding exogenous PCB as it has been shown that the endogenous modification of the bacterial metabolism leads to the production of toxic side-products.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="tagging"></a><br />
Protein Tagging<br />
</div><br />
<p><b>Construction choice</b></p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/8/8e/ESBS-Strasbourg-ImageProteinfinal.jpg" width="234px" height="143px" align="left"><br />
<p>&nbsp;</p><br />
<br />
<p><center><span>The addition of the tag could lead to some problems as compromised folding or increased activity of the target protein. Most bacterial proteins tolerate C-terminal fusions and the C-termini of most proteins are solvent accessible. Chances are, that no major problems occur when we add our tag.</span></center></p><br />
<br />
<br><br><br><br />
The figure shows the Protein Tagging used <br />
<br><br><br />
As it is the N-ter of PIF which interact with PhyB, this extremity has to be free. So, PIF will be fused to the N-ter of the tagged protein. The N-terminal tagging has been successfully demonstrated.<br />
<br><br />
For the C-terminal degradation tags, the target protein construct will be PIF-Protein-Tag, interconnected by a linker. To avoid problems with the accessibility of the tag we decided to test a further contruction with a N-terminally fused degradation tag (Tag-Protein-linker-PIF).<br />
<br><br />
We need then to choose an appropriate tag. It was also a critical step. <br />
<br><br><br />
<p><b>The LAA Tag</b></p><br />
The ssrA tag is a natural well-characterized recognition for ClpXP-degradation sequence in E. Coli. It is composed of the 11 amino acid sequence AANDENYALAA, localized at the C-terminal of the target protein. At least five ClpX-recognizing motifs have been determined: three located at the N-terminus and two at the C-terminus <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Park and Song, 2008)</a></i>. Here we are concentrating on those located at the C-terminus where ClpX recognizes the last three residues (Leu9, Ala10 and Ala11).<br />
<br><br />
ClpX alone is able to interact with the ssrA-tagged substrates and delivers them to ClpP protease. However, it has been shown that the adaptor protein, SspB, markedly enhances the recognition of the ssrA tag. So, in our case the PIF-fused target should also favor the recognition of the ssrA tag.<br />
<br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> have shown that proteins with C-terminal LAA- tags are degraded rapidly in the cell, even without presence of SspB. This tag serves as positive control for the functionality of the composed ClpXP and the PhyB-ClpXP fusion protein.<br />
<br><br><br />
<p><b>The DAS Tag</b></p><br />
Replacing two residues in the ssrA tag weakens ClpX binding. Ser was chosen as an allowed but not preferred C-terminal residue and Asp as the antepenultimate residue because this substitution decreases ClpXP and ClpAP degradation modestly. The ssrA tags with these mutations are referred as DAS tags <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"(>Baker and Sauer)</a></i>. Besides, no other proteases than ClpXP degrades DAS-tagged proteins. Therefore we chose the DAS tag as specific recognition sequence for our system. As the role of the adaptor-protein SspB has been assumed by Pif3/6 in our system, only light-induced activation can lead to binding and efficient degradation of DAS bearing constructs. <br />
<br><br><br />
<p><b>The Lambda Tag</b></p><br />
The λO- tag is the N-terminal equivalent to the DAS-tag. Degradation of proteins bearing the N-terminal λO- tag normally requires the N-domain of ClpX, which is missing in the PhyB-linker-[ClpX]3 variant. <br />
<br><br><br />
<i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">Baker and Sauer</a></i> used this tag to test an artificial tethering system and demonstrated that it can serve as degradation signal for substrates that are tethered to ClpX.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
<br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<div class="heading"><br />
<a name="system"></a><br />
Light controllable protease<br />
</div><br />
<p><b>The choice of the host organism</b></p><br />
