http://2010.igem.org/wiki/index.php?title=Special:Contributions/Sholle&feed=atom&limit=50&target=Sholle&year=&month=2010.igem.org - User contributions [en]2024-03-29T05:48:10ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Davidson-MissouriW/ProjectTeam:Davidson-MissouriW/Project2010-10-28T02:50:16Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="project_main" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div class="clear"></div> <br />
<div id="mission_box" style="padding:10px"> <h2> iGEM Davidson – Missouri Western 2010: Project </h2><br />
<a Name="abstract"></a> <br />
<h4>Abstract</h4> <br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The Cre-lox system is a tool that involves the splicing of a specific pair of DNA sequences called lox sites with an enzyme called Cre recombinase. We implicated this system in attempts to manipulate gene expression that mimics randomly "selecting objects" to fill a knapsack in order to solve the knapsack problem. To do this we needed a set of variant lox sites in order to create constructs that would yield different subsets of survival and fluorescence to optimally fill the knapsack. Initially the design to address the knapsack problem had several vital components using modules that consisted of lox sites that floxed the TetA gene and RFP.<br />
In our attempts to solve the knapsack problem, we assembled 10 new lox sites with mutations in the 8 bp region and floxed 16 out of 21 possible lox site combinations with red fluorescent protein with these variant lox sites. We built a construct with a fluorescent protein gene downstream of TetA to test for the presence of a terminator within the TetA gene. Along the way, we built several tools to assist us in the wetlab. In addition, we recorded several observations regarding gene expression and codon optimization as we progressed. Characterizing and attempting to understand these foundational problems became one of the new focuses of this team.<br />
</p><br />
<a Name="Introduction"></a><br />
<h4> Introduction</h4><br />
<br />
<h4> What is the Knapsack problem?</h4><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The knapsack problem is an NP-complete problem that asks whether: given a capacity and different weighted items, if there exists a subset of the items for which the sum of its values is equal to that of the capacity.<br><br><br />
<center><img src="https://static.igem.org/mediawiki/2010/d/da/Davidson-MissouriWknapsack.png" alt="" width=300/></center><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;There are several variations of the knapsack problem. The one that we are focusing on involves attempting to fit various items of various weights into a knapsack with a certain capacity. You have solved the knapsack problem if you manage to fill the knapsack to capacity. Other variations include looking for the closest possible value to the capacity that we can fill if the capacity itself cannot actually be reached.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In order to help people understand the knapsack problem and its complexity, we have built a <a href="http://72.22.219.205/knapsack">knapsack game</a>. In tutorial mode this game will give the user hints to help solve the problem. The challenge mode of the game should give the user an appreciation of the complexity of the knapsack problem and the overall class of NP-complete problems.<br />
</p><br />
<h4> Why Bacterial Computing? </h4><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In mathematics, there exists a class of complex mathematical problems, known as NP-complete problems, where there are no efficient algorithms to solve these problems other than exhaustive search of trying all the possible solutions one at a time and determining whether or not they are actually solutions. Bacterial computers offer a more efficient alternative approach to solving these NP-complete problems by using massive parallel computing. By engineering a bacterial computer, the billions of cells can simultaneously try the possible solutions and determine whether they are in fact a solution to the given problem.<br />
<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Besides the much greater efficiency and speed, another advantage of bacterial computers is that it actually becomes more powerful as the number of cells increase from cell division. Despite the complexity of bacterial computing, it is quickly gaining popularity because of its many advantages over the traditional computer. <br />
</p><br />
<h4> Our Biological Design </h4><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Cells of identical genotype can produce different levels of protein. This variation is called noise. While noise is generally treated as a necessary evil in synthetic biology, we chose to use the stochastic nature of gene expression to our advantage.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In order to control for the random nature of gene expression, we decided to implement a band pass filter. Essentially, this filter kills off cells that express either too much or two little of a chosen protein. Band pass filters harness and focus noise without eliminating it. We chose to use this system in order to help bridge the gap between a digital problem and an analog solution.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The combination of the tetA gene and an environment containing the antibiotic tetracycline produces a natural band pass filter. The tetA gene provides a level of resistance to tetracycline by creating efflux pumps that help the cell excrete the otherwise fatal tetracycline. However, these pumps come with a cost. They make the cell membrane more porous and permeable. With too many pumps, the cell cannot maintain homeostasis and dies; with too few pumps, the cells cannot remove tetracycline from its cytoplasm and dies from blocked protein synthesis. Therefore, tetA is a band pass filter.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;With this band pass filter in mind, we decided to make each cell a knapsack. Overexpression of tetA would be analogous to exceeding the capacity of the knapsack. However, we still had to solve a fundamental problem: weights. We used a novel tool called codon optimization to assign weights. By rewriting the codons of the tetA gene, we could alter the number of pumps produced by different versions of the same gene in a given time frame.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We planned to produce a chain of tetA modules with a different fluorescent protein attached to each one to act as visual and biochemical reporters. Each tetA and fluorescent color pair would be attached to a genetic switch in the form of the Cre/lox system. A switch being on would correspond to packing an item of that weight (color and tetA level) into the knapsack. Allowing this system to run and randomly flip switches on and off would ensure that all possible combinations of packed knapsacks would be generated. The tetA band pass filter could give us a narrow subsets of cells that solved the problem. We could then figure out how a cell packed the knapsack based on the fluorescent reporters.</p><br><br><br />
<center><img width=600 src="https://static.igem.org/mediawiki/2010/4/46/Davidson-MissouriWFrontpage.png" /></center><br />
<br><br />
<a Name="Summary and Outlook"></a><br />
<h4> Summary and Outlook</h4><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Our summer research project culminated with foundational advances in the fields of codon optimization, cre-lox characterization, and gene expression. The team successfully built 6 tetA constructs with varying levels of codon optimization and deoptimization. We also assembled eleven novel lox sites and characterized interactions between several of them in the presence of the cre protein. While choosing and characterizing reporters, we observed variations in gene expression due to environmental factors and inherent variability in bacterial cells. To assist our research in different ways, we designed tools such as the VeriPart, the Oligator, the Optimus, the Construct Simulator, and the Knapsack game.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;With the help of this integral research, we have the tools and knowledge to address the knapsack problem. In the future, we wish to further experiment with varying levels of codon optimization and gene placement. Finally, we wish to build and test different constructs to find the most efficient way to solving the knapsack problem.</p><br><br />
<br />
<div><br />
<a Name="References"></a><br />
<H4>References</H4><br />
<p><br />
Gwang Lee I, Izumu S. 1998. Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination. Gene 216: 55-65.<br />
<br><br><br />
Jean L, Tamily A. W, Hyuno K, Ryan W. D, Ju L, Robyn A. B, Joshua R. S, Jeff W. L. 2007 Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous systems. Nature: 450, 56-62.<br />
<br><br><br />
Jesse M. Fox, Ivan Erill. 2010 Relative Codon Adaptation: A Generic Codon Bias Index for Prediction of Gene Expression. DNA Research[ [Internet]: 17(3), 185-196. Avalaible from http://dnaresearch.oxfordjournals.org<br />
<br><br><br />
Ronald J, Harmen J. B, Mark G. 2003. Revisiting the codon adaptation index from a whole-genome perspective: analyzing the relationship between gene expression and codon occurrence in yeast using a variety of models. Nucleic Acid Research 31(8): 2242-2251. Available online from http://nar.oxfordjournals.org/cgi/content/full/31/8/2242<br />
<br><br><br />
Stuart B. Levy. 1992 April. MINIREVIEW Active Efflux Mechanisms for Antimicrobial Resistance. American Society for Microbiology 36 (4): 695-703.<br />
<br><br><br />
Ui-Jung J, Sun P, Gwang L, Ho-Joon S, Myung-Hee K. [received 22 August 2007, available online 30 August 2007]. Analysis of spacer regions derived from intramolecular recombination between heterologous loxP sites.<br />
<br><br><br />
Uttam R, Shibsankar D, Satyabrata S. 2009. [received 21 March 2008, accepted 16 October 2008, published online 8 January 2009]. Predicting Gene Expression Level from Relative Codon Usage Bias: An Application to Escherichia coli Genome. DNA Research [Internet]: 16, 13-30.<br />
<br><br><br />
</div><br />
<br />
<center><a href="#main_wrapper">top</a></center><br />
</div><br />
<br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriW/ProjectTeam:Davidson-MissouriW/Project2010-10-28T02:47:22Z<p>Sholle: </p>
<hr />
<div><html><br />
<body id="project_main" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div class="clear"></div> <br />
<div id="mission_box" style="padding:10px"> <h2> iGEM Davidson – Missouri Western 2010: Project </h2><br />
<a Name="abstract"></a> <br />
<h4>Abstract</h4> <br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The Cre-lox system is a tool that involves the splicing of a specific pair of DNA sequences called lox sites with an enzyme called Cre recombinase. We implicated this system in attempts to manipulate gene expression that mimics randomly "selecting objects" to fill a knapsack in order to solve the knapsack problem. To do this we needed a set of variant lox sites in order to create constructs that would yield different subsets of survival and fluorescence to optimally fill the knapsack. Initially the design to address the knapsack problem had several vital components using modules that consisted of lox sites that floxed the TetA gene and RFP.<br />
In our attempts to solve the knapsack problem, we assembled 10 new lox sites with mutations in the 8 bp region and floxed 16 out of 21 possible lox site combinations with red fluorescent protein with these variant lox sites. We built a construct with a fluorescent protein gene downstream of TetA to test for the presence of a terminator within the TetA gene. Along the way, we built several tools to assist us in the wetlab. In addition, we recorded several observations regarding gene expression and codon optimization as we progressed. Characterizing and attempting to understand these foundational problems became one of the new focuses of this team.<br />
</p><br />
<a Name="Introduction"></a><br />
<h4> Introduction</h4><br />
<br />
<h4> What is the Knapsack problem?</h4><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The knapsack problem is an NP-complete problem that asks whether: given a capacity and different weighted items, if there exists a subset of the items for which the sum of its values is equal to that of the capacity.<br><br><br />
<center><img src="https://static.igem.org/mediawiki/2010/d/da/Davidson-MissouriWknapsack.png" alt="" width=300/></center><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;There are several variations of the knapsack problem. The one that we are focusing on involves attempting to fit various items of various weights into a knapsack with a certain capacity. You have solved the knapsack problem if you manage to fill the knapsack to capacity. Other variations include looking for the closest possible value to the capacity that we can fill if the capacity itself cannot actually be reached.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In order to help people understand the knapsack problem and its complexity, we have built a <a href="http://72.22.219.205/knapsack">knapsack game</a>. In tutorial mode this game will give the user hints to help solve the problem. The challenge mode of the game should give the user an appreciation of the complexity of the knapsack problem and the overall class of NP-complete problems.<br />