Another important point was the choice of the host organism. At the beginning we considered three different options: Saccharomyces cerevisae that was used by the former iGEM Team of the ESBS, Bacillus subtilis and Escherichia coli. The advantage of yeast was that it is a eukaryotic organism which would have been interesting for further applications in eukaryotic cells. At the other site this would impede the control of transcriptional regulation, which one of the initial application ideas of our protease, due to the nucleus’ membrane. The disadvantages are that the ClpP-coding sequence lacks in their genome which would have to be additionally cloned in. Moreover the growth rate of the cells is lower than the one of E.coli which would have slowed the laboratory work. The disadvantages of E.coli as host are the necessary knock-out of the ClpX gene for the control and the risk of interference of host-proteins with the synthetic system. This would have been an advantage for the use of B. subtilis but here the impact of a synthetic protease system is far less characterized than in E.coli. <br />
<br><br><br />
Thus, the final choice of the host organism was E.coli as this organism is best characterized for the work in molecular genetics and also tested for synthetic engineering of ClpX andthe presence of the ClpP-subunit that assembles auto-catalitically with ClpX.<br />
<br><br><br />
<p><b>The Linker</b></p><br />
The linker has been designed for the use in different construction to avoid steric hindrance. The sequence is composed of the twenty amino-acids ASGAGGSEGGGSEGGTSGAT.<br />
<br><br><br />
<p><b>Final construction</b></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/ESBS-Strasbourg-system.jpg" width="150px" height="234px" align="left"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><center><span>Even if we had a clear idea of our system, we needed more information about the constructional design. During our investigations, we found an extremely helpful article for this issue: <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">“Engineering Synthetic Adaptors and Substrates for Controlled ClpXP Degradation” from Tania Baker and al. </a></i></span></center></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<br><br />
The figure shows the whole light<br> controllable degradation system <br />
<br><br><br />
In this work Baker and colleges probed minimal biochemical functions necessary for efficient degradation by designing and characterizing variant substrates, adaptors and ClpX-enzymes. They implemented a rapamycin-dependent tethering system and demonstrated that artificial tethering can support substrate delivery.Therefore they constructed a ClpX variant lacking the N-domain that contained the human FKBP12 protein. The FKBP12 was fused to the N terminus of a trimeric form of ClpX-N in which the subunits were connected with a flexible linker to stabilize the enzyme. The reason for this particular design is that N-domain dimerization is needed to stabilize the active hexameric form of ClpX <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Houry W. A. et al, 2003; Maurizi M. R. et al., 1998)</a></i> so that replacing this domain would probably result in weaker hexamerization. Upon these findings we decided to construct the PhyB-ClpX fusion protein in the same manner.<br />
<br><br><br />
For the adaptor-mediated delivery they fused an altered SspB variant to the FRB domain from rat m. In the presence of the small molecule rapamycin the FKBP12 protein and the FRB domain bind to each other with high affinity, consequently the adaptor-mediated delivery of their system depends on rapamycin-induction. The experiments resulted in efficient adaptor-dependent degradation.<br />
<br><br><br />
In our system the adaptor-role is assumed by PIF, which will bind to PhyB following light-induction. Target proteins are fused to PIF and tagged with the degradation sequence which, through light activation, brings the degradation sequence in proximity to ClpX and guides them to the catalytic core of the protease. Therefore a specific degradation of proteins containing the degradation sequence can be induced by a light signal.<br />
<br><br><br />
<p><b>The E. Coli stem</b></p><br />
The native ClpXP in E.coli would interfere with the measurements of the degradation and the degradation itself, so we decided to work in an E. Coli deficient in ClpX. (ClpX knocked out)<br />
<br><br><br />
<p><b>Prediction of possible problems</b></p><br />
One problem could be a too slow protease activity of the ClpXP to clear the tagged protein. Endogenous levels of ClpXP are capable of degrading more than 100,000 copies of a tagged substrate per generation in E. coli <i><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference">(Farrell et al., 2005)</a></i>.<br />
<br><br><br />
We had a precise and feasible project to start working.<br />
<br />
<br />
<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<br />
<br />
<br />
</table><br />
</body><br />
</html></div>Thezihttp://2010.igem.org/Team:ESBS-Strasbourg/TeamTeam:ESBS-Strasbourg/Team2010-10-12T20:52:44Z<p>Thezi: </p>
<hr />
<div>{{ESBS-Strasbourg/Temp1}} {|<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<p><br />
<head><br />
<meta http-equiv="content-type" content="text/html;charset=utf-8" /><br />
<title>ESBS - Strasbourg</title><br />
<br />
<br />
<script type="text/javascript"><!-- <br />
var delay=7000<br />
var ie4=document.all<br />
var curindex=0<br />
var totalcontent=0<br />
function get_total(){<br />
if (ie4){<br />
while (eval("document.all.content"+totalcontent))<br />
totalcontent++<br />
}<br />
else{<br />
while (document.getElementById("content"+totalcontent))<br />
totalcontent++<br />
}<br />
}<br />
function contract_all(){<br />
for (y=0;y<totalcontent;y++){<br />
if (ie4)<br />
eval("document.all.content"+y).style.display="none"<br />
else<br />
document.getElementById("content"+y).style.display="none"<br />
}<br />
}<br />
function expand_one(which){<br />
contract_all()<br />
if (ie4)<br />
eval("document.all.content"+which).style.display=""<br />
else<br />
document.getElementById("content"+which).style.display=""<br />
}<br />
function rotate_content(){<br />
get_total()<br />
contract_all()<br />
expand_one(curindex)<br />
curindex=(curindex<totalcontent-1)? curindex+1: 0<br />
setTimeout("rotate_content()",delay)<br />
}<br />
window.onload=rotate_content<br />
//--></script><br />
</head><br />
<br />
<style> <br />
body{<br />
background-color: red;<br />
font: 11px Arial;<br />
color: #888888;<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
b{<br />
color: #ffffff;<br />
}<br />
<br />
.heading{<br />
color: #FFF;<br />
font: 14px century gothic;<br />
padding: 5px 5px 2px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
.titlebg{<br />
position: absolute;<br />
top: 0px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:3;<br />
}<br />
<br />
.title{<br />
position: absolute;<br />
top: 243px;<br />
float: left;<br />
font: 35px Trebuchet MS;<br />
color: #FFF;<br />
padding-top: 5px;<br />
padding-left: 10px;<br />
z-index: 4;<br />
}<br />
<br />
.header{<br />
z-index: 1;<br />
position: absolute;<br />
top: 0px;<br />
height: 293px;<br />
}<br />
<br />
.menu{<br />
z-index: 5;<br />
position: absolute;<br />
top: -20px;<br />
font: 18px Trebuchet MS;<br />
text-align: center;<br />
}<br />
<br />
.menubg{<br />
position: absolute;<br />
top: 243px;<br />
background-color: #000000;<br />
width: 965px;<br />
height: 50px;<br />
/* for IE */<br />
filter:alpha(opacity=60);<br />
/* CSS3 standard */<br />
opacity:0.6;<br />
z-index:2;<br />
}<br />
a:link{color:#fff;}<br />
a:visited{color:#fff;}<br />
a:active{color:#fff;}<br />
</style><br />
<br />
<body bgcolor="#414141" style="background-color: #800000"><br />
<body style="background-color: #800000"><br />
<br />
<br />
<div class="header"><br />
<div class="titlebg"><br />
</div><br />
<div class="title"><br />
</><br />
</div><br />
<br />
<div id="content0" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/05/Strasbourg_parlement_europeen_nuit.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content1" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a6/Strasbourg_cathedrale.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content2" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/59/Strasbourg_coucherdesoleil.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content3" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/17/Strasbourg_ESBS-Strasbourg-main3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content4" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Strasbourg_parlement_europeen_jour.