</p><br />
<h4> Why Bacterial Computing? </h4><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In mathematics, there exists a class of complex mathematical problems, known as NP-complete problems, where there are no efficient algorithms to solve these problems other than exhaustive search of trying all the possible solutions one at a time and determining whether or not they are actually solutions. Bacterial computers offer a more efficient alternative approach to solving these NP-complete problems by using massive parallel computing. By engineering a bacterial computer, the billions of cells can simultaneously try the possible solutions and determine whether they are in fact a solution to the given problem.<br />
<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Besides the much greater efficiency and speed, another advantage of bacterial computers is that it actually becomes more powerful as the number of cells increase from cell division. Despite the complexity of bacterial computing, it is quickly gaining popularity because of its many advantages over the traditional computer. <br />
</p><br />
<h4> Our Biological Design </h4><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Cells of identical genotype can produce different levels of protein. This variation is called noise. While noise is generally treated as a necessary evil in synthetic biology, we chose to use the stochastic nature of gene expression to our advantage.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In order to control for the random nature of gene expression, we decided to implement a band pass filter. Essentially, this filter kills off cells that express either too much or two little of a chosen protein. Band pass filters harness and focus noise without eliminating it. We chose to use this system in order to help bridge the gap between a digital problem and an analog solution.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The combination of the tetA gene and an environment containing the antibiotic tetracycline produces a natural band pass filter. The tetA gene provides a level of resistance to tetracycline by creating efflux pumps that help the cell excrete the otherwise fatal tetracycline. However, these pumps come with a cost. They make the cell membrane more porous and permeable. With too many pumps, the cell cannot maintain homeostasis and dies; with too few pumps, the cells cannot remove tetracycline from its cytoplasm and dies from blocked protein synthesis. Therefore, tetA is a band pass filter.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;With this band pass filter in mind, we decided to make each cell a knapsack. Overexpression of tetA would be analogous to exceeding the capacity of the knapsack. However, we still had to solve a fundamental problem: weights. We used a novel tool called codon optimization to assign weights. By rewriting the codons of the tetA gene, we could alter the number of pumps produced by different versions of the same gene in a given time frame.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We planned to produce a chain of tetA modules with a different fluorescent protein attached to each one to act as visual and biochemical reporters. Each tetA and fluorescent color pair would be attached to a genetic switch in the form of the Cre/lox system. A switch being on would correspond to packing an item of that weight (color and tetA level) into the knapsack. Allowing this system to run and randomly flip switches on and off would ensure that all possible combinations of packed knapsacks would be generated. The tetA band pass filter could give us a narrow subsets of cells that solved the problem. We could then figure out how a cell packed the knapsack based on the fluorescent reporters.</p><br><br><br />
<center><img width=600 src="https://static.igem.org/mediawiki/2010/4/46/Davidson-MissouriWFrontpage.png" /></center><br />
<br><br />
<a Name="Summary and Outlook"></a><br />
<h4> Summary and Outlook</h4><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Our summer research project culminated with foundational advances in the fields of codon optimization, cre-lox characterization, and gene expression. The team successfully built 6 tetA constructs with varying levels of codon optimization and deoptimization. We also assembled eleven novel lox sites and characterized interactions between several of them in the presence of the cre protein. While choosing and characterizing reporters, we observed variations in gene expression due to environmental factors and inherent variability in bacterial cells. To assist our research in different ways, we designed tools such as the VeriPart, the Oligator, the Optimus, the Construct Simulator, and the Knapsack game.<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;With the help of this integral research, we have the tools and knowledge to address the knapsack problem. In the future, we wish to further experiment with varying levels of codon optimization and gene placement. Finally, we wish to build and test different constructs to find the most efficient way to solving the knapsack problem.</p><br><br />
<br />
<div><br />
<a Name="References"></a><br />
<H4>References</H4><br />
<p><br />
Gwang Lee I, Izumu S. 1998. Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination. Gene 216: 55-65.<br />
<br><br><br />
Jean L, Tamily A. W, Hyuno K, Ryan W. D, Ju L, Robyn A. B, Joshua R. S, Jeff W. L. 2007 Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous systems. Nature: 450, 56-62.<br />
<br><br><br />
Jesse M. Fox, Ivan Erill. 2010 Relative Codon Adaptation: A Generic Codon Bias Index for Prediction of Gene Expression. DNA Research[ [Internet]: 17(3), 185-196. Avalaible from http://dnaresearch.oxfordjournals.org<br />
<br><br><br />
Ronald J, Harmen J. B, Mark G. 2003. Revisiting the codon adaptation index from a whole-genome perspective: analyzing the relationship between gene expression and codon occurrence in yeast using a variety of models. Nucleic Acid Research 31(8): 2242-2251. Available online from http://nar.oxfordjournals.org/cgi/content/full/31/8/2242<br />
<br><br><br />
Stuart B. Levy. 1992 April. MINIREVIEW Active Efflux Mechanisms for Antimicrobial Resistance. American Society for Microbiology 36 (4): 695-703.<br />
<br><br><br />
Ui-Jung J, Sun P, Gwang L, Ho-Joon S, Myung-Hee K. [received 22 August 2007, available online 30 August 2007]. Analysis of spacer regions derived from intramolecular recombination between heterologous loxP sites.<br />
<br><br><br />
Uttam R, Shibsankar D, Satyabrata S. 2009. [received 21 March 2008, accepted 16 October 2008, published online 8 January 2009]. Predicting Gene Expression Level from Relative Codon Usage Bias: An Application to Escherichia coli Genome. DNA Research [Internet]: 16, 13-30.<br />
<br><br><br />
</div><br />
<br />
<center><a href="#main_wrapper">top</a></center><br />
</div><br />
<br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-27T07:16:45Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
<!-- body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);} --><br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
#SideBar { float :left;<br />
width: 323px;<br />
margin-top: 1px;<br />
}<br />
<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li> --><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li> --><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-27T07:15:36Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
<!-- body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);} --><br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 0px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
#SideBar { float :left;<br />
width: 323px;<br />
margin-top: 1px;<br />
}<br />
<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li> --><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li> --><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-27T07:11:07Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
<!-- body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);} --><br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
#SideBar { float :left;<br />
width: 323px;<br />
margin-top: 1px;<br />
}<br />
<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li> --><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li> --><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-27T07:07:11Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
<!-- body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);} --><br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 5px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
#SideBar { float :left;<br />
width: 323px;<br />
}<br />
<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li> --><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li> --><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T07:02:53Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/8/8f/DavidsonWesternPic6.jpg" width="323" height="220" vspace="3"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T07:02:14Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/8/8f/DavidsonWesternPic6.jpg" width="323" height="220" vspace="3"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T07:00:58Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220" vspace="3"><br />
<img src="https://static.igem.org/mediawiki/2010/8/8f/DavidsonWesternPic6.jpg" width="323" height="220" vspace="3"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-27T06:55:33Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
<!-- body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);} --><br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
#SideBar { float :left;<br />
width: 323px;<br />
}<br />
<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li> --><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li> --><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:51:00Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200" vspace="5"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220" vspace="5"><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250" vspace="5"><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220" vspace="5"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220" vspace="5"><br />
<img src="https://static.igem.org/mediawiki/2010/8/8f/DavidsonWesternPic6.jpg" width="323" height="220" vspace="5"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:49:54Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200" vspace="10"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220" vspace="10"><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/8/8f/DavidsonWesternPic6.jpg" width="323" height="220" border="2"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:47:52Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200" border="10"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220" border="10"><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/8/8f/DavidsonWesternPic6.jpg" width="323" height="220" border="2"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:46:41Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220" border="2"><br />
<img src="https://static.igem.org/mediawiki/2010/8/8f/DavidsonWesternPic6.jpg" width="323" height="220" border="2"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:42:12Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/8/8f/DavidsonWesternPic6.jpg" width="323" height="220"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/File:DavidsonWesternPic6.jpgFile:DavidsonWesternPic6.jpg2010-10-27T06:39:09Z<p>Sholle: </p>
<hr />
<div></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:36:49Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/b/b8/DavidsonWesternPic5.jpg" width="323" height="220"><BR><BR><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:34:07Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220"><BR><BR><br />
<br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:33:34Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220"><BR><BR><br />
[[Image:DavidsonWesternPic5.jpg|232px]]<br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/File:DavidsonWesternPic5.jpgFile:DavidsonWesternPic5.jpg2010-10-27T06:30:53Z<p>Sholle: </p>
<hr />
<div></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:29:57Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/16/DavidsonWesternPic4.jpg" width="323" height="220"><BR><BR><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/File:DavidsonWesternPic4.jpgFile:DavidsonWesternPic4.jpg2010-10-27T06:28:48Z<p>Sholle: </p>
<hr />
<div></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:27:10Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="250"><BR><BR><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:26:34Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/7/7d/DavidsonWesternPic3.jpg" width="323" height="220"><BR><BR><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/File:DavidsonWesternPic3.jpgFile:DavidsonWesternPic3.jpg2010-10-27T06:25:39Z<p>Sholle: </p>