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content5" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/dd/Strasbourg_Barrage_Vauban_at_night2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content6" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/7/74/Strasbourg_anciennedouane2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content7" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/66/Strasbourg_ciel2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content8" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/57/Strasbourg_ciel3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content9" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/6/63/Strasbourg_ciel.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content10" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/9/92/Strasbourg_gare2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content11" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_gare3.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content12" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b6/Strasbourg_kammerzell.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content13" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b5/Strasbourg_neige2.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content14" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/d/db/Strasbourg_neige.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content15" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/0/01/Strasbourg_petitefrance.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content16" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Strasbourg_quais.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content17" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Strasbourg_zenith.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content18" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Strasbourg_Illuminations.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<div id="content19" style="display:none"><br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Strasbourg-at-Night-a18209576.jpg" width="965px" height="293px" border="0"><br />
</div><br />
<br />
<br />
</div><br />
<br />
<div class="menubg"><br />
</div><br />
<br />
<div class="menu"><br />
<br />
<!--[if lt IE 7]><br />
<script type="text/javascript"><br />
<br />
sfHover = function() {<br />
var sfEls = document.getElementById("nav").getElementsByTagName("LI");<br />
for (var i=0; i<sfEls.length; i++) {<br />
sfEls[i].onmouseover=function() {<br />
this.className+=" over";<br />
}<br />
sfEls[i].onmouseout=function() {<br />
this.className=this.className.replace(new RegExp(" over\\b"), "");<br />
}<br />
}<br />
}<br />
if (window.attachEvent) window.attachEvent("onload", sfHover);<br />
<br />
</script><br />
<![endif]--><br />
<style type="text/css"> <br />
/* general styling */<br />
*{margin:0;padding:0}<br />
body {<br />
font: x-small Verdana, Arial, Helvetica, sans-serif;<br />
text-align:left;<br />
padding:20px;<br />
}<br />
.outer{<br />
padding:0px 0 0 0;<br />
width:965px;<br />
margin:auto;<br />
position:relative;<br />
text-align:center;<br />
}<br />
<br />
/* drop up */<br />
ul#nav,ul#nav ul {<br />
margin: 0;<br />
padding: 0;<br />
list-style: none;<br />
}<br />
ul#nav {<br />
width:1100px;<br />
height:25px;<br />
<br />
}<br />
<br />
ul#nav li {<br />
position: relative;<br />
float: left;<br />
width:170px;<br />
height:75px;<br />
color:#fff;<br />
text-align:left;<br />
}<br />
ul#nav li a {<br />
text-decoration: none;<br />
color:#fff;<br />
<br />
}<br />
#nav li ul {<br />
position: absolute;<br />
left: 0; <br />
top:70px;<br />
margin-left:-999em;<br />
border:none;<br />
height:193px;<br />
width:193px;<br />
background:#000;<br />
/*opacity for IE5+*/<br />
filter: alpha(opacity=60);<br />
/*opacity for older Mozilla browsers*/<br />
-moz-opacity: 0.6;<br />
/*opacity for mozilla/safari*/<br />
opacity: 0.6;<br />
}<br />
ul#nav li li{height:auto;border:none;}<br />
ul#nav li li a{<br />
color:red;<br />
padding:2px 5px 2px 5px;<br />
display:block;<br />
}<br />
ul#nav li:hover ul, <br />
ul#nav li.over ul {<br />
margin-left:0;<br />
}<br />
ul#nav li:hover,<br />
ul#nav li.over,<br />
ul#nav li:hover a,<br />
ul#nav li.over a {color:#800000}<br />
<br />
ul#nav li:hover li a,ul#nav li.over li a{color:#fff;}<br />
ul#nav li li a:hover{color:#800000; background-color: #fff;}<br />
ul#nav li p {padding:0px;}<br />
ul#nav li.last,ul#nav li.last ul{border:none;width:193px;}<br />
<br />
</style> <br />
<div class="outer"><br />
<br />
<ul id="nav"><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg">&nbsp;&nbsp;HOME</a></p><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team">&nbsp;&nbsp;TEAM</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#under"><br />
Students</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#instructors"><br />
Advisors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Team#uni"><br />
Strasbourg</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project">&nbsp;&nbsp;PROJECT</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Strategy"><br />
Strategy</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Application"><br />
Application</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Acknowledgment">Acknowledgment</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Project/Reference"><br />
Reference</a></li><br />
<br />
</ul><br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results">&nbsp;&nbsp;RESULTS</a></p> <br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Biobricks">Biobricks</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Characterization"><br />
Characterization</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Results/Modelling">Modelling</a></li><br />
<br />
</ul><br />
<br />
<br />
</li><br />
<li><br />
<p><br/><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook">&nbsp;&nbsp;NOTEBOOK</a></p><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Syntethic">Synthetic Photoreceptors</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Microfluidics"><br />
Microfluidics</a></li><br />
<li><a href="https://2010.igem.org/Team:ESBS-Strasbourg/Notebook/Labbook">Lab-book</a></li><br />
<br />
</ul><br />
<br />
</li><br />
<li class="last"><br />
<p><br /><br />
<a href="https://2010.igem.org/Team:ESBS-Strasbourg/Sponsors">&nbsp;&nbsp;SPONSORS</a></p><br />
</li><br />
</ul><br />
</div><br />
</div><br />
</p><p><br />
<body style="background-color: #800000"><br />
<br />
<style><br />
<br />
p{<br />
padding: 5px 5px 5px 5px;<br />
}<br />
<br />
.heading{<br />
font: century gothic;<br />
color: #ffffff;<br />
}<br />
<br />
.name{<br />
font: century gothic;<br />
color: #ffffff;<br />
padding: 5px 5px 5px 5px;<br />
font-weight: bold;<br />
}<br />
<br />
table {<br />
left:0px;<br />
background-color: #222222;<br />
cell-padding: 5px;<br />
}<br />
<br />
#content{<br />
background-color:#222222;<br />
border:0px;<br />
font: 12px Arial;<br />
color: #cccccc;<br />
}<br />
<br />
#leftmenu{<br />
border-right:10px transparent;<br />
}<br />
<br />
td{<br />
color: #cccccc;<br />
cell-padding:5px;<br />
}<br />
<br />
.profiles{<br />
float:left;<br />
padding: 5px 10px 5px 5px;<br />
}<br />
<br />
.desc{<br />
padding: 5px 10px 5px 5px;<br />
text-align: justify;<br />
}<br />
</style><br />
<br />
<img src="http://i1001.photobucket.com/albums/af132/igemcalgary/blankspace.gif" height="205px"><br />
<br><br />
<table cellspacing=0><br />
<tr><br />
<div id="leftmenu"><br />
<td width="210" rowspan=65 bgcolor="#414141" valign="top"><br />
<br><br />
<div class="heading">THE TEAM</div><br />
<div class="desc"><br />
<a href="#under"><b>Undergraduates</b></a><br><br />
<ul><br />
<li><a href="#camille">Camille Bernard</a></li><br />
<li><a href="#fabian">Fabian Stiefel</a></li><br />
<li><a href="#georgio">Georgio Kourjian</a></li><br />
<li><a href="#jens">Jens-Sebastian Kalchschmidt</a></li><br />
<li><a href="#morgane">Morgane Griesbeck</a></li><br />
<li><a href="#pierre">Pierre Dillard</a></li><br />
<li><a href="#raphael">Raphaël Doineau</a></li><br />
<li><a href="#renaud">Renaud Renault</a></li><br />
<li><a href="#sebastien">Sebastien Pigeot</a></li><br />
<li><a href="#thea">Thea Ziegler</a></li><br />
<li><a href="#yohann">Yohann Lacotte</a></li><br />
<li><a href="#yves">Yves Gendrault</a></li><br />
</ul><br />
<br><br />
<a href="#instructors"><b>Instructors</b></a><br><br />
<ul><br />
<li><a href="#jacques">Pr. Jacques Haiech</a></li><br />
<li><a href="#maria">Pr. Maria Zeniou</a></li><br />
<li><a href="#Bruno">Pr. Bruno Chatton</a></li><br />
<li><a href="#Weiss">Pr. Etienne Weiss</a></li><br />
<li><a href="#Sibler">Pr. Annie-Paule Sibler</a></li><br />
<li><a href="#christophe">Pr. Christophe Lallement</a></li><br />
<li><a href="#morgan">Pr. Morgan Madec</a></li><br />
<li><a href="#andrew">Pr. Andrew Griffiths</a></li><br />
</ul><br />
<br><br />
<br />
<a href="#uni"><b>Our Universities</b></a><br><br />
<ul><br />
<li><a href="#bs">ESBS - Biotech School</a></li><br />
<li><a href="#uni">University of Strasbourg</a></li><br />
</ul><br />