<hr />
<div></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:24:48Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="220"><BR><BR><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:23:54Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="200"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:23:15Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><BR><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="200"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:22:00Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1e/DavidsonWesternPic2.jpg" width="323" height="200"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/File:DavidsonWesternPic2.jpgFile:DavidsonWesternPic2.jpg2010-10-27T06:20:09Z<p>Sholle: </p>
<hr />
<div></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:18:30Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg" width="323" height="200"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriWTeam:Davidson-MissouriW2010-10-27T06:16:18Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="home" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div id="orangeBox"><h3>Optimizing Codons</h3><br><br />
<p>Building weighted items for the Knapsack through codon variation of the TetA gene led to Foundational Advances&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Details</a><br />
</div><br />
<div id="greenBox"><h3>Characterizing Cre/Lox</h3><br><br />
<p>Foundational Advances were made as 11 novel lox sites for Cre recombination were built for randomly choosing Knapsack objects<br />
</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Details</a><br />
</div><br />
<div id="blueBox"><h3>Measuring Gene Expression</h3><br><br />
<p>Design and construction of a Knapsack biological computer required Foundational Advances in the measurement of gene expression</p><br />
<a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Details</a><br />
</div><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h3> iGEM Davidson – Missouri Western 2010:<br>Foundational Advances in Biology and the Knapsack Problem </h3><br />
<p> The Davidson/Missouri Western multidisciplinary team is using synthetic biology to address a mathematical problem in <i>Escherichia coli</i>. Specifically, we are addressing the Knapsack Problem, an NP-complete problem that asks, “Given a finite number of weighted items, can one find a subset of these items that completely fills a knapsack of fixed capacity?” </p><br />
<br />
<p>In our design, weighted items are represented by versions of <i>TetA</i> genes that confer measurably distinct levels of tetracycline resistance. We have altered the codons of the wild type <i>TetA</i> gene, optimizing and de-optimizing several segments of the coding sequence. Each <i>TetA</i> variant is coupled with a distinctive fluorescent gene, and each pair of genes is flanked by <i>lox</i> sites. In the presence of Cre protein, the <i>lox</i> mechanism either inverts or excises the coding sequence, yielding different combinations of expressed <i>TetA</i> variants. An expressed variant corresponds to an item being placed in the knapsack. Over-expression of <i>TetA</i> results in cell death, which represents exceeding the capacity of the knapsack. Under-expression of <i>TetA</i> causes the cells to stop growing due to tetracycline in the growth medium, which represents not completely filling the knapsack. Surviving cells correspond to cells within a certain range of <i>TetA</i> production and the fluorescence tag allows for comparative measurement within this range.</p><br />
<br />
<p>The team is also working to develop software tools relevant to the specific project and applicable to projects in the wider synthetic biology community.</p><br><br />
</div><br />
<div id="team_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team"><img src="https://static.igem.org/mediawiki/2010/8/86/Davidson-MissouriWTeam.png" alt="Team" width="174px" height="36px"/></center><br />
<h3>Team</h3></a><br />
<p>The 2010 iGEM team from Davidson College and Missouri Western State University is composed of approximately 15 multidisciplinary undergraduate students and 4 professors – 2 biologists and 2 mathematicians. The team includes math, biology, computer science, and chemistry majors. The team has traveled back and forth across the country and research was conducted on both campuses. View the Davidson- Missouri Western <a href="https://2010.igem.org/Team:Davidson-MissouriW/Team">team </a>page. </p><br />
</div><br />
<div id="zoo_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project"><img src="https://static.igem.org/mediawiki/igem.org/3/3e/Davidson-MissouriW_Project.jpeg" alt="Project"/></center><br />
<h3>Project</h3></a><br />
<p>In an attempt to solve the knapsack problem, we explored a variety of different topics. We optimized the codons for a portion of the TetA gene in order to produce variant genes that confer differing amounts of tetracycline resistance. We also created 11 variant lox sites that have differing recombination frequencies. Finally, we explored gene expression of RFP and the TetA gene. View the <a href="https://2010.igem.org/Team:Davidson-MissouriW/Project">work </a> done by Davidson and Missouri Western undergrads.</p><br />
</div><br />
<div id="notebook_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook"><img src="https://static.igem.org/mediawiki/2010/0/0b/Davidson-MissouriWNotebook.png" alt="Notebook"/></center><br />
<h3>Notebook</h3></a><br />
<p>Lab notebooks are an integral part of conducting scientific research because the results of a scientific experiment must be reproducible. In an effort to properly document our efforts, each team member kept a detailed record of their daily activities. We have condensed the information from all of these sources so that each entry in this virtual notebook contains the highlights of each day’s work. View the daily progress of our project via the lab <a href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a>.</p><br />
</div><br />
<div class="clear"><br />
</div><br />
<div id="parts_box"> <center><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW"><img src="https://static.igem.org/mediawiki/2010/2/26/Davidson-MissouriWParts.jpg" alt="Parts"/></center><br />
<h3>Parts</h3></a><br />
<p>BioBricks are the foundation of iGEM. We have created more than 40 basic and composite parts that are now available for the entire synthetic biology community to use. Among these parts are 11 new variant lox sites in both forward and reverse versions. Using these variants, we have constructed “modules” consisting of RFP floxed by multiple different combinations. Furthermore, we have assembled new cre recombinase expression cassettes and added them to the RFP modules. View the <a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=Davidson-MissouriW">parts</a> built by our team.</p> <br />
</div><br />
<div id="gallery_box"><center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"><img src="https://static.igem.org/mediawiki/2010/9/90/Davidson-MissouriW_Tools.png" alt="Tools"/></center><br />
<h3>Tools</h3></a><br />
<p> We have designed many programs that will be useful to the public. VeriPart will identify the BioBrick part associated with any DNA sequence thus eliminating the tedious process of manually confirming sequences. The Oligator suggests which oligos are needed to assemble the submitted sequence. The Optimus allows users to choose different equations to optimize a given segment of DNA. The Construct Simulator models how floxed modules behave when exposed to cre. The Knapsack Game is an educational tool intended to explain the problem. View our<a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools"> Tools </a>page.</p><br />
</div><br />
<div id="sponsors_box"> <center><a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"><img src="https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWsponsorship.jpg" alt="Acknowledgements"/></center><br />
<h3>Acknowledgements</h3></a><br />
<p> This project and our participation in iGEM 2010 would not have been possible without help from numerous sources. We have received invaluable assistance from numerous people both at Davidson College and at Missouri Western State University. Furthermore, many organizations have contributed generously to our efforts, and without their help, we could not have come this far. This section is a thank you to our <a href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors"> sponsors </a> and all of those who have helped us in any way.</p> <br />
</div> <br />
<div class="clear"><br />
</div><br />
<center><a href="#main_wrapper">Top</a></center><br />
</div> <!-- end SubWrapper --><br />
<div id="SideBar"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1a/DavidsonWesternPic1.jpg"><br />
</div><br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-27T06:11:41Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
<!-- body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);} --><br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
#SideBar { float :left;<br />
width: 323px;<br />
}<br />
<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li> --><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/File:DavidsonWesternPic1.jpgFile:DavidsonWesternPic1.jpg2010-10-27T06:05:15Z<p>Sholle: </p>
<hr />
<div></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-27T05:53:57Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
<!-- body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);} --><br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li> --><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T04:36:13Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<!-- <li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li> --><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriW/NotebookTeam:Davidson-MissouriW/Notebook2010-10-26T04:33:59Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<div style="padding:10px"><br />
==Notebook==<br />
<br />
'''May 25, 2010 to May 29, 2010'''<br />
<hr><br />
<ul><br />
<li>Davidson traveled to Missouri Western and further discussed project ideas</li><br />
</ul> <br />
<br><br />
'''June 1, 2010'''<br />
<hr><br />
<ul><br />
<li>Tested to find lethal concentration of Tet in plated and liquid mediums</li><br />
<li>Verified RCBS with our sequences and researched codon optimization methods</li><br />
<li>Analyzed probabilities for constructs A and B</li><br />
<li>Learned lab protocols and organized lab <br />
<li>Created list of needed parts and parts we need<br />
</ul> <br />
<br><br />
'''June 2, 2010'''<br />
<hr><br />
<ul><br />
<li>Mini prepped, diagnostic RP digest, preparative digest, ligation, pBAD+RBS-RFP </li><br />
<li>Researched different ways to optimize a gene</li><br />
<li>Began simulation for Constructs A and B</li><br />
<li>Learned miniprep and digestion protocols<br />
<li>Learned how to document gels<br />
</ul><br />
<br><br />
'''June 3, 2010'''<br />
<hr><br />
<ul><br />
<li>Mini prepped, diagnostic RP digest, preparative digest, ligation, pBAD+RBS-RFP </li><br />
<li>Researched restriction sites and created proposal for gene optimization</li><br />
<li>Continued work on simulation in Java and Matlab</li><br />
<li>Learned about biobrick restriction sites and sticky ends<br />
<li>Ordered lox oligos<br />
</ul><br />
<br><br />
'''June 4, 2010'''<br />
<hr><br />
<ul><br />
<li>Mini prepped RBS-TetA-TT<br />
<li>RX Fragment digestion for RBS-TetA-TT<br />
<li>Analyzed the optimization of tetA sequence and researched properties of Lox sites<br />
<li>Debugged Simulations<br />
<li>Sent off parts for sequencing<br />
<li>Learned the transformation protocol <br />
</li><br />
</ul><br />
<br><br />
'''June 7, 2010'''<br />
<hr><br />
<ul><br />
<li>Ligate and plasmid check for pSB1A2 or pSB1AK3<br />
<li>Began working to improve the Lancelator and created histograms for simulations<br />
</li><br />
<li>Gel purified vector for lox ligations<br />
<li>Divided up constructs to be ligated<br />
</ul><br />
<br><br />
'''June 8, 2010'''<br />
<hr><br />
<ul><br />
<li>Double digest on pBAD-RBS-RFP to make an RS fragment insert </li><br />
<li>Worked on a Perl program that check for Bio Brick Restriction Sites<br />
<li>Analyzed sequencing results using ApE program<br />
<li>BOUGHT HAWAIIAN SHIRTS!!!!!<br />
</ul><br />
<br><br />
'''June 9, 2010'''<br />
<hr><br />
<ul><br />
<li>EcoRI and PstI digest on pLac and pBad colonies <br />
<li>Arabinose and IPTG concentration experiments started </li><br />
<li>Continued work on the Lancelator program and began working on a different simulation for Construct C and D<br />
<li>Annealed lox oligos together<br />
<li>Gel purified pBad+RBS+Cre (“Cre construct” from 2010 igem kit plate)<br />
</ul><br />
<br><br />
'''June 10, 2010'''<br />
<hr><br />
<ul><br />
<li>Picked 14 colonies from pLac-RBS-RFP and pLac-RBS-RFP-RBS plates<br />
<li> Started inducer curve experiments</li><br />
<li>Linked Lancelator code to the website and continued simulations<br />
<li>Performed ligations involving lox sites<br />
</ul><br />
<br><br />