<br><br />
<br />
<br />
<br />
</td><br />
<td width="10" rowspan=65 bgcolor="#800000"><br />
</div><br />
<br />
<br />
<br />
<tr><br />
<td width="750" bgcolor="#414141" height="420"><br />
<div class="heading"><br />
OUR TEAM<br />
</div><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2010/8/81/ESBS_Strasboug_wiki.JPG" width="500" height="375"><br />
</center><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#800000" height="10"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="under"></a><br />
<div class="heading"><br />
UNDERGRADUATES<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="camille"></a><br />
Camille Bernard<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/3/3d/Bernard_Camille.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="fabian"></a><br />
Fabian Stiefel<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/5/52/Stiefel_Fabian.jpg" <br />
height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Fabian is now in the ninth semester and so at his last year as student at the Ecole supérieure de Biotechnology de Strasbourg (ESBS). Before he entered the ESBS he studied two years of chemistry at the University of Freiburg, Germany. The idea of trilingual courses in four Universities in three different countries was and is very thrilling to him. He is very fond of synthetic biology and he wants to continue in this domain of research for his diploma/ master thesis. He finds it also very exciting to work with a highly motivated team on a self chosen project for the summer. <br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="georgio"></a><br />
Georgio Kourjian<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/3/31/Kourjian_Georgio.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="jens"></a><br />
Jens-Sebastian Kalchschmidt<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/d/d8/Kalchschmidt_Jens_Sebastian.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Jens is in his last year as student at the Ecole supérieure de Biotechnology de Strasbourg (ESBS). Before he enrolled in the ESBS he studied 2 years molecular biotechnology at the University of Heidelberg, Germany. He decided to take the chance to continue his biotechnology studies within the trilingual study course biotechnology at the ESBS implicating four universities in three countries. In retrospect, he must say that it was absolutely the right choice and the first long-term contact with the international research community. His research interests focus mostly on immunology and infectious diseases, but the iGEM participation sparked his interest in synthetic biology.<br />
<br />
<p>Personal remark: Marathon preparation can be best done during incubation times.</p><br />
<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="morgane"></a><br />
Morgane Griesbeck<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/0/04/Griesbeck_Morgane.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="pierre"></a><br />
Pierre Dillard<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/c/cf/Dillard_Pierre.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="raphael"></a><br />
Raphaël Doineau<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b1/Doineau_Raphael.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="renaud"></a><br />
Renaud Renault<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/e/ef/Renault_Renaud-glow.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Also known as Reno carré (Reno square) he tends to be famous for his experiments on the lack of sleep on himself. As some of his fellows, he is in the third year of ESBS, after having intensively studied Maths, Physics, Biology, Chemistry, and even more for 2 years in Classe Prépa. Since that time, he has been a MATLAB freak, coding some cool stuff you can see on his youtube channel (for instance <a href="http://www.youtube.com/watch?v=vm0qQlzh0hw">http://www.youtube.com/watch?v=vm0qQlzh0hw</a>) and earns his living (sushis are quite expensive) by doing clinical trials. He got interested in Synthetic Biology quite early, and more especially with the iGEM competition. He originally got the idea of engineering a controllable protease which was the basis of our project and is really glad that others were as exited and motivated about it as him.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="sebastien"></a><br />