'''June 11, 2010'''<br />
<hr><br />
<ul><br />
<li>Ligated S03736 into pSB1A7 vector<br />
<li>EcoRI/PstI digest on pLac-RBS-RFP-RBS colonies</li><br />
<li>Added new features to the Lancelator and worked on numerically representing Construct C for the Matlab simulation<br />
<li>Performed colony PCR screening for the first ligations<br />
</ul><br />
<br><br />
'''June 14, 2010'''<br />
<hr><br />
<ul><br />
<li>EcoRI/PstI diagnostic digest performed on pBad-RBS-RFP colonies <br />
<li>Inducer curve experiment started on pBad and pLac constructs </li><br />
<li>Debugged Lancelator and finished numerical representation for the simulation<br />
<li>Size verified lox forward and lox reverse sites<br />
<li>Ligated “cre construct” into low, medium, and high copy kanamycin resistant vectors<br />
</ul><br />
<br><br />
'''June 15, 2010'''<br />
<hr><br />
<ul><br />
<li>Ligated pLac-RBS-RFP + RBS-TetA<br />
<li>IPTG experiment started on pLacI-RBS-RFP </li><br />
<li>Worked on the color schemes for the new Oligator<br />
<li>Created a new construct that might be helpful for the biologists<br />
<li>Planning for Amp+Tet experiments<br />
<li>First “cre construct” ligations failed<br />
</ul><br />
<br><br />
'''June 16, 2010'''<br />
<hr><br />
<ul><br />
<li>EcoRI/PstI diagnostic digest performed on pLac-RBS-RFP in pSB1A7 vector<br />
<li>IPTG experiment started on plates with pLac and pLacI constructs </li><br />
<li>Began working on a Java code that will run simulations for all the constructs<br />
<li>Researched on NP-Complete problems<br />
<li>Religated “cre construct”<br />
<li>Lox sites sent off for sequencing <br />
</ul><br />
<br><br />
'''June 17, 2010'''<br />
<hr><br />
<ul><br />
<li>Flourimeter data collected from IPTG experiment<br />
<li>Ligated pLacI-RBS-RFP + RBS-TetA </li><br />
<li>Worked on graphics of the Java program<br />
<li>Studied specific NP-Complete problems and brainstormed ways to incorporate them in our project<br />
<li>Lox sites were frozen down and entered in GCAT-alog<br />
<li>Agar plates were prepared for Amp+Tet experiments<br />
</ul><br />
<br><br />
'''June 18, 2010'''<br />
<hr><br />
<ul><br />
<li>Picked 4 colonies from pLacI-RBS-RFP-RBS-TetA plates <br />
<li>IPTG experiment started using newly created IPTG </li><br />
<li>Debugged the Java program <br />
<li>Created a new page for the GCAT server<br />
<li>Planned kanamycin experiments <br />
</ul><br />
<br><br />
'''June 21, 2010'''<br />
<hr><br />
<ul><br />
<li>Digested TetA with EcoRI/NheI<br />
<li>Annealed oligos for optimized and deoptimized TetA segment 1 </li><br />
<li>Improved the Java program<br />
<li>Began categorizing the knapsack problem into subparts<br />
<li>Successfully ligated ptet+different lox sites <br />
<li>Planned different combinations of variant lox sites<br />
</ul><br />
<br><br />
'''June 22, 2010'''<br />
<hr><br />
<ul><br />
<li>Ligated annealed TetA oligos into digested TetA<br />
<li>Inducer curve experiment started on pLac and pLacI constructs </li><br />
<li>Added buttons to the java program<br />
<li>Brainstormed biological implications in different NP-Complete problems<br />
<li>Confirmed successful ligations of lox sites from sequencing results<br />
<li>First pilot test for Amp+Tet experiments<br />
</ul><br />
<br><br />
'''June 23, 2010'''<br />
<hr><br />
<ul><br />
<li>Preparative NheI/BamHI digest performed on TetA<br />
<li>Preparative EcoRI/NheI digest performed on TetA </li><br />
<li>Restructuring and reorganizing the Java program<br />
<li>Reviewed numerical algorithms and its relation to NP-Complete problems<br />
<li>Researched data on possible transcription terminator in Tet A <br />
<li>Failure of cre experiments <br />
</ul><br />
<br><br />
'''June 24, 2010'''<br />
<hr><br />
<ul><br />
<li>Annealed optimized and deoptimized segment 1 TetA ligated into vector <br />
<li>Annealed optimized and deoptimized segment 2 TetA ligatied into vector</li><br />
<li>Added weight characteristic to the fluorescent proteins in the Java code<br />
<li>Continued exploration of NP-Complete problems<br />
<li>Ligations to construct tet constructs <br />
</ul><br />
<br><br />
'''June 27, 2010'''<br />
<hr><br />
<ul><br />
<li>Inducer curve experiment started on pLac and pLacI constructs <br />
<li>Picked colonies from TetA segment 1 & 2 optimized & deoptimized plates </li><br />
<li>Added histograms to the Java Code<br />
<li>Researched and analyzed the effectiveness of Cre<br />
<li>Size verification of ptet+variant lox sites <br />
</ul><br />
<br><br />
'''June 28, 2010'''<br />
<hr><br />
<ul><li>Added the option for the user to input the weights of the various modules and began work on custom construct builder<br />
<li>Picked colonies from TetA segment 1 & 2 optimized & deoptimized plates </li><br />
<li>Planned to ligate pBad+RBS+Cre in ampicillin resistant vectors <br />
<li>Researched plasmid partitioning <br />
</ul><br />
<br><br />
'''June 29, 2010'''<br />
<hr><br />
<ul><br />
<li>Screened segment 1 optimized and deoptimized candidate clones using RFLP<br />
<li>Screened segment 2 optimized and deoptimized candidate clones using RFLP </li><br />
<li>Finished the simulation program and exported it<br />
<li>Explored the set covering problem<br />
<li>Researched applications of the knapsack problem in cryptography<br />
<li>Ligated ptet+LoxP+RBS+RFP<br />
</ul><br />
<br><br />
'''June 30, 2010'''<br />
<hr><br />
<ul><br />
<li>Tet titration experiment performed on pLac and pLacI +RBS-RFP-RBS-TetA<br />
<li>Ligated TetA onto pLac and pLacI +RBS-RFP-RBS-TetA with no terminator </li><br />
<li>Some final work on the simulation program<br />
<li>Discussed new ideas such as integer programming<br />
<li>PCR screening of “RFP construct” <br />
<li>Ptet+variant lox sites were frozen down<br />
</ul><br />
<br><br />
'''July 1, 2010'''<br />
<hr><br />
<ul><br />
<li>Preparative BamHI/NheI digest performed on TetA <br />
<li>New experiment protocol developed for reduced vector background noise </li><br />
<li>Added terminators to the program<br />
<li>Ran test trials of the program and analyzed its results<br />
<li>Planned experiments for using Cre as “front” and “back” vector<br />
<li>Ligated first “floxed” constructs <br />
</ul><br />
<br><br />
'''July 2, 2010'''<br />
<hr><br />
<ul><br />
<li>Mini prepped, diagnostic RP digest, preparative digest, ligation, pBAD+RBS-RFP </li><br />
<li>Continued work on the categorization of the knapsack problem<br />
<li>Researched Instant Insanity problem<br />
<li>PCR screening for “floxed constructs”<br />
</ul><br />
<br><br />
'''July 6, 2010'''<br />
<hr><br />
<ul><br />
<li>Ligated S04446 and S04447 to J31007<br />
<li>Tet titration experiment performed on pLac and pLacI +RBS-RFP-RBS-TetA </li><br />
<li>Added direction of terminators in the simulation<br />
<li>Researched cryptography application<br />
<li>Size verified “floxed constructs”<br />
<li>Digested “Cre construct” as front and back vector <br />
</ul><br />
<br><br />
'''July 7, 2010'''<br />
<hr><br />
<ul><br />
<li>Ligated S04448 to RBS-TetA<br />
<li>Ligated S04449 to RBS-TetA</li><br />
<li>Fixed memory leak in the simulation program<br />
<li>Researched integer programming<br />
<li>Sent off “floxed constructs" for sequencing<br />
<li>Ligated “floxed constructs” into pBad+RBS+Cre as “front” and “back” vector <br />
</ul><br />
<br><br />
'''July 8, 2010'''<br />
<hr><br />
<ul><br />
<li>IPTG experiment started using pre-induced method <br />
<li>IPTG experiment started using varying levels of tetracycline </li><br />
<li>Worked on animation for the simulation and continued analysis of the results of the simulation<br />
<li>Discussed integer programming as a group<br />
<li>Data suggests something wrong with “cre construct” <br />
</ul><br />
<br><br />
'''July 9, 2010'''<br />
<hr><br />
<ul><br />
<li>Picked optimized and deoptimized TetA colonies<br />
<li>Flourimeter data collected from IPTG experiment </li><br />
<li>Revised some features on the program<br />
<li>Began working on theoretical probability models of the different constructs<br />
<li>Further experiments with “cre construct” <br />
</ul><br />
<br><br />
'''July 10, 2010'''<br />
<hr><br />
<ul><br />
<li>Used RFLP to screen for candidate TetA clones <br />
<li>Transformed various pLac and pLacI constructs into MG1655 cells </li><br />
<li>Experiments suggest pBad+RBS+Cre from iGem 2010 kit plate is incorrect <br />
</ul><br />
<br><br />
'''July 12, 2010'''<br />
<hr><br />
<ul><br />
<li>Used RFLP to screen for candidate TetA clones <br />
<li>Transformed various pLac and pLacI constructs into MG1655 cells </li><br />
<li>Added slider feature to the simulation program<br />
<li>Continued work on the theoretical probability model for Construct A of size 3<br />
<li>Tested “cre construct” from 2009 iGem kit plate<br />
</ul><br />
<br><br />
'''July 13, 2010'''<br />
<hr><br />
<ul><br />
<li>Used RFLP to screen for candidate TetA clones <br />
<li>EcoRI/PstI diagnostic digest performed on K199150 </li><br />
<li>Added custom prefixes and suffixes to the Oligator<br />
<li>Found a general equation for finding theoretical probabilities for Construct A of size 3<br />
<li>Sent off “floxed sites for sequencing” <br />
</ul><br />
<br><br />
'''July 14, 2010'''<br />
<hr><br />
<ul><br />
<li>Ligated segment 2 optimized and deoptimzed TetA behind segment 1<br />
<li>IPTG experiment started on I715039-1 and I715039-2 </li><br />
<li>Began analyzing MW optimization code<br />
<li>Finished theoretical probabilities for Construct A of size 3<br />
<li>Cre construct from 2009 plate was incorrect as well <br />
</ul><br />
<br><br />
'''July 15, 2010'''<br />
<hr><br />
<ul><br />
<li>Cell count data collected from IPTG experiments<br />
<li>Flourimeter data collected from IPTG experiments </li><br />
<li>Worked on a separate program using the CAI equation<br />
<li>Began working on theoretical probabilities for Construct A of size 4<br />
<li>Ligated more “floxed constructs” <br />
</ul><br />
<br><br />
'''July 16, 2010'''<br />
<hr><br />
<ul><br />
<li>Tet titration experiment started using pSB3T5 vector<br />
<li>Tet titration experiment started using optimized and deoptimized TetA </li><br />
<li>Added changes to the optimizer code<br />
<li>Researched how to solve a system of recursive relations into closed form<br />
<li>Decided to ligate cre into pBad+RBS and pLac+RBS <br />
</ul><br />
<br><br />
'''July 19, 2010'''<br />
<hr><br />
<ul><br />
<li>Cell count data collected from Tet titrations<br />
<li>Tet titration experiment started using optimized and deoptimized TetA </li><br />
<li>Fixed the error in the CAI optimization program<br />
<li>Continued analyzing systems of recursive relations<br />
<li>Ligated pBad+RBS+Cre and pLac+RBS+Cre <br />
</ul><br />
<br><br />
'''July 20, 2010'''<br />
<hr><br />
<ul><br />
<li>Flourimeter data collected on IPTG experiment </li><br />
<li>Adapted the Oligator page for the Optimization program, now called the Optimus<br />
<li>Made progress on solving the system of recursive relations that we have<br />
<li>Performed IPTG and tet experiments <br />
<li>PCR screened both “cre constructs”<br />
<li>pBad+RBS+Cre ligation unsuccesful<br />
</ul><br />
<br><br />
'''July 21, 2010'''<br />
<hr><br />
<ul><br />
<li>IPTG experiment started on optimized and deoptmized TetA constructs<br />
<li>Passage I715039-1 and I715039-2 experiments started </li><br />
<li>Started to link the ruby program on the webpage<br />
<li>Finished theoretical probabilities for Construct A of size 4<br />
<li>"Floxed constructs" ligated into pLac+RBS+Cre <br />
</ul><br />
<br>'''July 22, 2010'''<br />
<hr><br />
<ul><br />
<li>IPTG experiment started using varying tetracycline concentrations<br />
<li>Cell count data collected on IPTG TetA experiment </li><br />
<li>Linked the Optimus on the webpage<br />
<li>Started theoretical probabilities for Construct A of size 5<br />
<li>Cre was religated into pBad+RBS<br />
</ul><br />
<br><br />
<br>'''July 23, 2010'''<br />
<hr><br />
<ul><br />
<li>Cell count data collected from IPTG experiment<br />
<li>Flourimeter data collected from IPTG experiment </li><br />
<li>Worked on the tutorial for the Optimus and added various features<br />
<li>Worked on a Matlab tool based on the pancake problem that can find the theoretical probabilities of different modules in different positions<br />
<li>Last of the “floxed constructs” were ligated <br />
</ul><br />
<br><br />
<br>'''July 26, 2010'''<br />
<hr><br />
<ul><br />
<li>Missouri traveled to Davidson to work on wiki and presentation materials<br />
<li>The two campuses reunite and share recent findings </li><br />
</ul><br />
<br><br />
<br>'''July 27, 2010'''<br />
<hr><br />
<ul><br />
<li>Began work on the team wiki </li><br />
</ul><br />
<br><br />
<br>'''October 25, 2010'''<br />
<hr><br />
<ul><br />
<li>Finalizing team wiki </li><br />
</ul><br />
<br><br />
<html><br />
<center><a href="#main_wrapper">top</a></center><br />
</html><br />
</div></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpressionTeam:Davidson-MissouriW/MeasuringExpression2010-10-26T04:31:39Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<h2> iGEM Davidson – MWSU 2010: Measuring Gene Expression </h2><br />