Sebastien Pigeot<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/Pigeot_Sebastien.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="thea"></a><br />
Thea Ziegler<br />
</div><br />
<div class="profiles"><br />
<img src="http://1.bp.blogspot.com/_U0Z48ReXC-w/SeFK2tEv19I/AAAAAAAAA2I/UgqbUw_XNMs/s400/power_rangers_sign_off.jpg" height="200" width="200"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Thea started her studies at the Humboldt University Berlin with the Bachelor program of Biophysics. As the trinational conception and organization of the ESBS captivated her, she left the German capital after finishing the 4th semester and went to Strasbourg to continue with the diploma course in Biotechnology. In the current last year of her studies she decided to specialize in Synthetic Biology and to take part of the iGEM competition. Behind the basic idea of iGEM she was attracted of the opportunity to work independently without limitations in creativity. She is very satisfied with the theme her team chose, the role and functioning of photoreceptors fascinate her since the early beginning of her studies. In the future she wants to continue within this field; for her diploma thesis she would like to work with vertebrate photoreceptors.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="yohann"></a><br />
Yohann Lacotte<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a1/Lacotte_Yohann.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<div class="name"><br />
<a name="yves"></a><br />
Yves Gendrault<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b0/Gendrault_Yves.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"></td><br />
</tr><br />
<br />
<br />
<br />
<br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="instructors"></a><br />
<div class="heading"><br />
INSTRUCTORS<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="jacques"></a><br />
<div class="name"><br />
Pr. Jacques Haiech<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/Haiech.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
bla<br />
bla<br />
bla<br />
bla<br />
bla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="maria"></a><br />
<div class="name"><br />
Pr. Maria Zeniou<br />
</div><br />
<div class="profiles"><br />
<img src="http://medchem.u-strasbg.fr/pages/permanents/photos/zeniou.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
Maria Zeniou graduated as a molecular biologist in 2002. Her PhD project included genetic studies of an X-linked inherited disorder and functional studies on the protein kinase whose loss of function leads to this disease.<br />
After her PhD, she performed a four-year post-doc in molecular and cellular biology. Within this period, she studied the roles and the regulation of lipid modifying enzymes during the process of regulated hormone exocytosis from neuroendocrine cells.<br />
In 2007, she joined the Strasbourg University as an assistant professor and since 2008 she participates to the iGEM teams of the Ecole Supérieure de Biotechnology de Strasbourg (ESBS) as an instructor. The aim of her current research project is to better understand the physiopathology of gliomas.<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="bruno"></a><br />
<div class="name"><br />
Pr. Bruno Chatton<br />
</div><br />
<div class="profiles"><br />
<img src="http://transcription.u-strasbg.fr/images/photos/photo_CHATTON_Bruno.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="weiss"></a><br />
<div class="name"><br />
Pr. Etienne Weiss<br />
</div><br />
<div class="profiles"><br />
<img src="http://www.bhmag.fr/images/img3/windows-live-messsenger-logo.jpg" height="160" width="131"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="sibler"></a><br />
<div class="name"><br />
Pr. Annie-Paule Sibler<br />
</div><br />
<div class="profiles"><br />
<img src="http://www.bhmag.fr/images/img3/windows-live-messsenger-logo.jpg" height="160" width="131"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="christophe"></a><br />
<div class="name"><br />
Pr. Christophe Lallement<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/Lallement_Christophe.jpg" height="200" width="150"><br />
</div><br />
<br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"></td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="morgan"></a><br />
<div class="name"><br />
Pr. Morgan Madec<br />
</div><br />
<div class="profiles"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/Madec_Morgan.jpg" height="200" width="150"><br />