<h3> </h3><br />
<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The system we originally designed to address the knapsack problem had several vital components. The TetA and RFP genes, along with their corresponding gene products, served as our reporters to see if and how a cell solved the knapsack problem. However, we recorded several observations regarding gene expression as we progressed. Characterizing and attempting to understand these foundational problems became one of the new focuses of this team.<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Results from past Davidson and Missouri Western research hinted at the presence of a transcriptional terminator within the TetA gene. Any gene located downstream of the 3’ end of the TetA gene did not appear to be expressed. This gene codes for an effluent pump that physically removes the antibody tetracycline from the cell.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;To test for the presence of this terminator, we created a construct with a fluorescent protein gene downstream of TetA. If TetA really does block transcription, we would expect to see no fluorescence despite induction of the promoter that precedes the construct (pLac+TetA+RFP). We also tested pLac+TetA+RFP to see if the gene products provided protection from tetracycline compared to a negative control..</p><br />
<img src="https://static.igem.org/mediawiki/2010/6/6e/Davidson-MissouriWTPS5.png" id="fig1" height=100 width = 200 onmouseover="makeBig('fig1')" onclick= "makeSmall('fig1')"><br />
<br><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The data suggest that the IPTG (0.5mM) inducer decreases cell density in all three cell types. In addition, the construct with TetA before RFP was only able to survive the presence of tetracycline (50ug/mL) when the inducer IPTG was present. These data imply that the inducer did increase gene expression even if overall cell density decreased. The construct fluoresced very little in comparison with the positive control (pLac+RBS+RFP) no matter what the conditions. The data support the hypothesis that there is a transcriptional terminator in the TetA gene.</p><br />
<img src="https://static.igem.org/mediawiki/2010/3/32/Davidson-MissouriWTPS3.png" id="fig2" height=100 width = 200 onmouseover="makeBig('fig2')" onclick= "makeSmall('fig2')"><br />
<br><br />
<p>&nbsp;&nbsp;&nbsp;We performed another battery of tests to compare the pLac+TetA+RFP construct to a construct with the pLac+RFP+TetA orientation. When compared to cells with RFP followed by TetA, the construct’s negligible fluorescence was even more apparent. Interestingly, the cells with the flipped orientation grew poorly in the presence of tetracycline but had a high fluorescence per cell. One possible explanation for this phenomenon is that the fluorescence is divided by such a low number of cells that small variations are magnified. Alternatively, the presence of tetracycline could be selecting for cells with high expression levels of both gene products. These few cells are producing high levels of TetA effluent pumps in order to survive. Correspondingly, they are producing a lot of RFP.<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2010/6/61/Davidson-MissouriW_RFP_in_JM_109_vs._MG_1655_%282%29.png" id=fig3 height=100 width = 200 onmouseover="makeBig('fig3')" onclick= "makeSmall('fig3')"><br />
<br><br />
<p></p><br />
<img src="https://static.igem.org/mediawiki/2010/7/71/Davidson-MissouriW_IPTG_Induction_in_JM_109_vs._MG_1655_%282%29.png" id=fig4 height=100 width = 200 onmouseover="makeBig('fig4')" onclick= "makeSmall('fig4')"><br />
<br><br />
<p></p><br />
<img src="https://static.igem.org/mediawiki/2010/c/ca/Davidson-MissouriW_Unexplained_Variation_in_Copy_Number_of_RFP_Plasmids_%282%29.png" id=fig5 height=100 width = 200 onmouseover="makeBig('fig5')" onclick= "makeSmall('fig5')"><br />
<br><br />
<p></p><br />
<img src="https://static.igem.org/mediawiki/2010/2/2b/Davidson-MissouriW_Use_of_LacI_Repressor_to_Achieve_a_Range_of_Induction_%282%29.png" id=fig6 height=100 width = 200 onmouseover="makeBig('fig6')" onclick= "makeSmall('fig6')"><br />
<br><br />
<p></p><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/3/3c/Davidson-MWSU_endonuclease_experiment.png" id="fig8" height=100 width = 200 onmouseover="makeBig('fig8')" onclick= "makeSmall('fig8')"><br />
<br><br />
<p>Over the summer, we synthesized a pLac-RBS-RFP gene and picked a pink colony and a red colony off our transformation plate. We sequenced the inserts and found that the DNA sequences were identical yet gave different phenotypes, one being a red colony and the other a pink. We were able to determine that red colonies had more red fluorescent protein being produced in comparison to the pink colonies, though we were puzzled at how this might be occurring consistently. We were able to determine that something inside the insert was allowing this to occur by doing experiments that involved switching of the inserts among the two vectors. This led us to believe that an epigenetic mechanism was involved in this process. The mechanism we proposed was DNA methylation. DNA methylation involves the addition of a methyl group to a nitrogenous base of the DNA. This modification of the DNA can be inherited through subsequent cell divisions and is known to regulate gene expression in a variety of organisms. Adenine or cytosine methylation (Dam or Dcm, respectively) is known to occur in many bacteria, including E. coli. Methylation could affect gene expression by making the DNA specific sequence harder to recognize by the polymerase; thus, decreasing gene expression. Methylation might also increase gene expression by having the opposite effect where the DNA binding site is more easily recognized by the polymerase, though this type is rare. We sought to determine if DNA methylation was actually playing a role in the gene expression of these E. coli cells. Our first experiment used three different restriction endonucleases that were sensitive to DNA methylation to see if any of the sites that are recognized by the enzyme are methylated. This experiment was not able to determine if any DNA in our gene was methylated. A future experiment that will help us in the determination of whether this gene is methylated is methylation-specific PCR (MSP).</p><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/8/8c/Davidson_MWSU_Pink_and_red_clones_vector_switch_for_iGEM.png" id=fig7 height=100 width = 200 onmouseover="makeBig('fig7')" onclick= "makeSmall('fig7')"> <br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/0/0f/Davidson-MWSU_vector_switch_on_white.png" id=fig13 height=100 width = 200 onmouseover="makeBig('fig13')" onclick= "makeSmall('fig13')"> <br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/0/08/Davidson-MWSU_vector_switch_on_uv.png" id=fig14 height=100 width = 200 onmouseover="makeBig('fig14')" onclick= "makeSmall('fig14')"> <br />
<br><br />
<p>In another effort to understand why the pLac-RBS-RFP construct was producing one set of red clones and one set of pink clones we designed an experiment to see whether the degree of red fluorescent protein was a function of the vector or the insert. In this experiment we performed a EcoRI/PstI digest on each clone and purified both the vector and insert for each. Then we put each of the inserts back into their original vectors as well as placing the inserts into the opposite vectors. The diagram illustrates the crosses. See pictures of the results of this experiment above. From these results we believe that the color follows the insert.</p><br />
<br><br />
<p></p><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/8/89/Davidson-MWSU_diagram_of_a_fried_egg.png" id="fig10" height=100 width = 200 onmouseover="makeBig('fig10')" onclick= "makeSmall('fig10')"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/2/29/Davidson-MWSU_fried_egg_passage_pic1.png" id="fig11" height=100 width = 200 onmouseover="makeBig('fig11')" onclick= "makeSmall('fig11')"><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/9/99/Davidson-MWSU_fried_egg_passage_pic2.png" id="fig12" height=100 width = 200 onmouseover="makeBig('fig12')" onclick= "makeSmall('fig12')"><br />
<br><br />
<p>As we were doing experiments with a pLac-RBS-RFP construct (part number I715039) we noticed some color variation between clones that were supposed to be identical. In an effort to trace the differences in fluorescence we spotted 2 ml of the two clones. These clones produced ring-like structures resembling a fried egg with a center, a middle, and an outer edge all of different colors. Sections from these colonies were picked, grown up overnight, and spotted again. Each of the new colonies showed similar results. We do not know the reason for the variation within clones, but are continuing to perform experiments to reach conclusions. View the pictures above in sequential order to see the color variations and how they traveled through generations.</p><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2010/f/f3/Davidson-MWSU_water_and_broth_for_iGEM.png" id="fig9" height=100 width = 200 onmouseover="makeBig('fig9')" onclick= "makeSmall('fig9')"><br />
<br><br />
<br />
<br />
<br />
<center><a href="#main_wrapper">Top<a/></center><br />
<br />
<br />
<script type="text/javascript"><br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
function makeBig(id){<br />
el=document.getElementById(id);<br />
el.height = 600;<br />
el.width = 800; <br />
}<br />
function makeSmall(id){<br />
el=document.getElementById(id);<br />
el.height = 100;<br />
el.width = 200;<br />
}<br />
<br />
function show(id1){<br />
el=document.getElementById(id1);<br />
if(el.style.display == 'none'){<br />
el.style.display = 'block';<br />
}<br />
else<br />
el.style.display='none';<br />
}<br />
<br />
<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriW/CreLoxTeam:Davidson-MissouriW/CreLox2010-10-26T04:29:08Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="crelox" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h1> Characterizing Cre/lox Recombination Method </h1><br />
<br />
<h2> Mechanism behind Cre/lox Recombination <h2><br />
<br />
<p> <br />
The Cre-lox tool is a site-specific recombination system that is widely used in biological research to manipulate DNA. It was discovered in the early 90's through characterization of coliphage P1 recombination system. The Cre recombinase enzyme, a 38kDa protein, catalyzes the recombination of DNA between two lox sites. These lox sites, each 34 bp long, consist of two inverted repeat arms flanking a spacer region of 8bp that is unique to the lox site.</p><br />
<br />
<table cellpadding=0 cellspacing=0><br />
<tbody bgcolor="#ede8e2"><br />
<tr><br />
<td><br />
<img height="210px" src="https://static.igem.org/mediawiki/2010/2/24/Davidson-missouriwCut.png"> <br />
<center>Excision</center><br />
</td><br />
<td><br />
<img height="210px" src="https://static.igem.org/mediawiki/2010/8/8b/Davidson-missouriw2Flip.png"><br />
<center>Inversion</center><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<h2>Designing Lox Sites</h2><br />
<p>In order to randomly "select objects" for the knapsack problem, we used the Cre-lox recombination method of excision and inversion. We needed a set of variant lox sites in order to create constructs that would yield different subsets of survival and fluorescence to optimally fill the knapsack. These variant lox sites have mutations specific to the 8bp spacer region and do not recombine. We created 10 new lox sites with mutations in the 8 bp region: loxN Forward and Reverse, loxm2 Forward and Reverse, lox2272 Forward and Reverse, lox5171 Forward and Reverse, and loxBri Forward and Reverse. In addition, we added the wildtype loxP Reverse to the registry. </p><br />
<br />
<center><table cellpadding=0 cellspacing=0><br />
<tbody bgcolor="#ede8e2"><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Davidson_MissouriW_Loxsite_7-25-10.png"><br />
</td><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2010/8/85/Davidson_MissouriW_Lox_site_key.png"><br />
</td><br />
</tr><br />
</tbody><br />
</table></center><br />
<br />
<p>We floxed red fluorescent protein with these variant lox sites using 16 out of the 21 combinations of the 5 lox forward variants to see immediately if recombination occurred in the presence of Cre. These constructs below follow a moderate promoter, pTet. The key for the constructs is above and colors refer to specific lox sites.</p><br />
<center><img src="https://static.igem.org/mediawiki/2010/c/c3/Davidson-missouriwFish.png"></center><br />
<center><h3>Would you like a bagel with all that lox?</h3></center><br />
<br />
<h1>Knapsack Construct Models</h1><br />
We designed five different construct models that could potentially lead us to a biological solution to the knapsack problem. These constructs include various lox sites, a reporter fluorescent protein, and a TetA gene that has an upper and lower threshold of expression in order to survive, thus providing a means to find "objects" (subset of modules) with the correct "weight" (expression of TetA).<br><br><br />
To determine which model would be best to solve the knapsack problems, we analyzed each version and its theoretical probabilities for different results that could be left after any number cre interactions. Furthermore, we created the construct simulator that can calculate for us the theoretical probabilities of the possible results after any number of cre steps for our construct and any custom construct. From this tool and an analysis of the possible results provided by the tool, we have decided that version D is the model to solve the knapsack problem.</p><br />
<br />
<center><h3>Version A: Allows inversion and excision within and over multiple modules.</h3></center><br />
<center><img width="700px" src="https://static.igem.org/mediawiki/2010/6/63/Davidson-missouriwA-1.png"></center><br />
<center><h3>Version B: Allows only excision within and over multiple modules.</h3></center><br />
<center><img width="700px"src="https://static.igem.org/mediawiki/2010/7/7c/Davidson-missouriwB-1.png"></center><br />
<center><h3>Version C: Only allows flipping within modules. Requires only 3 different Lox sites.</h3></center><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d7/Davidson-missouriwC.png"><br />
<center><h3>Version D: Only allows inversion within modules. Requires "n" different Lox sites.</h3></center><br />
<center><img width="700px"src="https://static.igem.org/mediawiki/2010/d/d9/Davidson-missouriwD.png"></center><br />
<center><h3>Version E: Initially only allows flipping over multiple modules, then allows cutting and flipping over multiple modules.</h3></center><br />
<img src="https://static.igem.org/mediawiki/igem.org/b/b7/Davidson-missouriwE.png"><br />
<br />
<h1>Troubleshooting with Cre</h1><br />
Clearly, characterizing the activity of Cre recombinase is integral to our project. Initially, we chose to use pBad-RBS-Cre because of its moderate promoter to test the floxed RBS-RFP constructs and analyze their level of recombination. While transforming pBad-RBS-Cre (<a href="http://partsregistry.org/Part:BBa_I718008">I718008</a>) from the 2010 iGEM kit plate, we observed unexpected results when size verifying the band. We digested the part with PvuI (an internal restriction site in the Cre gene sequence) and PstI and expected to see a 600 bp band along with two additional bands. Instead, we saw bands of unexplained size from digestion of the experimental colonies. In addition, the negative control (which contained only pBad-RBS-Cre) yielded only one band at around 1600bp when there should have been at least two bands (because of the internal PvuI site in Cre) and the band was at a size that pertained to none of the parts that were supposed to be involved in the ligation (see below, left). Furthermore, we religated pBAd-RBS-Cre from our own Davidson GCAT-alog from earlier years and digested with the same restriction enzymes. The presence of the 600 bp band confirmed the success of the ligation and this was used in furthur ligations (see below, right). We noted the incorrect part on the pBad-RBS-Cre wiki under experience. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/a/ad/Davidson_MissouriWestern_Slide2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/0/08/Slide1.jpg"><br />
</div><br />
<br />
</div> <!-- end SubWrapper --><br />
<br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
<br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
<!--<br />
<center><table><br />
<tbody><br />
<td><br />
<img src="https://2010.igem.org/Image:Slide1.jpg"><br />
</td><br />
<td><br />
</td><br />
</tr><br />
</tbody><br />
</table></center><br />
--><br />
<center><a href="#main_wrapper">top</a></center> <br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriW/CreLoxTeam:Davidson-MissouriW/CreLox2010-10-26T04:27:54Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="crelox" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h1> Characterizing Cre/lox Recombination Method </h1><br />
<br />
<h2> Mechanism behind Cre/lox Recombination <h2><br />
<br />
<p> <br />
The Cre-lox tool is a site-specific recombination system that is widely used in biological research to manipulate DNA. It was discovered in the early 90's through characterization of coliphage P1 recombination system. The Cre recombinase enzyme, a 38kDa protein, catalyzes the recombination of DNA between two lox sites. These lox sites, each 34 bp long, consist of two inverted repeat arms flanking a spacer region of 8bp that is unique to the lox site.</p><br />
<br />
<table cellpadding=0 cellspacing=0><br />
<tbody bgcolor="#ede8e2"><br />
<tr><br />
<td><br />
<img height="210px" src="https://static.igem.org/mediawiki/2010/2/24/Davidson-missouriwCut.png"> <br />
<center>Excision</center><br />
</td><br />
<td><br />
<img height="210px" src="https://static.igem.org/mediawiki/2010/8/8b/Davidson-missouriw2Flip.png"><br />
<center>Inversion</center><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<h2>Designing Lox Sites</h2><br />
<p>In order to randomly "select objects" for the knapsack problem, we used the Cre-lox recombination method of excision and inversion. We needed a set of variant lox sites in order to create constructs that would yield different subsets of survival and fluorescence to optimally fill the knapsack. These variant lox sites have mutations specific to the 8bp spacer region and do not recombine. We created 10 new lox sites with mutations in the 8 bp region: loxN Forward and Reverse, loxm2 Forward and Reverse, lox2272 Forward and Reverse, lox5171 Forward and Reverse, and loxBri Forward and Reverse. In addition, we added the wildtype loxP Reverse to the registry. </p><br />
<br />
<center><table cellpadding=0 cellspacing=0><br />
<tbody bgcolor="#ede8e2"><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Davidson_MissouriW_Loxsite_7-25-10.png"><br />
</td><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2010/8/85/Davidson_MissouriW_Lox_site_key.png"><br />
</td><br />
</tr><br />
</tbody><br />
</table></center><br />
<br />
<p>We floxed red fluorescent protein with these variant lox sites using 16 out of the 21 combinations of the 5 lox forward variants to see immediately if recombination occurred in the presence of Cre. These constructs below follow a moderate promoter, pTet. The key for the constructs is above and colors refer to specific lox sites.</p><br />
<center><img src="https://static.igem.org/mediawiki/2010/c/c3/Davidson-missouriwFish.png"></center><br />
<center><h3>Would you like a bagel with all that lox?</h3></center><br />
<br />
<h1>Knapsack Construct Models</h1><br />
We designed five different construct models that could potentially lead us to a biological solution to the knapsack problem. These constructs include various lox sites, a reporter fluorescent protein, and a TetA gene that has an upper and lower threshold of expression in order to survive, thus providing a means to find "objects" (subset of modules) with the correct "weight" (expression of TetA).<br><br><br />
To determine which model would be best to solve the knapsack problems, we analyzed each version and its theoretical probabilities for different results that could be left after any number cre interactions. Furthermore, we created the construct simulator that can calculate for us the theoretical probabilities of the possible results after any number of cre steps for our construct and any custom construct. From this tool and an analysis of the possible results provided by the tool, we have decided that version D is the model to solve the knapsack problem.</p><br />
<br />
<center><h3>Version A: Allows inversion and excision within and over multiple modules.</h3></center><br />
<center><img width="700px" src="https://static.igem.org/mediawiki/2010/6/63/Davidson-missouriwA-1.png"></center><br />
<center><h3>Version B: Allows only excision within and over multiple modules.</h3></center><br />
<center><img width="700px"src="https://static.igem.org/mediawiki/2010/7/7c/Davidson-missouriwB-1.png"></center><br />
<center><h3>Version C: Only allows flipping within modules. Requires only 3 different Lox sites.</h3></center><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d7/Davidson-missouriwC.png"><br />
<center><h3>Version D: Only allows inversion within modules. Requires "n" different Lox sites.</h3></center><br />
<center><img width="700px"src="https://static.igem.org/mediawiki/2010/d/d9/Davidson-missouriwD.png"></center><br />
<center><h3>Version E: Initially only allows flipping over multiple modules, then allows cutting and flipping over multiple modules.</h3></center><br />
<img src="https://static.igem.org/mediawiki/igem.org/b/b7/Davidson-missouriwE.png"><br />
<br />
<h1>Troubleshooting with Cre</h1><br />
Clearly, characterizing the activity of Cre recombinase is integral to our project. Initially, we chose to use pBad-RBS-Cre because of its moderate promoter to test the floxed RBS-RFP constructs and analyze their level of recombination. While transforming pBad-RBS-Cre (<a href="http://partsregistry.org/Part:BBa_I718008">I718008</a>) from the 2010 iGEM kit plate, we observed unexpected results when size verifying the band. We digested the part with PvuI (an internal restriction site in the Cre gene sequence) and PstI and expected to see a 600 bp band along with two additional bands. Instead, we saw bands of unexplained size from digestion of the experimental colonies. In addition, the negative control (which contained only pBad-RBS-Cre) yielded only one band at around 1600bp when there should have been at least two bands (because of the internal PvuI site in Cre) and the band was at a size that pertained to none of the parts that were supposed to be involved in the ligation (see below, left). Furthermore, we religated pBAd-RBS-Cre from our own Davidson GCAT-alog from earlier years and digested with the same restriction enzymes. The presence of the 600 bp band confirmed the success of the ligation and this was used in furthur ligations (see below, right). We noted the incorrect part on the pBad-RBS-Cre wiki under experience. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/a/ad/Davidson_MissouriWestern_Slide2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/0/08/Slide1.jpg"><br />
</div><br />
<br />
</div> <!-- end SubWrapper --><br />
<br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
<br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
<br />
<center><table><br />
<tbody><br />
<td><br />
<!--<br />
<img src="https://2010.igem.org/Image:Slide1.jpg"><br />
--><br />
</td><br />
<td><br />
</td><br />
</tr><br />
</tbody><br />
</table></center><br />
<center><a href="#main_wrapper">top</a></center> <br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriW/CreLoxTeam:Davidson-MissouriW/CreLox2010-10-26T03:48:13Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
<html><br />
<body id="crelox" onload="setPageSize()"><br />
<div id="super_main_wrapper"><br />
<div class="clear"></div><br />
<div id="SubWrapper"> <br />
<div id="mission_box"> <h1> Characterizing Cre/lox Recombination Method </h1><br />
<br />
<h2> Mechanism behind Cre/lox Recombination <h2><br />
<br />
<p> <br />
The Cre-lox tool is a site-specific recombination system that is widely used in biological research to manipulate DNA. It was discovered in the early 90's through characterization of coliphage P1 recombination system. The Cre recombinase enzyme, a 38kDa protein, catalyzes the recombination of DNA between two lox sites. These lox sites, each 34 bp long, consist of two inverted repeat arms flanking a spacer region of 8bp that is unique to the lox site.</p><br />
<br />
<table cellpadding=0 cellspacing=0><br />
<tbody bgcolor="#ede8e2"><br />
<tr><br />
<td><br />
<img height="210px" src="https://static.igem.org/mediawiki/2010/2/24/Davidson-missouriwCut.png"> <br />
<center>Excision</center><br />
</td><br />
<td><br />
<img height="210px" src="https://static.igem.org/mediawiki/2010/8/8b/Davidson-missouriw2Flip.png"><br />
<center>Inversion</center><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<h2>Designing Lox Sites</h2><br />
<p>In order to randomly "select objects" for the knapsack problem, we used the Cre-lox recombination method of excision and inversion. We needed a set of variant lox sites in order to create constructs that would yield different subsets of survival and fluorescence to optimally fill the knapsack. These variant lox sites have mutations specific to the 8bp spacer region and do not recombine. We created 10 new lox sites with mutations in the 8 bp region: loxN Forward and Reverse, loxm2 Forward and Reverse, lox2272 Forward and Reverse, lox5171 Forward and Reverse, and loxBri Forward and Reverse. In addition, we added the wildtype loxP Reverse to the registry. </p><br />
<br />
<center><table cellpadding=0 cellspacing=0><br />
<tbody bgcolor="#ede8e2"><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Davidson_MissouriW_Loxsite_7-25-10.png"><br />
</td><br />
<td><br />
<img src="https://static.igem.org/mediawiki/2010/8/85/Davidson_MissouriW_Lox_site_key.png"><br />
</td><br />
</tr><br />
</tbody><br />
</table></center><br />
<br />