</div><br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="220" bgcolor="#414141"><br />
<a name="andrew"></a><br />
<div class="name"><br />
Pr. Andrew Griffiths<br />
</div><br />
<div class="profiles"><br />
<img src="http://www-isis.u-strasbg.fr/lbc/Group/Photos/Andrew.jpg" height="200" width="200"><br />
</div><br />
<br />
<div class="desc"><br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
blablabla<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"><br />
</td><br />
</tr><br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="bs"></a><br />
<div class="heading"><br />
ESBS - Biotech School<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<br><br />
<img src="http://irebs.u-strasbg.fr/IMG/jpg/PanoESBS2008-2.jpg"><br />
</center><br />
<br><br />
<p><b>ESBS - Ecole Superieure de Biotechnologie de Strasbourg</b></p><br />
The three-year curriculum in Biotechnology is organized by the “Upper Rhine Universities” in Freiburg, Basel, Karlsruhe and Strasbourg. Students from France, Germany and Switzerland receive an interdisciplinary and intensive, trilingual education in biotechnology.<br />
<br />
Most of the lectures take place at the École Supérieure de Biotechnologie de Strasbourg (ESBS) in Strasbourg. Intensive laboratory courses and internships are offered by the universities Basel, Freiburg and Karlsruhe.The languages for lectures and exams are French, German and English.<br />
<br />
Students for this program are selected after successful completion of two years of undergraduate education in sciences or engineering at a university or an equivalent institution.The degree obtained in this program is completed within 6 semesters. Each of the four partner universities is responsible for part of the program, according to their special strengths in research, resulting in a diverse program covering a wide spectrum of current research. All aspects of biotechnology are covered, from molecular biology to microbiology, bioprocess engineering and biocomputing. Lectures in patent law, economics and professional language courses complete the program. In the third year, students can focus on specialized areas, such as bioproduction or bioinformatics.<br />
<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#800000"><br />
</td><br />
</tr><br />
<tr><br />
<td width="750" height="50" bgcolor="#414141"><br />
<a name="uni"></a><br />
<div class="heading"><br />
THE UNIVERSITY OF STRASBOURG<br />
</div><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" height="10" bgcolor="#222222"><br />
</td><br />
</tr><br />
<br />
<tr><br />
<td width="750" bgcolor="#414141"><br />
<div class="desc"><br />
<center><br />
<br><br />
<img src="http://www.observatoiredessubventions.com/wp-content/uploads/universite-Strasbourg-subventions-aides.JPG"><br />
</center><br />
<br><br />
European by nature and international by design, the University's strengths and assets stem from its active involvement in virtually every discipline comprising the current body of knowledge.<br />
As a young university founded on an age-old tradition, it strives to attain cross-disciplinarity so that this mixing fosters new research opportunities and produces courses that meet society's need. The international dimension is fundamental for the University of Strasbourg and thanks to the world wide reputation of its research teams, built on excellence and efficiency, it emerges among Europe's foremost research universities. Each of the University's main academic fields of instruction is based upon research sections that are the driving force of the institution, with over 2,600 professors and 2,000 staff.<br />
The Technology Transfer Office, one of the very first developed in a French university, strives to promote the work of the researchers and facilitate partnerships with economic and institutional stakeholders.<br />
An essential player in the promotion of scientific and technical culture, the University interfaces with its host city, Strasbourg.<br />
<br />
Solidly anchored in the European Higher Education Area, the University of Strasbourg, a beating heart of the Alsatian metropolis with its 41,000 students, has the potential to face the challenging international competition.<br />
</div><br />
<br><br />
</td><br />
</tr><br />
<br />
</table><br />
<br />
</td><br />
</tr><br />
</table><br />
</body><br />
<br />
</p></div>Thezi