<p>We floxed red fluorescent protein with these variant lox sites using 16 out of the 21 combinations of the 5 lox forward variants to see immediately if recombination occurred in the presence of Cre. These constructs below follow a moderate promoter, pTet. The key for the constructs is above and colors refer to specific lox sites.</p><br />
<center><img src="https://static.igem.org/mediawiki/2010/c/c3/Davidson-missouriwFish.png"></center><br />
<center><h3>Would you like a bagel with all that lox?</h3></center><br />
<br />
<h1>Knapsack Construct Models</h1><br />
We designed five different construct models that could potentially lead us to a biological solution to the knapsack problem. These constructs include various lox sites, a reporter fluorescent protein, and a TetA gene that has an upper and lower threshold of expression in order to survive, thus providing a means to find "objects" (subset of modules) with the correct "weight" (expression of TetA).<br><br><br />
To determine which model would be best to solve the knapsack problems, we analyzed each version and its theoretical probabilities for different results that could be left after any number cre interactions. Furthermore, we created the construct simulator that can calculate for us the theoretical probabilities of the possible results after any number of cre steps for our construct and any custom construct. From this tool and an analysis of the possible results provided by the tool, we have decided that version D is the model to solve the knapsack problem.</p><br />
<br />
<center><h3>Version A: Allows inversion and excision within and over multiple modules.</h3></center><br />
<center><img width="700px" src="https://static.igem.org/mediawiki/2010/6/63/Davidson-missouriwA-1.png"></center><br />
<center><h3>Version B: Allows only excision within and over multiple modules.</h3></center><br />
<center><img width="700px"src="https://static.igem.org/mediawiki/2010/7/7c/Davidson-missouriwB-1.png"></center><br />
<center><h3>Version C: Only allows flipping within modules. Requires only 3 different Lox sites.</h3></center><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d7/Davidson-missouriwC.png"><br />
<center><h3>Version D: Only allows inversion within modules. Requires "n" different Lox sites.</h3></center><br />
<center><img width="700px"src="https://static.igem.org/mediawiki/2010/d/d9/Davidson-missouriwD.png"></center><br />
<center><h3>Version E: Initially only allows flipping over multiple modules, then allows cutting and flipping over multiple modules.</h3></center><br />
<img src="https://static.igem.org/mediawiki/igem.org/b/b7/Davidson-missouriwE.png"><br />
<br />
<h1>Troubleshooting with Cre</h1><br />
Clearly, characterizing the activity of Cre recombinase is integral to our project. Initially, we chose to use pBad-RBS-Cre because of its moderate promoter to test the floxed RBS-RFP constructs and analyze their level of recombination. While transforming pBad-RBS-Cre (<a href="http://partsregistry.org/Part:BBa_I718008">I718008</a>) from the 2010 iGEM kit plate, we observed unexpected results when size verifying the band. We digested the part with PvuI (an internal restriction site in the Cre gene sequence) and PstI and expected to see a 600 bp band along with two additional bands. Instead, we saw bands of unexplained size from digestion of the experimental colonies. In addition, the negative control (which contained only pBad-RBS-Cre) yielded only one band at around 1600bp when there should have been at least two bands (because of the internal PvuI site in Cre) and the band was at a size that pertained to none of the parts that were supposed to be involved in the ligation (see below, left). Furthermore, we religated pBAd-RBS-Cre from our own Davidson GCAT-alog from earlier years and digested with the same restriction enzymes. The presence of the 600 bp band confirmed the success of the ligation and this was used in furthur ligations (see below, right). We noted the incorrect part on the pBad-RBS-Cre wiki under experience. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/a/ad/Davidson_MissouriWestern_Slide2.jpg"><br />
<img src="https://static.igem.org/mediawiki/2010/0/08/Slide1.jpg"><br />
</div><br />
<br />
</div> <!-- end SubWrapper --><br />
<br />
</div> <!-- end Super_main_wrapper --><br />
<br />
<script type="text/javascript"><br />
<br />
<br />
<br />
function setPageSize() {<br />
len = document.getElementById('super_main_wrapper').offsetHeight;<br />
document.getElementById('bodyContent').style.height = len + 'px';<br />
document.getElementById('SupWrapper').style.height = len + 'px';<br />
document.getElementById('news').style.height = len + 'px';<br />
}<br />
<br />
</script><br />
<br />
<center><table><br />
<tbody><br />
<td><br />
<img src="https://2010.igem.org/Image:Slide1.jpg"><br />
</td><br />
<td><br />
</td><br />
</tr><br />
</tbody><br />
</table></center><br />
<center><a href="#main_wrapper">top</a></center> <br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodonsTeam:Davidson-MissouriW/OptimizingCodons2010-10-26T03:45:52Z<p>Sholle: </p>
<hr />
<div>{{Template_Wiki}}<br />
==Optimizing Codons==<br />
<br />
<br />
<br />
===Overview===<br />
<br />
<br />
::Using a variety of programs available online, including the [http://gcat.davidson.edu/igem10/index.html Oligator] and [http://gcat.davidson.edu/igem10/opt/opt_index.html Optimoose], we were able to formulate a plan that would enable us to synthesize various optimized and deoptimized versions of the TetA gene. We relied on codon bias, the differences in frequency of occurrence of synonymous codons in coding DNA, to allow for varying expression levels of TetA in the cell. By using natural enzyme sites within TetA, we were able to conduct restriction digests on TetA that allowed us to alter roughly 150 base pairs within each segment using codon bias with a total of four segments available. The TetA vector that was used to synthesize segment 1 clones was digested with EcoRI and NheI. The TetA vector that was used to synthesize segment 2 clones was digested with NheI and BamHI. This gave us the ability to insert roughly 144 bp for each segment that were optimized or deoptimized using codon bias. These inserts were fairly large and thus were synthesized by annealing oligos. These annealed oligos were then treated with a polynucleotide kinase to add a phosphate backbone to the oligo DNA. Initial results yielded a lot of background given that it was difficult to distinguish between singly and doubly cut vectors. Therefore, to reduce background noise, we added an extra step in our preparation of the vector using Antarctic Phosphatase. By using this phosphatase on the vector, we were able to remove the 5’ phosphate groups off the backbone of the DNA while still leaving the 3’ end phosphates. This made it difficult for the singly cut vector to go back on itself because ligase requires a phosphate group to be present to seal the nick in the phosphate backbone. With this reduced background, we were able to ligate the annealed oligos to our vectors and screen the candidate clones using RFLP.<br />
<br />
<br />
<hr><br />
<br />
===Background===<br />
<br />
[[Image:Davidson-MissouriWtetsystem.jpg | center]]<br />
::::Resource: http://en.wikipedia.org/wiki/File:TetSystem.png<br />
<br />
<br />
::Through the understanding of the bacterial tetracycline resistance mechanism, we hypothesized that the optimization of the TetA gene was directly related to the translational efficiency of TetA and therefore a more optimized gene would offer a higher level of tetracycline resistance.<br />
<br />
<br />
::The diagrams below demonstrate our hypothesis:<br />
<br />
[[Image:Davidson-MissouriWwtteta.jpg | center]]<br />
[[Image:Davidson-MissouriWoptteta.jpg | center]]<br />
[[Image:Davidson-MissouriWdeoptteta.jpg | center]]<br />
<br />
<hr><br />
<br />
===Building Optimized and Deoptimized TetA===<br />
::To build the optimized and deoptimized segments of the Tet A gene we used the sequence that the [http://gcat.davidson.edu/igem10/opt/opt_index.html Optimoose] program gave us and put it into the [http://gcat.davidson.edu/igem10/index.html Oligator], a program created by the Davidson-Missouri Western iGEM team. After getting the recommended Oligo sequences, we added necessary "sticky ends" that were compatible with the naturally occurring restriction enzyme sites that we discovered (see Restriction Enzymes below). The Oligos that were ordered can be seen below. <br />
<br />
<br />
::This diagram demonstrates how the TetA gene was broken into different segments (1 and 2) and created on a pSB1A2 vector. <br />
<br />
[[Image:Davidson-MissouriWtetAsequencetable.jpg | center]]<br />
<br />
::Note: All above segments have been optimized and deoptimized using the [http://gcat.davidson.edu/igem10/opt/opt_index.html Optimoose] online program. <br />
<br />
<br />
<br />
<br />
::'''Segment 1 Oligos'''<br />
<br />
<br />
::'''Optimized''' <br />
<br />
::top 1 5' AATTCGCGGCCGCTTCTAGATGAAATCTAACAACGCGCTGATCGTTATCCTGGGTACCG 3’<br />
<br />
::top 2 5' TTACCCTGGACGCGGTTGGTATCGGTCTGGTTATGCCGGTTCTGCCGGGTCTGCTGCGTGAC 3’<br />
<br />
::top 3 5' ATCGTTCACTCTGACTCTATCGCGTCTCACTACGGTGTTCTG 3’<br />
<br />
::bottom 2 5' CATAACCAGACCGATACCAACCGCGTCCAGGGTAACGGTAC<br />
::CCAGGATAACGATCAGCGCGTTGTTAGATTTCATCTAGAAGCGGCCGCG 3’<br />
<br />
::bottom 1 5' CTAGCAGAACACCGTAGTGAGACGCGATAGAGTCAGAGTGAACGATGTCACGCAGCAGACCCGGCAGAACCGG 3’<br />
<br />
::'''Deoptimized'''<br />
<br />
::top 1 5' AATTCGCGGCCGCTTCTAGATGAAGAGTAATAATGCCCTAATAGTCATACTAGGAACAG 3’<br />
<br />
::top 2 5' TCACACTAGATGCCGTCGGAATAGGACTCGTCATGCCCGTCCTACCCGGACTACTAAGGGA 3’<br />
<br />
::top 3 5' TATAGTCCATAGTGATAGTATAGCCAGTCATTATGGAGTCCTG 3’<br />
<br />
::bottom 2 5' GAGTCCTATTCCGACGGCATCTAGTGTGACTGTTCCTAGTATG<br />
::ACTATTAGGGCATTATTACTCTTCATCTAGAAGCGGCCGCG 3’<br />
<br />
::bottom 1 5' CTAGCAGGACTCCATAATGACTGGCTATACTATCACTATGGACTATATCCCTTAGTAGTCCGGGTAGGACGGGCATGAC 3’<br />
<br />
<br />
<br />
::'''Segment 2 Oligos'''<br />
<br />
<br />
::'''Optimized'''<br />
<br />
::top 1 5' CTAGCCTGTACGCGCTGATGCAGTTCCTGTGCGCGCCGGTTCTGGGTGCGCTGTCTGAC 3’<br />
<br />
::top 2 5' CGTTTCGGTCGTCGTCCGGTTCTGCTGGCGTCTCTGCTGGGTGCGACCATCGACTAC 3’<br />
<br />
::top 3 5' GCGATCATGGCGACCACCCCGGTTCTGTG 3’<br />
<br />
::bottom 1 5' GCGCACAGGAACTGCATCAGCGCGTACAGG 3’<br />
<br />
::bottom 2 5' CCAGCAGAACCGGACGACGACCGAAACGGTCAGACAGCGCACCCAGAACCGGC 3’<br />
<br />
::bottom 3 5' GATCCACAGAACCGGGGTGGTCGCCATGATCGCGTAGTCGATGGTCGCACCCAGCAGAGACG 3’<br />
<br />
::'''Deoptimized'''<br />
<br />
::top 1 5' CTAGCGCTATATGCCCTAATGCAATTTCTATGTGCCCCCGTCCTAGGAGCCCTAAGTG 3'<br />
<br />
::top 2 5' ATAGGTTTGGAAGGAGGCCCGTCCTACTAGCCAGTCTACTAGGAGCCACAATAGAT 3'<br />
<br />
::top 3 5' TATGCCATAATGGCCACAACACCCGTCCTATG 3'<br />
<br />
::bottom 1 5' GGCACATAGAAATTGCATTAGGGCATATAGCG 3' <br />
<br />
::bottom 2 5' TAGGACGGGCCTCCTTCCAAACCTATCACTTAGGGCTCCTAGGACGGG 3' <br />
<br />
::bottom 3 5' GATCCATAGGACGGGTGTTGTGGCCATTATGGCATAATCTATTGTGGCTCCTAGTAGACTGGCTAG 3'<br />
<br />
<br />
<br />
<br />
::'''Restriction Enzymes'''<br />
<br />
::To insert the annealed Oligo segments that were created we had to digest the Tet A gene using naturally occurring enzyme restriction sites that did not exist in the rest of the gene or in the plasmid (pSBIA2). <br />
<br />
::To build the fully optimized (segments 1 and 2 optimized) and fully deopitmized (segments 1 and 2 are deoptimized) versions of the TetA gene, we also used these same restriction enzymes. For the fully optimized version, we cut the optimized segment 1 TetA gene and cut it with NheI and then ligated in the optimized segment 2 insert (this insert was cut with NheI and BamHI to allow for us to isolate just the optimized segment 2 fragment, without the rest of the TetA gene). The fully deoptimized version of the TetA gene was constructed using the same procedure with the deoptimzed segment 1 TetA gene and a deoptimized segment 2 insert. <br />
<br />
<br />
::{| class="wikitable" style="text-align:center" border="1" cellpadding="2"<br />
!Segment <br />
|'''First Restriction Enzyme'''<br />
|'''Second Restriction Enzyme'''<br />
|-<br />
<br />
| 1 || EcoRI || NheI<br />
|-<br />
<br />
<br />
| 2 || NheI || BamHI<br />
|-<br />
<br />
<br />
|}<br />
<html><center><a href="#main_wrapper">Top</a></center></html><br />
<br />
<hr><br />
<br />
===RFLP (Restriction Fragment Length Polymorphism)===<br />
<br />
We used restriction fragment length polymorphism (RFLP) as a way to screen our candidate clones for our optimized and deoptimized versions of the TetA gene. RFLP is a laboratory technique whereby DNA is digested by restriction enzymes and the resulting DNA fragments are separated by gel electrophoresis. RFLP relies on a difference between two or more samples of homologous DNA molecules arising from differing locations of restriction sites. Using the program NEBcutter V2 from New England Biolabs, we were able to determine which restriction enzymes to use to screen for our various TetA candidate clones. Based on availability of restriction enzymes and the greatest variability of bands created, we choose four different restriction enzymes for the custom digestion of our candidate clones:<br />
<blockquote>Optimized segment 1→ HinFI </blockquote><br />
<blockquote>Deoptimized segment 2→ DdeI </blockquote><br />
<blockquote>Optimized segment 2→ BsaWI </blockquote><br />
<blockquote>Deoptimized segment 2→ AccI </blockquote><br />
Using RFLP, we screened our clones and sent strong candidate clones, the ones that had diagnostic bands indicative of the desired clone, off for sequencing. After analyzing the sequencing data, we were able to conclude that RFLP is an excellent method for screening for clones, given that almost all of the clones sent off were correct.<br />
[[Image:Davidson-MissouriWRFLP.jpg | center]]<br />
<br />
<html><center><a href="#main_wrapper">Top</a></center></html><br />
<br />
<hr><br />
<br />
===TetA Toxicity===<br />
<br />
::This graph illustrates that a concentration of 2mM IPTG is lethal to the cell. pSB3T5 was a control in this experiment, for it has natural Tetracycline resistance. It can be seen that the deoptimized TetA gene did not provide as much Tet resistance as did the optimized and wild type TetA gene when behind a pLac promoter. <br />
<br />
[[Image:Davidson-MissouriWIPTGexpt1.jpg | center]]<br />
<gallery widths=60px heights=60px perrow=10 caption="TetA Toxicity Experiments"><br />
Image:Davidson-MissouriWIPTGexpt1.jpg<br />
</gallery><br />
<html><center><a href="#main_wrapper">Top</a></center></html><br />
<br />
<hr><br />
<br />
===Tetracycline Experiments===<br />
<br />
::The graph below illustrates that any amount of Tetracycline is toxic to the cell. With increasing concentrations of Tet, cell viability decreases. <br />
[[Image:Davidson-MWTetexpt1.png | center]]<br />
<br />
<hr><br />
<br />
<html><center><a href="#main_wrapper">Top</a></center></html><br />
<br />
::The graph below illustrates that any amount of Tetracycline is toxic to the cell. With increasing concentrations of Tet, cell viability decreases. pSB1A2 was a control in this experiment which has no tetracycline resistant. <br />
[[Image:Davidson-MWTetexpt2.png | center]]<br />
<gallery widths=60px heights=60px perrow=9 caption="Tetracycline Titration Experiments"><br />
Image:Davidson-MWTetexpt1.png<br />
Image:Davidson-MWTetexpt2.png<br />
</gallery<br />
<br />
<hr><br />
<center><a href="#main_wrapper">top</a></center></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T03:37:56Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/Pictures">Pictures</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T03:34:25Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/TeamBio">Pictures</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T03:33:59Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Student Bio's</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/TeamBio">Pictures</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T03:32:14Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/TeamBio">Student Bio's</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T03:31:17Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Student Bio's</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T03:30:06Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team/TeamBio">Student Bio's</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T03:27:26Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Student Bio's</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Template:Template_WikiTemplate:Template Wiki2010-10-26T03:24:57Z<p>Sholle: </p>
<hr />
<div><html><br />
<head><br />
<style type="text/css"><br />
body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}<br />
<br />
.clear {clear:both;}<br />
body.mediawiki {<br />
background-color:#494d51;<br />
background-position: center center;<br />
background-attachment: fixed;<br />
background-repeat: no-repeat;<br />
font-family: Calibri, Verdana, helvetica, sans-serif;<br />
}<br />
h2 {padding: 10px 20px;<br />
font-size: 18px;<br />
color: #000;<br />
text-decoration: none;<br />
font-weight: bold;}<br />
border: none;<br />
h2 a {color: #000000;}<br />
h3 {padding: 10px 20px;<br />
font-size: 16px;<br />
color: #000;<br />
font-decoration: none;<br />
font-weight: bold;}<br />
h1.firstHeading {<br />
display: none;<br />
}<br />
p {<br />
text-align: justify;<br />
}<br />
a:link {<br />
color: #C80000;<br />
text-decoration: none<br />
} <br />
a:visited {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
a:hover {<br />
color: #C80000;<br />
text-decoration: none<br />
}<br />
a:active {<br />
color:#C80000;<br />
text-decoration: none<br />
}<br />
#bodyContent { width: 970px; margin: 225px 0px 0px; background-color:#ede8e2;}<br />
#content {padding-left: 0px; width: 970px;}<br />
table#team_members { text-align: justify; border: 0; }<br />
table#team_members h2, table#team_members h3 { clear: both; }<br />
#content * a:hover {text-decoration:none;}<br />
#main_wrapper {<br />
position:absolute; left:0px; top:0px;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: center;<br />
border-style: solid;<br />
border-color: white;<br />
}<br />
#header {<br />
position:absolute; left:0px; top:0px;<br />
style:fixed;<br />
margin: 0;<br />
width: 969px;<br />
height: 221px;<br />
align: left;<br />
background-color: #000000;<br />
background-image: url(https://static.igem.org/mediawiki/2010/5/54/Indexdavmwsu.png);<br />
}<br />
#navigation {<br />
position:absolute; left:0px; top:150px; width:793px; height:69px;<br />
z-index:100; background-color: transparent; float: left; <br />
color: #0000FF;<br />
}<br />
#super_main_wrapper {<br />
position:absolute; left:0px; top:227px;<br />
width: 975px;<br />
align: center;<br />
background-color: #ede8e2;<br />
heigth: auto;<br />
}<br />
#orangeBox, #greenBox, #blueBox {background-repeat: no-repeat; <br />
height:200px; <br />
width: 323px; <br />
float:left;}<br />
#orangeBox p, #greenBox p, #blueBox p{padding: 0 20px;<br />
font-size: 12px;<br />
color: #FFF;}<br />
#orangeBox h3, #greenBox h3, #blueBox h3{padding: 20px 25px 0 20px;<br />
font-weight: bold;<br />
font-size: 18px;<br />
color: #FFF;}<br />
#orangeBox a, #greenBox a, #blueBox a {<br />
padding-right: 20px;<br />
font-weight: bold;<br />
font-size: 14px;<br />
display: block;<br />
text-align: right;<br />
color: #FFF;} <br />
#orangeBox {margin-left: 3px;<br />
background-image: url(https://static.igem.org/mediawiki/2010/d/d7/Davidson-MissouriWRedBox.PNG);}<br />
#greenBox {background-image: url(https://static.igem.org/mediawiki/2010/e/e7/Davidson-MissouriWGoldBox.PNG);}<br />
#blueBox {background-image: url(https://static.igem.org/mediawiki/2010/a/ab/Davidson-MissouriWGreyBox.PNG);}<br />
<br />
#SubWrapper {width: 645px;<br />
padding: 0px;<br />
border-left:4px solid #ede8e2;<br />
float: left;<br />
margin-top: 3px;<br />
background-color: #ede8e2;}<br />
#SubWrapper * p, #SubWrapper p {padding: 0 20px;<br />
text-align: justify;<br />
font-size: 12px;}<br />
#SubWrapper * h3, #SubWrapper h3 {padding-top: 10px;<br />
font-size: 18px;}<br />
# {width: 322px;<br />
margin-top: 3px;<br />
float: left;<br />
background-color: #d8d5d0;<br />
border-right:4px solid #ede8e2;}<br />
<br />
#mission_box {width:650px;<br />
float: left;}<br />
#team_box, #zoo_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {width:215px;<br />
float: left;<br />
padding: 10px 0 0 0;}<br />
div.tleft {border-width: 0px; margin:0; padding:0;border-color:transparent;}<br />
<br />
<br />
<!-- ################# Navi styles ######################### --><br />
#menu * {<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
#menu {<br />
behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc); <!-- fuer ie6 --><br />
font-family: calibri, verdana, sans-serif;<br />
font-size: 14px;<br />
background-color: transparent;<br />
float:left;<br />
padding: 10px 0 0 0;<br />
}<br />
<br />
#menu ul {<br />
float: left;<br />
list-style: none;<br />
}<br />
<br />
#menu ul li {<br />
background-color:transparent;<br />
position:relative;<br />
float:left;<br />
list-style: none;<br />
padding: 10px 15px 0 0;<br />
font-weight: bold;<br />
width: auto;<br />
}<br />
<br />
#menu a {<br />
color: #FFF;<br />
display: inline;<br />
text-decoration: none;<br />
}<br />
<br />
#menu a:visited {<br />
color:#FFFFFF;<br />
text-decoration: none<br />
}<br />
<br />
#menu a:hover {<br />
color: #FFF414;<br />
}<br />
<br />
#menu ul li ul {<br />
display: none;<br />
position: absolute;<br />
left: -20px; <br />
width: 155px;<br />
heigth: 1%;<br />
font-size: 12px;<br />
opacity: 0.8;<br />
list-style: none;<br />
top: 19px;<br />
padding-top: 9px;<br />
z-index:500;<br />
}<br />
<br />
#menu ul li:hover ul {<br />
display: inline;<br />
background-position: bottom;<br />
}<br />
<br />
#menu ul li ul li {<br />
width: 100%;<br />
list-style: none;<br />
background-color: #000;<br />
margin: -1px;<br />
padding: 0 0 0 5px;<br />
display: inline;<br />
}<br />
<br />
body#home #mainHome a,<br />
body#team .aTeam,<br />
body#project .aProject,<br />
body#notebook .aNotebook,<br />
body#modeling .aModeling,<br />
body#sponsors .aSponsors,<br />
body#eucaryopedia .aEucaryopedia,<br />
body#parts .aParts<br />
{ color: #FFFFFF; <!--cursor: default;--> }<br />
<br />
<br />
</style><br />
</head><br />
<br />
<br />
<br />
<!-- ############################# BODY!!!!! #################################### --><br />
<br />
<body><br />
<!--[if IE]><br />
<style type="text/css"><br />
#SubWrapper {width: 645px;}<br />
#super_main_wrapper {position:static;}<br />
#navigation {left: 15px;}<br />
#menu ul li ul {left: -2px; top: 22px;}<br />
</style><br />
<![endif]--> <br />
<div id="main_wrapper"> <br />
<div id="header" position:absolute><br />
<div id="navigation"><br />
<div id="menu" style="position:static"><br />
<ul><br />
<li id="mainHome"><a class="aMain" href="https://2010.igem.org/Team:Davidson-MissouriW">Home</a></li><br />
<li id="mainTeam"><a class="aTeam" href="https://2010.igem.org/Team:Davidson-MissouriW/Team">Team</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Location</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/TeamBio">Overview</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Advisors">Advisors</a></li> <br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#Students">Students</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Team#TeamBio">Student Bio</a></li><br />
</ul><br />
</li><br />
<li id="mainProject"><a class="aProject" href="https://2010.igem.org/Team:Davidson-MissouriW/Project">Project</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Abstract">Abstract</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Introduction">Introduction</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/OptimizingCodons">Optimizing Codons</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/CreLox">Characterizing Cre/Lox</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/MeasuringExpression">Measuring Gene Expression</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#Summary and Outlook">Summary &amp; Outlook</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Project#References">References</a></li><br />
</ul><br />
</li><br />
<li id="mainParts"><a class="aParts" href="https://2010.igem.org/Team:Davidson-MissouriW/Parts">Parts</a><br />
</li><br />
<li id="mainModeling"><a class="aModeling" href="https://2010.igem.org/Team:Davidson-MissouriW/Tools">Tools</a><br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Veripart">Veripart</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Oligator">Oligator</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Optimoose">Optimus</a></li><br />
<li><a href="https://2010.igem.org/Team:Davidson-MissouriW/Tools#Simulator">SimuLox</a></li><br />
</ul><br />
</li><br />
<li id="mainHumanPractices"><a class="aHumanPractices" href="https://2010.igem.org/Team:Davidson-MissouriW/HumanPractices">Human Practices</a></li><br />
<li id="mainNotebook"><a class="aNotebook" href="https://2010.igem.org/Team:Davidson-MissouriW/Notebook">Notebook</a><br />
</li><br />
<li id="mainSafety"><a class="aSafety" href="https://2010.igem.org/Team:Davidson-MissouriW/Safety">Safety</a></li><br />
<li id="mainSponsors"><a class="aSponsors" href="https://2010.igem.org/Team:Davidson-MissouriW/Sponsors">Acknowledgements</a></li><br />
</ul><br />
<br />
</div><!-- end drop menu --><br />
</div> <!-- end navigation --><br />
</div><br />
</div><br />
<!-- For IE 6 --><br />
<script type="text/javascript"><br />
window.onload = function() {<br />
var lis = document.getElementsByTagName('li');<br />
for(i = 0; i < lis.length; i++) {<br />
var li = lis[i];<br />
if (li.id == 'mainTeam' || li.id == 'mainProject' || li.id == 'mainParts' || li.id == 'mainModeling' || li.id == 'mainNotebook') {<br />
li.onmouseover = function() { this.getElementsByTagName('ul').item(0).style.display = 'block'; }<br />
li.onmouseout = function() { this.getElementsByTagName('ul').item(0).style.display = 'none'; }<br />
}<br />
}<br />
}<br />
</script><br />
</body></html></div>Shollehttp://2010.igem.org/Team:Davidson-MissouriW/TeamBioTeam:Davidson-MissouriW/TeamBio2010-10-26T03:17:45Z<p>Sholle: New page: This is the page that Steph requested....feel free to use it for whatever.</p>
<hr />
<div>This is the page that Steph requested....feel free to use it for whatever.</div>Sholle